ID: 1184739037

View in Genome Browser
Species Human (GRCh38)
Location 22:46416464-46416486
Sequence CTGGTCACTCAGGCCGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184739031_1184739037 12 Left 1184739031 22:46416429-46416451 CCTCGCTTCCAGGACATAAAGCT 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1184739037 22:46416464-46416486 CTGGTCACTCAGGCCGAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 138
1184739032_1184739037 4 Left 1184739032 22:46416437-46416459 CCAGGACATAAAGCTCAGTAGCT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1184739037 22:46416464-46416486 CTGGTCACTCAGGCCGAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 138
1184739030_1184739037 17 Left 1184739030 22:46416424-46416446 CCAGGCCTCGCTTCCAGGACATA 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1184739037 22:46416464-46416486 CTGGTCACTCAGGCCGAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 138
1184739029_1184739037 18 Left 1184739029 22:46416423-46416445 CCCAGGCCTCGCTTCCAGGACAT 0: 1
1: 0
2: 0
3: 9
4: 164
Right 1184739037 22:46416464-46416486 CTGGTCACTCAGGCCGAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184739037 Original CRISPR CTGGTCACTCAGGCCGAGCA AGG Intronic
900150692 1:1178074-1178096 CCTGTCACTCAGGCGGGGCAGGG + Intronic
904755799 1:32767912-32767934 CTGCACACTCAGGCCCAGGAGGG + Exonic
905448607 1:38043460-38043482 CTGGTGACCCAGGCCGAGGTGGG + Intergenic
914955303 1:152156642-152156664 CTTGTCTCTCAGGCTGACCATGG + Exonic
915589247 1:156861230-156861252 CTGGTCAGGCAGGACGAGCACGG + Intronic
918345179 1:183601565-183601587 ATGGTGAATCAGGCTGAGCACGG + Intergenic
920187028 1:204166169-204166191 TTGGTAACTCAGGCAGAGAAGGG - Intronic
922719901 1:227895014-227895036 CTGGTGACTCAGGGTTAGCATGG + Intergenic
1063273833 10:4541701-4541723 CGGGTCATTCAGGCCCAGCTGGG + Intergenic
1063459197 10:6204467-6204489 CCGGTGATTCAGACCGAGCAGGG - Intronic
1063575748 10:7260486-7260508 CAGGCCTCTCAGGCAGAGCAAGG + Intronic
1064574353 10:16729443-16729465 CTGGCCACTCAGGCTGAAAAGGG + Intronic
1069212636 10:65780258-65780280 CTGGTAGCACAAGCCGAGCAGGG + Intergenic
1071509362 10:86251487-86251509 CTGGTCCCTCAAGCCTTGCAGGG + Intronic
1073072720 10:100805148-100805170 CTGGCCTCCCAGACCGAGCATGG - Intronic
1073294429 10:102430457-102430479 CTGGGCTCTCAGGCCGGGCACGG - Intronic
1074010767 10:109477066-109477088 AAGGTCACTCAGGCAGTGCAAGG - Intergenic
1077410479 11:2401570-2401592 CAGGTCACTCTGGGCGGGCAAGG + Intronic
1082070789 11:47938017-47938039 ATGATCACACAGGCCGGGCATGG - Intergenic
1084107669 11:66990584-66990606 CTGTTAACTGAGGCCGGGCATGG + Intergenic
1089788484 11:120925049-120925071 CTGGTCTCTGAGGCAGAGCTGGG + Intronic
1090499047 11:127243888-127243910 CTGGTCACTCAGGCAGGTCACGG - Intergenic
1091038334 11:132254007-132254029 CTGGGAACTCAAGCCAAGCAGGG + Intronic
1091212137 11:133871235-133871257 CAGGTTCCTCAGGCAGAGCAGGG - Intergenic
1091878883 12:3960408-3960430 CTGTTCAGTCAGGCCAAGGATGG - Intergenic
1092764084 12:11836885-11836907 CTGGTTCCTCAGGCCTAGGAAGG - Intronic
1095112247 12:38310623-38310645 CTTGTCACTCAGGGCCAGCCAGG + Intergenic
1095311084 12:40697889-40697911 CAGGTTACTCAGCCAGAGCAGGG + Intronic
1096318286 12:50588438-50588460 CTGATGAATCAGGCCGGGCACGG - Intronic
1096518116 12:52169456-52169478 CTGGTCAATCAGGCTGATCATGG - Exonic
1096537406 12:52284036-52284058 CAGGTCACTAAGGCCCAGCTAGG + Intronic
1099471717 12:83058443-83058465 CTGGTCTCTCAGGGCCAGGAAGG - Intronic
1102471638 12:113162884-113162906 TCGGTCACTCACCCCGAGCATGG + Intronic
1104864667 12:131945785-131945807 TGGGTCACCCAGGCCGGGCACGG - Exonic
1109713005 13:66183499-66183521 CTGTTGACTCAGGCAGTGCATGG + Intergenic
1110118234 13:71846591-71846613 CTTGTCGCTCAGGCCGAGTGAGG - Intronic
1110758853 13:79207940-79207962 CTGGGAACTCAGGCCCTGCAGGG + Intergenic
1111829381 13:93307992-93308014 ATGGTGGCTCAGGCCGGGCACGG + Intronic
1112092758 13:96099416-96099438 CTGGGCACTCAGTCCAAGAATGG + Intronic
1112726309 13:102308616-102308638 CAGATCACTCAGGCAGAGCTGGG - Intronic
1113661068 13:112106666-112106688 CCGGTCACTCAGGCAGAACGGGG + Intergenic
1118904251 14:70011972-70011994 CTGGTGACACAGGACGACCATGG + Intronic
1120923829 14:89778846-89778868 ATGGTCTCTGAGGCTGAGCATGG + Intergenic
1121508961 14:94498125-94498147 CTGGGCACCCAGGCACAGCATGG + Exonic
1122617522 14:103030159-103030181 CTGGTCACTCCTGTCGGGCAAGG - Intronic
1124736520 15:32251593-32251615 ATTGTCACTCAGGCCGGGCGCGG - Intergenic
1132327802 15:100986313-100986335 CTGGTCTCTGAAGCTGAGCAGGG + Intronic
1132486859 16:197718-197740 CTGCTCACTCAGGCCGCATATGG - Intronic
1139691240 16:68643376-68643398 TTGCTCTCTCAGGCCTAGCATGG - Intronic
1140065913 16:71611096-71611118 CTGGTCACCCAGGCTGAGTCGGG + Intergenic
1142319757 16:89373478-89373500 CCTGTGACTCAGGCCGTGCACGG - Intronic
1142869503 17:2810876-2810898 CTAGTCACCCAGGCTGAGCTTGG + Intronic
1144675787 17:17160783-17160805 CTGGTCACACAGGCCAGGCTAGG - Intronic
1144850120 17:18240005-18240027 CAGTTCACACAGGCAGAGCAGGG + Intronic
1146860778 17:36296351-36296373 CTGGCCAATCAGGCCGGACATGG - Intronic
1146867122 17:36347052-36347074 CTGGTTAATCAGTCCAAGCAAGG + Intronic
1146956848 17:36940937-36940959 TTGGGCACCCAGGCCGAGCCAGG + Intronic
1147069992 17:37947661-37947683 CTGGTTAATCAGTCCAAGCAAGG + Intergenic
1147081514 17:38027181-38027203 CTGGTTAATCAGTCCAAGCAAGG + Intronic
1147091107 17:38100446-38100468 CTGGCCAATCAGGCCGGACATGG - Intergenic
1147097465 17:38151156-38151178 CTGGTTAATCAGTCCAAGCAAGG + Intergenic
1147106105 17:38220057-38220079 CTGGCCAATCAGGCCGGACATGG + Intergenic
1148423402 17:47568459-47568481 CTGGCCAATCAGGCCGGACACGG - Intronic
1148858838 17:50593601-50593623 CTGGTCACTCTGGCCCTGCTGGG + Intronic
1150079171 17:62221279-62221301 CTGGTTAATCAGTCCAAGCAAGG + Intergenic
1151599102 17:75095274-75095296 CTTCTCACACAGGCAGAGCAGGG + Intronic
1161889927 19:7027630-7027652 CTGGTCATTTAGGCCGGGCGCGG + Intergenic
1161891525 19:7043116-7043138 CTGGTCATTTAGGCCGGGCGCGG - Intergenic
1161893609 19:7061573-7061595 CTGGTCATTTAGGCCGGGCGCGG - Intergenic
1163561463 19:18021796-18021818 CTTGTCAATCAGGCCCAGCAGGG - Intergenic
1163849332 19:19654512-19654534 CTGGGGCCTCAGGCCCAGCAAGG - Intronic
1165892224 19:39120223-39120245 CTGGGCACTCAGGCTGGGCATGG - Intergenic
1166719982 19:44991134-44991156 CTGGTCTGGCAGGCCGGGCAGGG - Intronic
925499728 2:4489434-4489456 CTGTTCCCTCAGGCAGTGCAGGG + Intergenic
925509955 2:4614648-4614670 ATGGTCACTGGGACCGAGCACGG + Intergenic
926123477 2:10257220-10257242 CTCGACCCTCAGGCTGAGCACGG + Intergenic
926743798 2:16134172-16134194 CTGGGCAGTCTGGCTGAGCATGG + Intergenic
928433860 2:31241097-31241119 CCAGTCACTGAGGCCAAGCAGGG + Intronic
929811338 2:45191429-45191451 CTGCCCACTCTGGCCGGGCAAGG - Intergenic
930063859 2:47312660-47312682 CTGGTCAGTCAGGCAGAACTGGG - Intergenic
930943937 2:57048490-57048512 CTTGTCACACACGCCGAACATGG - Intergenic
936558482 2:113516133-113516155 CTGCTGCCTCAGTCCGAGCATGG + Intergenic
946701198 2:222416100-222416122 CTGGTCTCTCAGGGCAAGGATGG - Intergenic
947373945 2:229476171-229476193 CTGCTCACTTGGGCAGAGCAGGG - Intronic
947466060 2:230347574-230347596 CTGGCCACTGAGGCTGGGCAGGG + Intronic
948986890 2:241531078-241531100 TTGGTCACTCTGGGCGAGCACGG + Intergenic
1171897417 20:30821486-30821508 CAGGGCACTCAGGCCAAGCCAGG + Intergenic
1175914240 20:62418403-62418425 CCGGTGAGTCAGGCCAAGCAGGG - Exonic
1176205480 20:63885889-63885911 GTGCTCAGTCAGGCCCAGCAGGG - Intronic
1179726567 21:43344389-43344411 CTGCTCATTTTGGCCGAGCAAGG + Intergenic
1179891219 21:44335979-44336001 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891235 21:44336031-44336053 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891251 21:44336083-44336105 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891267 21:44336135-44336157 CTGGGCACACTGGCTGAGCAGGG - Intronic
1181474116 22:23158134-23158156 CTGGTCACTCACACCCACCACGG - Intronic
1182518112 22:30870349-30870371 CTGCACAGCCAGGCCGAGCAGGG - Intronic
1182577226 22:31281135-31281157 CTGGACACACAAGCCGGGCACGG + Intergenic
1183372036 22:37438304-37438326 GTGGTCACTGAGGCCGGGGACGG - Intergenic
1184119779 22:42442231-42442253 CTGGTCATTGGGGCCGAGCTGGG + Intergenic
1184739037 22:46416464-46416486 CTGGTCACTCAGGCCGAGCAAGG + Intronic
1184865448 22:47199527-47199549 CTGGTCATTCAGGCTCAGCTTGG + Intergenic
1185295672 22:50052929-50052951 CAGCTCACTCTGGCGGAGCACGG + Intronic
950104217 3:10378165-10378187 GAGGTAACTGAGGCCGAGCATGG + Intronic
950239061 3:11351543-11351565 TTGCTCTCTCAGGCCCAGCATGG - Intronic
950522884 3:13506887-13506909 CTGGTCACTCTGCCCGGCCAAGG - Intergenic
950798041 3:15527087-15527109 CTGGTCTCTCTGGCCCAGAATGG + Intergenic
952795940 3:37239202-37239224 CTGGGCTCTCAGGTTGAGCAGGG - Intergenic
953366196 3:42347574-42347596 CTCCTCACCAAGGCCGAGCAGGG - Intergenic
953579229 3:44138337-44138359 CTTGTCAGTCAGCCCCAGCATGG - Intergenic
956459152 3:69454306-69454328 GTGGGCACTGAGGCCGAGGAGGG - Intronic
962875888 3:139535787-139535809 CTGACCTCTCAGACCGAGCAGGG + Intronic
967203827 3:187101320-187101342 CTGGGCTCTGAGGCTGAGCAAGG + Intergenic
969315739 4:6380542-6380564 CAGGTCACCCAGGCAGAGGAAGG + Intronic
982894436 4:160900230-160900252 CTGGTCATTCCTGCAGAGCAAGG - Intergenic
986415246 5:7521685-7521707 CTGGTTTCTCAGACCCAGCAGGG - Intronic
986742661 5:10717580-10717602 CTGTTCCCTCAGGCAGCGCAGGG - Intronic
987060900 5:14242960-14242982 CTGTTCCCTCTGCCCGAGCAAGG - Intronic
991587336 5:68214982-68215004 GAGGTCACTCAGGCAGACCACGG - Intergenic
994169074 5:96639387-96639409 CAGCTCACTCAGGCCAAACATGG - Intronic
994651202 5:102531138-102531160 CTTGTCACCCAGGCTGAGTACGG - Intergenic
998376309 5:141693087-141693109 CTTGGCACACAGCCCGAGCATGG + Intergenic
999282794 5:150375980-150376002 GTGCTCCCTCAGGCAGAGCATGG + Intronic
1004187312 6:13432038-13432060 CCGGTGACTCAGCCCCAGCAAGG + Intronic
1004305767 6:14500614-14500636 TTTGTCACTCAAGCAGAGCATGG - Intergenic
1004473166 6:15947087-15947109 CTGGTCACTAAGCCCAAGCAGGG - Intergenic
1006918650 6:37613350-37613372 CTGGGCCCCCAGGCAGAGCAAGG + Intergenic
1007735852 6:43981771-43981793 GTGGTCACTCAGGCCCACCCAGG - Intergenic
1019560010 7:1651215-1651237 CTGGGTCCTCAGGCCGAGGATGG + Intergenic
1020268788 7:6579488-6579510 CTGGATACTGAGGCCGAGCGTGG - Intronic
1026545209 7:71316330-71316352 CTGGTCACTCAAGCTGAACAAGG + Intronic
1028141410 7:87279456-87279478 CTGTTCCCTCAGGCAGTGCAGGG - Intergenic
1032364327 7:131285186-131285208 CTGGTCTCAGAGGCCTAGCAGGG + Intronic
1033309058 7:140246585-140246607 CTAGTCCTTCAGGCAGAGCATGG - Intergenic
1035482548 7:159198861-159198883 CTGGTCACTGAGGCAGAGCTTGG - Intergenic
1037481055 8:19306054-19306076 ATGGTGTCTCAGGCCGGGCACGG + Intergenic
1041327435 8:56683244-56683266 CTGTTCACTCAAGCCCAGGATGG - Intergenic
1045913460 8:107437974-107437996 CTAGTCACGCAGGTCCAGCAGGG - Intronic
1048332879 8:133483049-133483071 ATGCTCACGCAGGCCGGGCATGG + Intronic
1052753835 9:32520853-32520875 CTGGTGACTCAGGCCGGGTGTGG + Intronic
1053283850 9:36838230-36838252 CTGGTCACCCAGGCCAGGGATGG - Exonic
1053735594 9:41100126-41100148 CTGCTGCCTCAGTCCGAGCATGG - Intergenic
1054692784 9:68331274-68331296 CTGCTGCCTCAGTCCGAGCATGG + Intronic
1059543961 9:115157861-115157883 ATGGTCAAATAGGCCGAGCATGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1186207597 X:7216644-7216666 CTGCTCACTCAGACTGAGGATGG + Intergenic
1194956978 X:100192375-100192397 CTGTTCATTGAGGCCGGGCACGG + Intergenic
1196730216 X:118934142-118934164 CTGGTCTTTCAGGCCAGGCATGG + Intergenic
1198531138 X:137550267-137550289 CTTGTCAATCACGCCGAGCTCGG - Intergenic
1199396525 X:147345002-147345024 TTTGTCACTCAGGCCGGGCATGG - Intergenic
1201579428 Y:15495315-15495337 CTGCTCACTCAGACTGAGGATGG + Intergenic