ID: 1184740726

View in Genome Browser
Species Human (GRCh38)
Location 22:46427627-46427649
Sequence AACCATTGCCAACAGTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184740726_1184740728 -4 Left 1184740726 22:46427627-46427649 CCACCGCACTGTTGGCAATGGTT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1184740728 22:46427646-46427668 GGTTGTTGACGTTCCGCTGTCGG 0: 1
1: 0
2: 0
3: 3
4: 18
1184740726_1184740729 -1 Left 1184740726 22:46427627-46427649 CCACCGCACTGTTGGCAATGGTT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1184740729 22:46427649-46427671 TGTTGACGTTCCGCTGTCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184740726 Original CRISPR AACCATTGCCAACAGTGCGG TGG (reversed) Intronic
900572891 1:3368100-3368122 ATCCATTCCCAACAGAGGGGAGG + Intronic
903899177 1:26630726-26630748 AAGCATTGCCTGCAGTGGGGTGG - Intergenic
905150927 1:35926910-35926932 AACCATTGCCAAGAGGATGGTGG - Exonic
912666155 1:111581494-111581516 GGCCATTGCCAACAATGTGGAGG + Intronic
916471760 1:165130392-165130414 AGCCATTGCCAACAGTAGTGAGG + Intergenic
921567006 1:216733602-216733624 AACCATTGCAAAAAAAGCGGTGG + Intronic
1065382400 10:25103177-25103199 AGCCAATGCCAACAATGCTGGGG - Intergenic
1075328157 10:121551341-121551363 ACCCAATGCCAACCATGCGGTGG - Exonic
1076001838 10:126918700-126918722 AGCCATTGCCAACTGTCCCGGGG + Intronic
1076099566 10:127764881-127764903 ACCCCTTGCCAACTGTGCCGGGG + Intergenic
1077802299 11:5552162-5552184 AACCATTGTCAAAATTGCTGTGG - Intronic
1078949372 11:16112153-16112175 AACCATTAACTACAGTTCGGTGG - Intronic
1083011222 11:59401527-59401549 AAGCATTGCCCACAGCGGGGTGG - Intergenic
1083708156 11:64530777-64530799 AACAATGACCACCAGTGCGGTGG - Intergenic
1090117899 11:123994348-123994370 AAACAATGACAACAGTGAGGTGG + Exonic
1101217075 12:102595582-102595604 AAACATTGCCGACAGTAGGGGGG - Intergenic
1102772980 12:115494710-115494732 TACCATTGCCTACCATGCGGTGG - Intergenic
1106784765 13:33095646-33095668 AACCATTGCAAACAATATGGAGG + Intergenic
1107439807 13:40415669-40415691 AACCACTCTCAACAGTGCGGAGG - Intergenic
1108182520 13:47854933-47854955 AACCATCGCCAAGTGGGCGGGGG + Intergenic
1111304311 13:86386047-86386069 AATCATAGCCAACAGAGGGGTGG + Intergenic
1115179051 14:30600983-30601005 GCCCAGTGACAACAGTGCGGAGG - Intronic
1122338774 14:101010875-101010897 CACCATTGCCAACATTTTGGTGG + Intergenic
1123220606 14:106851795-106851817 GACCATGGACAAGAGTGCGGAGG - Intergenic
1132514306 16:359206-359228 AAGCACTGGCAACAGGGCGGGGG + Intergenic
1135144452 16:19949383-19949405 AACCATTGCTAGCTGTGGGGAGG - Intergenic
1143500048 17:7333580-7333602 AGCCTTTGGCAAGAGTGCGGTGG + Intergenic
1157063398 18:44320114-44320136 AACAATTGCTAAGAGTCCGGAGG + Intergenic
929834411 2:45381617-45381639 AACAATTGCAAACAGTGCTGCGG - Intergenic
941625087 2:167822661-167822683 AACCAGTGCCAAGAGAGAGGAGG - Intergenic
943352125 2:186807727-186807749 AACCACTTCCAACATTGTGGAGG - Intergenic
946256301 2:218444703-218444725 AGCCAGTGACAACAGTGGGGTGG + Intronic
1174886201 20:54337917-54337939 AACAATAGGCAACAGTGAGGGGG + Intergenic
1177570453 21:22879153-22879175 AACCAGTGCCAACACTGCTGTGG - Intergenic
1177791560 21:25727956-25727978 TACCATTGCCAAAACTGAGGAGG - Intronic
1184740726 22:46427627-46427649 AACCATTGCCAACAGTGCGGTGG - Intronic
953273800 3:41474841-41474863 AAACATTGGCAACAATGTGGAGG + Intronic
957385205 3:79487345-79487367 AGCCATTGCAAACAGTACTGTGG - Intronic
962059439 3:131910176-131910198 AACACTTGCCAACAGTGTGCTGG - Intronic
969079329 4:4606354-4606376 AACCAATGACAACAATCCGGGGG + Intergenic
969297060 4:6276448-6276470 AACTAAGGCAAACAGTGCGGTGG - Intronic
975601816 4:76108535-76108557 AATCATTGCTAACAGTGGAGTGG - Intronic
979073559 4:116241663-116241685 CACCATTGGCAAAAGTGCTGTGG - Intergenic
981054373 4:140345089-140345111 AACCAGTGCCAACAGTGGACTGG - Intronic
987058947 5:14223494-14223516 AAGCATTGGGAACAGGGCGGTGG + Intronic
992552669 5:77874117-77874139 ACCCATTTCCATCAGTGCAGTGG + Intergenic
993575622 5:89596509-89596531 CACCATTTCCCACAGTGAGGAGG - Intergenic
997634585 5:135395691-135395713 AACCATTGCTCACAGAGCTGGGG + Intronic
1000913635 5:167052797-167052819 AACTATTTCCAACAGTGCCCAGG - Intergenic
1001381464 5:171309245-171309267 AAACTTTGCCAAGAGTGCGCGGG - Intergenic
1001447237 5:171794961-171794983 AACAATTGCCAAGAATGAGGTGG + Intergenic
1001576397 5:172767116-172767138 GACCATTGCTAACATTGTGGAGG - Intergenic
1003033753 6:2624698-2624720 CACCAATGCCCACAGTCCGGAGG + Intronic
1003888932 6:10546269-10546291 GACCAGTGCCAACAATGTGGCGG + Intronic
1006394114 6:33775967-33775989 AACCAGAGCCAACACTGGGGGGG + Intronic
1007737743 6:43992287-43992309 GACCATGCCCAACAGTGTGGGGG + Intergenic
1010719277 6:79263959-79263981 AATCATTGCCTGCAGTGCGGTGG + Intergenic
1017959043 6:159206004-159206026 CACCATTGCAAACAGAGGGGAGG - Intronic
1018138492 6:160802919-160802941 ATGCAGTTCCAACAGTGCGGAGG - Intergenic
1018200746 6:161392610-161392632 CACCACTTCCAACAGTGTGGTGG + Intronic
1018410277 6:163538409-163538431 AACCTTAGCGAAAAGTGCGGTGG + Intronic
1018964823 6:168476132-168476154 AACCATCTCCAACTGTGCAGAGG + Intronic
1022747146 7:33184151-33184173 AAGCATTGCCTGCAGTGGGGTGG + Intronic
1023653064 7:42390676-42390698 AACCAGTGCTAACAGGGAGGAGG + Intergenic
1024081414 7:45859209-45859231 TACCACTTCCAACAGTGCGATGG + Intergenic
1037271180 8:17132050-17132072 AATCATTGCATACAGTGCTGTGG + Intergenic
1049468993 8:142766981-142767003 CACCTTTGGCAACAGTGAGGCGG - Intronic
1053887018 9:42651329-42651351 AACCAATGCCAGCAGTGCATCGG - Intergenic
1054226038 9:62458779-62458801 AACCAATGCCAGCAGTGCATCGG - Intergenic
1055785489 9:79865230-79865252 TACCATTGACAGCAGTGCTGTGG + Intergenic
1056740738 9:89252671-89252693 AATTATTGCCAACAGTATGGTGG - Intergenic
1061669458 9:132180479-132180501 AACCTTTGCCCACAGTTCTGGGG + Intronic
1062408177 9:136407797-136407819 AGCCATCGCCCACAGTGCCGTGG + Intronic
1193425473 X:81336976-81336998 TACCATTGGCAGCAGTGCAGAGG + Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1200208995 X:154337440-154337462 ATCCCTTGCCAACAGAGCTGAGG + Intergenic
1200221881 X:154394688-154394710 ATCCCTTGCCAACAGAGCTGAGG - Intronic