ID: 1184740931

View in Genome Browser
Species Human (GRCh38)
Location 22:46428746-46428768
Sequence CCAGGAGGCCCAGAGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 938
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 874}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184740931_1184740941 27 Left 1184740931 22:46428746-46428768 CCCAGCAGCTCTGGGCCTCCTGG 0: 1
1: 0
2: 4
3: 59
4: 874
Right 1184740941 22:46428796-46428818 GCTCACTCACGGGTCCCCAGCGG 0: 1
1: 0
2: 0
3: 6
4: 126
1184740931_1184740939 16 Left 1184740931 22:46428746-46428768 CCCAGCAGCTCTGGGCCTCCTGG 0: 1
1: 0
2: 4
3: 59
4: 874
Right 1184740939 22:46428785-46428807 CTCACTGCACAGCTCACTCACGG 0: 1
1: 0
2: 2
3: 21
4: 191
1184740931_1184740942 28 Left 1184740931 22:46428746-46428768 CCCAGCAGCTCTGGGCCTCCTGG 0: 1
1: 0
2: 4
3: 59
4: 874
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data
1184740931_1184740940 17 Left 1184740931 22:46428746-46428768 CCCAGCAGCTCTGGGCCTCCTGG 0: 1
1: 0
2: 4
3: 59
4: 874
Right 1184740940 22:46428786-46428808 TCACTGCACAGCTCACTCACGGG 0: 1
1: 0
2: 3
3: 20
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184740931 Original CRISPR CCAGGAGGCCCAGAGCTGCT GGG (reversed) Intronic
900109044 1:997979-998001 CCTGGAGGGCCAGTGCTGGTGGG + Intergenic
900128991 1:1079735-1079757 TCGGGAGGCTCAGAGCAGCTTGG + Intergenic
900311146 1:2033697-2033719 CCAGGAGGGCCAGAGGTTCCTGG - Intergenic
900313608 1:2046584-2046606 CCAGGTGCCCCAGCCCTGCTGGG + Intergenic
900613811 1:3555395-3555417 GGTGGAGGCCCAGAGCGGCTTGG - Intronic
900680049 1:3911668-3911690 CCAGGAGGCCCAGCGGGACTTGG + Intergenic
900902572 1:5526977-5526999 CCAGGCGTCCCAGGGCTGATGGG + Intergenic
901396720 1:8987211-8987233 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
901630687 1:10646826-10646848 CCTGGGGGCTCACAGCTGCTGGG + Intronic
902348809 1:15838154-15838176 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
902406078 1:16184398-16184420 CCAGGAGTCCCAGAGCTGGCCGG - Intergenic
902906474 1:19561862-19561884 CCAGGAGGTCCAGACTAGCTTGG - Intergenic
903118840 1:21200558-21200580 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
903279026 1:22239533-22239555 CCAGGAGGCCCACACCTGTGTGG + Intergenic
903426035 1:23254995-23255017 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
903627753 1:24743849-24743871 CCAGGAGGCCCAGACATGGGAGG - Intergenic
903878852 1:26494979-26495001 CCAGGAGTCCAAGAGCAGCTTGG + Intergenic
903952778 1:27005825-27005847 CCAGGAGGCCCAGCACTGCAGGG - Exonic
904188918 1:28728247-28728269 CCAGGTGGCCTTAAGCTGCTAGG - Intergenic
904271918 1:29355741-29355763 CCTGGAGGCCCAAGGCTGTTGGG + Intergenic
904470095 1:30730645-30730667 CCAGGAGGCCCTGAACTTCCCGG - Intergenic
904504350 1:30938460-30938482 CCAGGAGTTCCAGACCAGCTTGG - Intronic
904629890 1:31833073-31833095 CCCTGAGTCCCAGAGCTGATTGG - Intergenic
905120702 1:35679637-35679659 CCAGGAGGCCTAGAGATGTGGGG - Intergenic
905393084 1:37650628-37650650 CCAATAGGCCCAGAGCAACTGGG - Intergenic
906061040 1:42948717-42948739 CCAGGAGTTCCAGACCAGCTTGG + Intronic
906724553 1:48034676-48034698 ACAGAAGGCCCAGATCTTCTAGG - Intergenic
907243094 1:53091420-53091442 TCAGGAGCTCCAGACCTGCTGGG + Intronic
907274253 1:53308420-53308442 CCTGGAGGGCCAGTGATGCTTGG - Intronic
907304687 1:53506989-53507011 CCAGGGGGCCCAGGGCAGCTGGG + Intronic
907326562 1:53642088-53642110 CCAGCAGGCCCAGAGCTTGTGGG + Intronic
908098387 1:60764430-60764452 CAAGGATGGCCAGAGATGCTGGG + Intergenic
908226067 1:62057035-62057057 CCAGGAGTTCCAGACCAGCTTGG - Intronic
908267054 1:62389862-62389884 CCAGGAGTTCCAGATCAGCTTGG - Intergenic
908408371 1:63837609-63837631 CCAGGAGTTCCAGACCAGCTTGG + Intronic
908740591 1:67323268-67323290 ACAGGAGGCCCTGAGCTGGAAGG - Intronic
909410196 1:75341289-75341311 CCAGGAGTTCCAGAGCAGCCTGG + Intronic
909805595 1:79870929-79870951 CCAGAAGGTCAAGAACTGCTTGG + Intergenic
910452689 1:87363053-87363075 CCTGGAGGCCCAGAGGTATTTGG - Intergenic
911024378 1:93421523-93421545 CCAGGAGTCCCAGACCAGCCTGG - Intergenic
912717387 1:111991523-111991545 CCAGGAGTCCCGGAGCTGTGTGG + Intergenic
913024151 1:114819039-114819061 CCAGGAGGCCCAGAGCAGCCTGG - Intergenic
914446120 1:147751954-147751976 CCAGGAGTCCCAGGGCAGCCTGG - Intergenic
914726126 1:150329237-150329259 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
914756062 1:150562173-150562195 CCTGGAAGCCCAGAGCTGGGCGG + Intergenic
914802368 1:150971053-150971075 CCAGGAGAGCCAGGGATGCTGGG + Intronic
915108271 1:153547529-153547551 CTAGGAGGCCCAGAGATGTGAGG - Exonic
915554323 1:156652944-156652966 TCAGGTGACCCAGAGCTGCAGGG - Intronic
916093088 1:161324317-161324339 CCAGGAGTTCAAGACCTGCTTGG - Intronic
916163801 1:161946202-161946224 CCAGGAGTTCGAGAGCAGCTGGG - Intronic
917374608 1:174336332-174336354 CCAGGAGTTCCAGACCAGCTTGG - Intronic
917747385 1:178023972-178023994 CCAGGAGGCCAAGACCAGCCTGG + Intergenic
918606781 1:186437247-186437269 CCAGGAGGGACAGAGCTTCAGGG - Intergenic
918682041 1:187367898-187367920 CCAGGAGTTCCAGACCTGCCTGG - Intergenic
919922918 1:202177091-202177113 CCAGGATGCCCAGAGCTGGGTGG - Intergenic
920341294 1:205276611-205276633 CCAGCAGGCCCAAATGTGCTGGG - Intergenic
920447349 1:206028715-206028737 TCAGGTGGCCCACAGCTGCAAGG - Intergenic
920547667 1:206832042-206832064 CCAGCAGGGCCTGAGCTGCCTGG - Intronic
921131703 1:212225195-212225217 CCAGGATGCCCACAGCTGGGTGG + Intergenic
921881961 1:220265713-220265735 CCAGGAGTTCAAGACCTGCTTGG + Intronic
922195475 1:223355949-223355971 CCTGCAGGCCCTGACCTGCTGGG + Intronic
922236500 1:223726421-223726443 CCAGGAGGGTCAGGGCTGCAGGG + Intronic
922242178 1:223762896-223762918 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
922726451 1:227925131-227925153 CCAGCCTGCCCAGAGCTCCTGGG - Intronic
922795738 1:228338580-228338602 AGAGCAGGCCCAGAGCTGCCTGG + Intronic
922962791 1:229662731-229662753 CCAGGAGTCCCAGACCAGCCTGG - Intergenic
923617799 1:235552210-235552232 CCAGGAGGTCCGCAGCTGCCTGG + Exonic
923724952 1:236497635-236497657 CCAGGAGGTCAAGAGCAGCCTGG + Intergenic
923888867 1:238188741-238188763 CCAGGAGTCCAAGACCTGCCTGG - Intergenic
924531276 1:244895919-244895941 CCAGGAGTTCCAGAGCAGCTTGG - Intergenic
924812027 1:247411405-247411427 CCAGGAGGCCAAGAGCAGCCTGG - Intergenic
1062823273 10:550593-550615 CCAGGAGGAGAAGAGCTTCTGGG - Intronic
1063427050 10:5958594-5958616 CCAGGAGTCCCAGACCAGCCTGG - Intronic
1063650046 10:7926008-7926030 CCAGGAGTTCAAGAGCAGCTTGG + Intronic
1064144099 10:12813996-12814018 CCAGGAGGTCCAGACCAGCCTGG - Intronic
1064233896 10:13555520-13555542 CCAGGAGGTCGAGATCAGCTTGG + Intergenic
1064717185 10:18188512-18188534 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
1064987016 10:21220943-21220965 CCAGGAGTCCCAGACCAGCCTGG + Intergenic
1065047951 10:21760967-21760989 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1065154649 10:22856733-22856755 CCAGGAGAGCCAGACCAGCTTGG + Intergenic
1065484256 10:26221866-26221888 GCAGGAGGCCAAGGGCTGCAGGG + Intronic
1065614690 10:27507826-27507848 CCAGGAGTCCGAGACCAGCTTGG + Intronic
1065845154 10:29737094-29737116 CCAGGGAGCCCTGAGCCGCTGGG - Intergenic
1066184205 10:32993157-32993179 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1066758427 10:38732656-38732678 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
1066963230 10:42240038-42240060 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1067014476 10:42746614-42746636 CCAGGAGTTCCAGATCAGCTTGG - Intergenic
1067162994 10:43842809-43842831 GCAAGAGCCCCAGAGCTGCCAGG + Intergenic
1067165473 10:43863500-43863522 ACAGGAGGGCCATTGCTGCTTGG + Intergenic
1067471315 10:46540727-46540749 CCAGGAGTTCAAGAGCTGCCTGG + Intergenic
1067702937 10:48586881-48586903 CCTGGAGACCCAGAGCTACTGGG + Intronic
1067856033 10:49794292-49794314 CCAGGAGTCCCAGACCAGCCTGG + Intergenic
1067924181 10:50491135-50491157 CCAGGAGTTCAAGAGCAGCTGGG + Intronic
1068139548 10:52988350-52988372 CCAGGAGGTCCAGAGCAGCCTGG - Intergenic
1068775604 10:60864898-60864920 CCAGGAGGTCAAGACCAGCTTGG - Intergenic
1068895214 10:62191352-62191374 CCAGGAGTTCAAGAGCAGCTTGG - Intronic
1069383836 10:67866343-67866365 CCATGAGGCAAAGAGCTGCAAGG - Intergenic
1069654903 10:70080524-70080546 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1069759833 10:70801135-70801157 CCAGGAGGTCGAGAGCAGCCTGG + Intergenic
1069794363 10:71042825-71042847 CCTCGGGGCCCAGAACTGCTGGG + Intergenic
1069849009 10:71393090-71393112 GCAGGAGGCTCAGAGCTGGGGGG - Intergenic
1070126401 10:73625736-73625758 CGGGGAGGACTAGAGCTGCTGGG - Intronic
1070406779 10:76104497-76104519 CAGGGAGACCCAGAGCTGCAGGG - Intronic
1070406786 10:76104533-76104555 CAGGGAGACCCAGAGCTGCAGGG - Intronic
1070533783 10:77360390-77360412 CCAGGGGCCAGAGAGCTGCTGGG + Intronic
1071137366 10:82467722-82467744 GTAGAAGGCCCAGAGCTGTTTGG - Intronic
1071505361 10:86228559-86228581 CCAGGCATCCCAGAGCTGCCAGG + Intronic
1071514924 10:86291092-86291114 TCTGGGGGCTCAGAGCTGCTGGG - Intronic
1072312303 10:94168131-94168153 CCAGGGGTCCTAGAGCTACTCGG + Intronic
1072323148 10:94270877-94270899 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
1073223969 10:101900770-101900792 CCAGGAGTTCAAGAGCAGCTTGG + Intronic
1074105999 10:110390076-110390098 CCAGGAGTTCGAGACCTGCTTGG + Intergenic
1074704688 10:116120359-116120381 CCAGGAGCCCAAGAGCGGCCTGG + Intronic
1075245599 10:120819365-120819387 CGAGGTGGCCAAGAGCTGCGTGG - Intergenic
1075402617 10:122172035-122172057 CCAGCAAGCCCAGAGGTGGTTGG + Intronic
1076128089 10:127992040-127992062 CCTGGGGGCCCCGAGGTGCTGGG - Intronic
1076642375 10:131927435-131927457 ACAGGAGGCCCAGAGCTTGGCGG + Intronic
1077225766 11:1438508-1438530 CTAGCAGGGCCAGGGCTGCTGGG - Intronic
1077476350 11:2792183-2792205 CCTGCAGGCCCAGAGCAGCGTGG + Intronic
1077797810 11:5509566-5509588 GCAGGAGGCCCAGATCTGTGGGG + Exonic
1078043610 11:7892781-7892803 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1078085382 11:8230541-8230563 CCTTGAGGCCCAGAGCTACGGGG - Intronic
1078552881 11:12292565-12292587 CCATGAGATACAGAGCTGCTAGG + Intronic
1079493343 11:21013359-21013381 CCAGGAAGATTAGAGCTGCTTGG + Intronic
1080494602 11:32804338-32804360 CCAGGAGTTCGAGACCTGCTTGG - Intergenic
1080550206 11:33367833-33367855 CCAGGAGTTCCAGATCAGCTTGG - Intergenic
1080615021 11:33938187-33938209 CCAGGAGTTCGAGAGCAGCTTGG - Intergenic
1080838079 11:35958979-35959001 CCTGGAGGCCCAATGCTGCTGGG - Intronic
1080891464 11:36412161-36412183 TCAGGGAGCCCAGAGCTGCCTGG - Intronic
1081518757 11:43860824-43860846 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1081692577 11:45088275-45088297 CCAAGTGGCCCAGGGGTGCTGGG + Intergenic
1082049309 11:47757701-47757723 TCAGGAGTCCAAGAGCAGCTAGG - Intronic
1082223207 11:49667836-49667858 CAAGGAGGCCCAGAGCTTCCCGG + Intergenic
1082817287 11:57517483-57517505 CCAGGAGTTCAAGACCTGCTTGG + Intergenic
1082831104 11:57617963-57617985 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1083119499 11:60497382-60497404 CCAGGAGCCATAAAGCTGCTTGG - Exonic
1083176718 11:60954714-60954736 TGAGGAGCCCCAGAGCTGGTGGG + Intergenic
1083264821 11:61541878-61541900 CCAAGAGGCCAAGAGCAGCCTGG + Intronic
1083397496 11:62401707-62401729 CCTGCAGGCCCTGACCTGCTGGG - Intergenic
1083706556 11:64520459-64520481 CCAGGAGGTCAAGACCAGCTTGG - Intergenic
1084037151 11:66518970-66518992 CCAGGAGTCCAAGACCAGCTTGG - Intronic
1084233177 11:67768167-67768189 CCAGGAGGACCAGAGCATTTGGG - Intergenic
1084602229 11:70152669-70152691 GCAGGAAGCCCAGAGGTGCCAGG - Intronic
1084705864 11:70815683-70815705 CCAGGAGGCACTGGGTTGCTTGG + Intronic
1085425501 11:76401080-76401102 CCAGGAGTTCAAGAGCAGCTTGG - Intronic
1085772343 11:79336829-79336851 CCAGGAGGCCCCCAGTTGCTGGG + Intronic
1086202516 11:84221011-84221033 CCAGGAGTTCAAGAGCAGCTTGG - Intronic
1086625848 11:88951394-88951416 CAAGGAGGCCCAGAGCTTCCCGG - Intronic
1088241260 11:107775826-107775848 CCAGGAGTCCAAGACCTGCCTGG + Intergenic
1088626897 11:111736039-111736061 AAAGGAGGCCCAGTGGTGCTAGG - Intronic
1089061511 11:115629761-115629783 CCAGCAGGGCCAGAGCTACGGGG - Intergenic
1089230539 11:116970854-116970876 CCAGGAGTTCCAGATCAGCTTGG - Intronic
1089267545 11:117276398-117276420 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1089746796 11:120623340-120623362 CCAGGAGGCCAAGACCAGCCTGG - Intronic
1089955589 11:122568165-122568187 CCAGGAGTTCGAGACCTGCTTGG + Intergenic
1090176265 11:124652483-124652505 CCAGGAGTCCCAGACCAGCCTGG + Intronic
1091326140 11:134689645-134689667 CCGTGAGGCCCAGAGTTCCTCGG - Intergenic
1091594137 12:1864551-1864573 GCAGCAGGCACAGAGCTGCTGGG - Intronic
1091626094 12:2122072-2122094 CCAGGAGGTCCAGAGTTGAGGGG - Intronic
1091687428 12:2573255-2573277 CCAGGAGTTCCAGACCTGCCTGG - Intronic
1091819853 12:3467873-3467895 CCAGGTGGCCCACAGCTGGGAGG - Intronic
1092127267 12:6083718-6083740 CCACGGGGCACAGAGCTGCTAGG + Intronic
1092222525 12:6724606-6724628 TCAGGATGTCCAGAGCTGCAAGG - Exonic
1092254651 12:6919814-6919836 CCATAAGGTCCAGAGTTGCTGGG - Intronic
1094238585 12:28195893-28195915 CCAGGAGTTCAAGAGCAGCTTGG + Intronic
1094483874 12:30908540-30908562 CCATGAAGCCCAGAGCTGTGTGG + Intergenic
1094486284 12:30928012-30928034 TTAGGTGGCCCAGAGCTGTTTGG + Intronic
1095894335 12:47265435-47265457 CCAGGAGTCCCAGACCAGCCTGG - Intergenic
1096019020 12:48306817-48306839 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1096150958 12:49312268-49312290 CCAGGAGGCTGAGACCAGCTTGG + Intergenic
1096320320 12:50606328-50606350 CCAGGAGTTCCAGACCAGCTTGG - Intronic
1096388045 12:51208061-51208083 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1096706380 12:53424852-53424874 CCAGGAGTCCCAGGGCTCCCTGG - Exonic
1097051107 12:56223862-56223884 CCAGGAGTTCCAGACCTGCCTGG - Intronic
1098225862 12:68322854-68322876 CCACTAGCCCAAGAGCTGCTTGG + Intronic
1098884790 12:75949608-75949630 CCAGGAGCTCAAGAGCAGCTTGG - Intergenic
1098903869 12:76141429-76141451 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1100194459 12:92228560-92228582 CCAGGAGGTCAAGACCAGCTTGG - Intergenic
1100300245 12:93300334-93300356 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
1101248605 12:102909747-102909769 CCAGGAGTTCCAGATCAGCTTGG + Intronic
1101413105 12:104485420-104485442 TCAGGAGGGCCACAGCTGCAGGG + Intronic
1102024810 12:109708405-109708427 CCAGGAGGCCCAGAGAGGGGAGG - Intergenic
1102896172 12:116600041-116600063 CCAGGAGAGCCAGAGCTGGCTGG + Intergenic
1103067575 12:117913011-117913033 CCAGCAGGCCCAGAGGTGAGAGG + Intronic
1103156837 12:118692741-118692763 CCATGGGGCCAAGTGCTGCTGGG - Intergenic
1103363135 12:120365770-120365792 GCAAGAGGCCCAGAGTTTCTAGG - Intronic
1103567874 12:121826118-121826140 CCAGGAGTTCCAGATCAGCTTGG - Intronic
1103646629 12:122398656-122398678 CCAGGAGTCTGAGAGCTGCCTGG + Intronic
1103699814 12:122843217-122843239 CCAGGCGGCCCTGGGCTGCATGG - Intronic
1103720751 12:122974170-122974192 CCAGGAGGCCCAGGGCAGGTCGG - Intronic
1103780594 12:123396243-123396265 CGAGGAGGCACACAGCTCCTTGG - Intronic
1103990834 12:124798199-124798221 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1104037482 12:125107571-125107593 CCAGGTGGTCCAGACCTGCAGGG - Intronic
1104286195 12:127426924-127426946 CCAGGAGAGCCAGAGCTGGAAGG - Intergenic
1104553357 12:129777922-129777944 CCAGGAGTTCAAGACCTGCTTGG + Intronic
1104584710 12:130038678-130038700 CCTGGAGGCCCTCAGCTGCTGGG - Intergenic
1104696158 12:130865468-130865490 CCAGGAGGTCAAGACCAGCTTGG - Intergenic
1104746041 12:131211104-131211126 CCAGCAACCCCTGAGCTGCTGGG + Intergenic
1104784987 12:131443602-131443624 GGAGGAAGCCCAGAGCTGCATGG + Intergenic
1104953106 12:132451252-132451274 CCTGGATGCCCTGAGCTGGTCGG - Intergenic
1104969469 12:132524643-132524665 CCTGGGGGCCCAGATGTGCTGGG + Intronic
1105303504 13:19154371-19154393 CCAGGGGGCCCAGTGCTCCCTGG + Intergenic
1105515974 13:21091047-21091069 CCAGGAGTTCCAGACCAGCTGGG - Intergenic
1105809082 13:23978909-23978931 CCAGGAGTTCAAGAGCAGCTGGG - Intergenic
1105962469 13:25354601-25354623 CCAGGAGTCCAAGATCAGCTGGG + Intergenic
1105989399 13:25603276-25603298 CCAGGAGTTCAAGAGCAGCTTGG + Intronic
1106109097 13:26760967-26760989 CCAGGAGGCTGAGAACTGCATGG + Intergenic
1106158637 13:27180780-27180802 CCAGGAGTTCCAGACCAGCTGGG + Intergenic
1106177778 13:27346018-27346040 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
1106285813 13:28317330-28317352 CCATCAGGCCCAGATATGCTGGG - Intronic
1107883673 13:44855977-44855999 CCAGGTGGCCCAGAGGGGCTGGG - Intergenic
1107949276 13:45447176-45447198 CCAGGACGCCAGGAGCTGCAGGG - Intergenic
1108334354 13:49423506-49423528 CCAGGAGTTCCAGAGCAGCCTGG + Intronic
1110373246 13:74763207-74763229 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
1112032790 13:95472929-95472951 CCAGGAGGTCAAGAGCAGCCTGG + Intronic
1112365045 13:98749302-98749324 CCAGGAGGCTGAGATCTGGTGGG + Intronic
1112397040 13:99042971-99042993 TCAGAAGGGCCATAGCTGCTTGG - Intronic
1112525617 13:100143971-100143993 CCAGGAGTTCCAGACCAGCTTGG - Intronic
1112599903 13:100844794-100844816 CCAGGAGGTCAAGAGCAGCCTGG + Intergenic
1113589312 13:111487031-111487053 CCAGGACCCCCACAACTGCTTGG + Intergenic
1113684685 13:112274598-112274620 CCCTGAGGCCCAGCCCTGCTGGG + Intergenic
1113741698 13:112715998-112716020 CCAGCCTGCCCAGAGCTGCTGGG - Intronic
1113750824 13:112775443-112775465 CCTGGAGGCCCCAGGCTGCTGGG - Intronic
1113964639 13:114145815-114145837 CCAGGAGGCCTGGAGCTGCTGGG - Intergenic
1114205229 14:20564636-20564658 CCAGGAGGACCAGACCACCTGGG + Intergenic
1114302384 14:21390023-21390045 CCAGGAGTTCCAGAGCAGCTTGG + Intronic
1114313188 14:21486125-21486147 CCAGGAGTTCCAGATCAGCTTGG + Intronic
1114837850 14:26224645-26224667 CCTGGATCTCCAGAGCTGCTTGG - Intergenic
1115644508 14:35358947-35358969 CCAGGAGTCCGAGACCAGCTTGG + Intergenic
1115724109 14:36194421-36194443 CCAGCAGCCGCAGAGCAGCTGGG - Intergenic
1115851775 14:37595110-37595132 AGAGGAAGCCCAGAGCTGCGGGG + Intronic
1117015093 14:51509833-51509855 CCAGGAGTTCCAGAGCAGCTTGG - Intronic
1117277807 14:54207239-54207261 CCAGGAGTTCCAGACCTGCCTGG - Intergenic
1117744446 14:58854118-58854140 CCAGGAGTTCCAGAGCAGTTGGG - Intergenic
1117841969 14:59870041-59870063 CCAGGAGGCTCCGAGCTGTAGGG - Intronic
1117903167 14:60556850-60556872 CCAGGAGTTCCAGACCTGCCTGG + Intergenic
1118238009 14:64028462-64028484 CCAGGAGGTCTAGACCAGCTTGG - Intronic
1118868209 14:69719600-69719622 CCAAGAGGCAAACAGCTGCTCGG + Intergenic
1119028896 14:71176126-71176148 CCAGGAGTTCGAGAGCAGCTTGG - Intergenic
1119067853 14:71548685-71548707 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1119117045 14:72033442-72033464 CCAGGAGTTCCAGACCAGCTGGG - Intronic
1119177445 14:72579609-72579631 CCAGGATGCTCAGAGGGGCTGGG - Intergenic
1119209618 14:72821371-72821393 CCAGGAGTCCAAGACCTGCCTGG + Intronic
1119597628 14:75950756-75950778 CCAGGAGTTCCAGAGCAGCCTGG + Intronic
1119731456 14:76953764-76953786 CCAGCAGGCCCTGAGCTCCAAGG + Intergenic
1119745674 14:77042208-77042230 CCAGCAGGCACAGAGCTGAAGGG + Intergenic
1121047246 14:90797052-90797074 CCAGGAGTTCCAGACCAGCTTGG - Intronic
1121173634 14:91874276-91874298 CAAGGAGGCTGGGAGCTGCTGGG - Intronic
1121362650 14:93276003-93276025 CCAGGAGTCCAAGACCAGCTTGG + Intronic
1121443311 14:93962693-93962715 TCAGGAGTCCCAGGGATGCTTGG - Intronic
1121755834 14:96401333-96401355 ACAGGAGGCCCCGATCTGTTTGG - Intronic
1122189138 14:100026039-100026061 CCAGGAGCCCCAGATCAGCCTGG + Intronic
1122772896 14:104105119-104105141 CCTGGAGACCCTGAGCTGGTAGG + Intronic
1202917959 14_KI270723v1_random:2812-2834 CCAGGAGGCCGGGTGCAGCTGGG - Intergenic
1202926665 14_KI270724v1_random:31771-31793 CCAGGAGGTCGGGAGCAGCTGGG + Intergenic
1123441837 15:20297372-20297394 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
1123934372 15:25187048-25187070 CCAGGGGTCCCAGTGCTGCTTGG + Intergenic
1124009941 15:25830209-25830231 CCAGGAAGGCCAGCGCTGCATGG - Intronic
1124440009 15:29678801-29678823 TCAGGAGGACCAGAGCTGCTGGG - Intergenic
1124605135 15:31163900-31163922 CCAGGAGGCCCAGAGATAGGAGG - Intergenic
1124611955 15:31215355-31215377 CCCGGCGTCCCAGAGCTGCTGGG + Intergenic
1126097661 15:45100785-45100807 CCAGAAGCCCCAGAGCTGGGAGG - Exonic
1126195408 15:45925423-45925445 CCAGGATGCCCAGAGATTCATGG - Intergenic
1126404174 15:48305688-48305710 CCAGGAGTTCAAGAGCAGCTTGG - Intergenic
1126439155 15:48668885-48668907 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
1126469952 15:48998744-48998766 CCAGGAGTTCCAGACCAGCTTGG - Intronic
1127293248 15:57588927-57588949 TCAGGAGGGCCAGAATTGCTTGG + Intergenic
1127822876 15:62675522-62675544 CCAGGAGCCCCTGGGCAGCTGGG + Intronic
1128309040 15:66619262-66619284 CCAGGAGGCCCAGAGTTTTCTGG - Intronic
1129269576 15:74412220-74412242 CCAGGAGGCCCAGGGGTCCCTGG + Intronic
1129271023 15:74419310-74419332 GCAGGAGGACCAGGGCTCCTTGG + Intronic
1129890161 15:79066579-79066601 CCAGGGGACTCAGAGCTGCATGG + Intronic
1130412134 15:83655681-83655703 CCATGGGGGCCAGAGCTGGTTGG + Intronic
1130533666 15:84767372-84767394 CCAGCAGCCTCAGACCTGCTGGG - Intronic
1130564020 15:84979905-84979927 CCGAGAGGACTAGAGCTGCTTGG + Intergenic
1131739444 15:95371771-95371793 CCTGGAAGCCAAGAGCTGATTGG - Intergenic
1131906209 15:97145767-97145789 CCAGAGGGCACAGAGCTCCTGGG + Intergenic
1132574492 16:658257-658279 GCAGGTGGCCCAGAGCTGCAGGG - Exonic
1132764372 16:1526829-1526851 CCAGGGGGCCCTGAGGTGCTGGG - Intronic
1132887899 16:2190446-2190468 CCGGCAGGCACAAAGCTGCTGGG + Intronic
1133002660 16:2858852-2858874 CCAGGATTCAAAGAGCTGCTGGG + Intergenic
1133160225 16:3906801-3906823 CCAGGAGGTCGAGACCAGCTTGG + Intergenic
1133223218 16:4328053-4328075 CCAGGAGGCGCAGAGGGGCGTGG + Intronic
1133231126 16:4367076-4367098 CCAGGAGCCACAGAGTGGCTGGG + Intronic
1133236810 16:4391211-4391233 CCAGGAGTTCCAGAGCAGCCTGG + Intronic
1133376822 16:5294017-5294039 CCAGGAGTTCGAGACCTGCTTGG + Intergenic
1133746963 16:8694585-8694607 CCAGGAGTTCCAGACCAGCTTGG - Intronic
1133901738 16:9981995-9982017 CCAGGAGTTCCAGACCTGCCTGG - Intronic
1134096262 16:11420900-11420922 ACAGGAGGTCCAGGTCTGCTGGG + Intronic
1134123835 16:11602899-11602921 CCAGGAGTCCCAGACCAGCCTGG + Intronic
1134508943 16:14830857-14830879 CCAGGAGTTCCAAAGCAGCTTGG - Intronic
1134696644 16:16229691-16229713 CCAGGAGTTCCAAAGCAGCTTGG - Intergenic
1134975189 16:18565014-18565036 CCAGGAGTTCCAAAGCAGCTTGG + Intergenic
1135100364 16:19599829-19599851 CCAGGAGTTCAAGACCTGCTTGG + Intronic
1135502935 16:23012873-23012895 CCAGGAGTCCCTGACCAGCTTGG + Intergenic
1135519976 16:23168805-23168827 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1135812287 16:25599119-25599141 CCAGGAGTCCCAGGCCTGCCTGG - Intergenic
1136174684 16:28508473-28508495 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1136244809 16:28968625-28968647 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1136274856 16:29173448-29173470 CCAGGAGGCTCAGAGCCCCAAGG + Intergenic
1136286983 16:29250175-29250197 CCAGGAGTTCAAGAGCTGCTTGG - Intergenic
1136414302 16:30094410-30094432 CAGGGAGGCCCAGAGATGTTAGG - Intronic
1136453743 16:30369402-30369424 CCTCGAGGCCCAGAGATGCCAGG + Exonic
1136620088 16:31422898-31422920 CCAGGAGTTCCAGACCAGCTGGG - Intronic
1136687984 16:32007158-32007180 CCAGGAGTCCGAGACCAGCTTGG + Intergenic
1136719371 16:32308141-32308163 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1136724400 16:32346539-32346561 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1136837743 16:33514421-33514443 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1136842723 16:33552580-33552602 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1137013102 16:35344167-35344189 CCAGGAGACCCAGTGCAGCCGGG - Intergenic
1137033052 16:35543354-35543376 CCAGGAGACCCAGTGCAGCAGGG - Intergenic
1137530780 16:49277548-49277570 CCCGGAGGCACAGGGCTGCAAGG + Intergenic
1137591522 16:49696801-49696823 CCTGGAGGCCCAGGCCTGCATGG - Intronic
1137656639 16:50164840-50164862 CCAGGAGTTCAAGAGCAGCTTGG + Intronic
1138432667 16:56979034-56979056 CCAGGAGTCTCAGACCAGCTGGG - Intronic
1138466675 16:57197933-57197955 CCAGGAGGCTGAGACCAGCTTGG - Intronic
1138598521 16:58041910-58041932 ACAGGGGGCCCAGAGCAGCCAGG - Intronic
1139418178 16:66831082-66831104 CCAAGAGCCCCAGACCCGCTCGG - Intronic
1139428865 16:66900457-66900479 ACAGGACACCCAGATCTGCTGGG - Intergenic
1139646952 16:68338453-68338475 CAAAGAGGCCCAGAGATGCATGG + Intronic
1139696334 16:68677969-68677991 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
1139722929 16:68871827-68871849 CCAGGAGTCCAAGACCTGCCTGG - Intronic
1139774494 16:69307733-69307755 CCAGGAGGTCCAGACCAGCCTGG + Exonic
1139840282 16:69873133-69873155 CCAGGAGACCCAGAGCAGCATGG + Intronic
1139964948 16:70740277-70740299 CCACGGGGCCCAATGCTGCTGGG - Intronic
1140299419 16:73741552-73741574 CCTGGCTGCCCAGAGCTGCTTGG - Intergenic
1140742471 16:77953703-77953725 CCAGGAGTTCCAGACCAGCTTGG - Intronic
1140746219 16:77982771-77982793 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
1141410441 16:83829411-83829433 CCAGGAGGCCAACAGCAGCCTGG + Intergenic
1142079153 16:88139205-88139227 CCAGGAGGCTCAGAGCCCCAAGG + Intergenic
1142092587 16:88222806-88222828 CCAGGAGTTCAAGAGCTGCTTGG - Intergenic
1142262168 16:89048131-89048153 CCTGGAGGGCCGGCGCTGCTGGG + Intergenic
1142316327 16:89348139-89348161 CCAGGAGTTGCAGAGCAGCTTGG - Intronic
1142380706 16:89730399-89730421 CCAGCAGCCCCAGACCTTCTGGG - Intronic
1203002030 16_KI270728v1_random:171216-171238 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
1203007060 16_KI270728v1_random:209628-209650 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
1203133634 16_KI270728v1_random:1707622-1707644 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
1203147923 16_KI270728v1_random:1814707-1814729 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1203152888 16_KI270728v1_random:1852878-1852900 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1142694322 17:1625047-1625069 CCAGGAAGCCCCGTGCTTCTCGG + Intronic
1143089579 17:4441311-4441333 CCAGGAGTTCGAGACCTGCTTGG + Intronic
1143214111 17:5211310-5211332 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1143228596 17:5330811-5330833 CCAGGAGGCCAAGACCAGCCTGG + Intronic
1143643846 17:8216779-8216801 CCAGGAGTTCGAGACCTGCTTGG - Intergenic
1143919179 17:10317389-10317411 CAAGGAGGCACAGGGCTGCGTGG + Intronic
1144348633 17:14372962-14372984 CCAGGAGGCCTTGAACTGTTGGG + Intergenic
1144386185 17:14751202-14751224 GCAGGAGGCCCAGAGCACCTGGG - Intergenic
1144460272 17:15452938-15452960 CCAGTGGGCCAAGAGTTGCTTGG - Intronic
1144550984 17:16240708-16240730 CCAGGAGTTCAAGACCTGCTTGG - Intronic
1144692252 17:17275294-17275316 CCAGGAGCTCCAGACCTGCCTGG - Intronic
1144904012 17:18625333-18625355 CCAGGAGGACCAGTGGTACTTGG - Intergenic
1145023914 17:19453397-19453419 CCACGAGGCCCACAGCAGCTGGG - Intergenic
1145128572 17:20321409-20321431 CCAGGAGGACCAGTGGTACTTGG + Intergenic
1145181386 17:20755830-20755852 CCAGGAGGTCCAGAGCACCCTGG + Intergenic
1145196047 17:20895906-20895928 CCAGGAGGACCAGTGGTACTTGG - Exonic
1145979384 17:29002826-29002848 CCAGGAGCCCTAGTGCTGCAAGG - Intronic
1146009090 17:29179969-29179991 CCAGGTGGCCCGGAGCTGCGGGG - Intronic
1146415790 17:32631434-32631456 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1147995071 17:44355752-44355774 CCAGCAGGGCCAGGGCTGCCAGG + Exonic
1148110827 17:45144004-45144026 CCAGGAGGCCCGGACCAGTTGGG + Exonic
1148376824 17:47155739-47155761 CCAGGAGTTCCAGATCAGCTTGG + Intronic
1149142196 17:53445030-53445052 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
1149801636 17:59573541-59573563 CCAGGAGGTCGAGACCTGCCAGG - Intronic
1149815443 17:59718739-59718761 CCAGGAGGTCCAGACCAGCCTGG - Intronic
1149855176 17:60076489-60076511 CCAGGAGTCCAAGACCAGCTTGG + Intronic
1150422824 17:65054518-65054540 CCAGGAGTTCCAGACCAGCTGGG - Intronic
1150425620 17:65074798-65074820 CCAGGGGGCTCTAAGCTGCTGGG - Intergenic
1150463461 17:65372001-65372023 CCAGGAGGCCAAGGACTGCCTGG - Intergenic
1151415062 17:73956779-73956801 CCAGGAGGCCAAGGCCTGCAGGG - Intergenic
1151467789 17:74298831-74298853 CCAGGAATCCAAGAGCAGCTTGG - Intronic
1151602631 17:75115647-75115669 CCAGGAGGTCAAGAGCAGCCTGG + Intronic
1151948589 17:77333434-77333456 CCAGGAGTTTCAGACCTGCTTGG - Intronic
1151955978 17:77380455-77380477 CCAGTTGGCCCAGAGATGCCAGG - Intronic
1152073537 17:78145629-78145651 CCAGCAGGTCCCCAGCTGCTTGG + Intergenic
1152119783 17:78411386-78411408 AGAGGAGGCCCAGAGCTGGGAGG + Intronic
1152198574 17:78931929-78931951 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1152234678 17:79132553-79132575 GCAGGAGTGCCAGAGCTGCTGGG + Intronic
1152457752 17:80425870-80425892 GCAGGAGGCTCAGAGAGGCTGGG - Intronic
1152880435 17:82811752-82811774 CCAGGAAGCCAGGAGTTGCTGGG + Intronic
1153838826 18:8988380-8988402 CCAGGAGCCTGAGAGCTGCAGGG + Intergenic
1154977287 18:21471828-21471850 CCAGGAGTTCCAGACCAGCTTGG - Intronic
1155076334 18:22359165-22359187 CCAGGAGTTCAAGACCTGCTTGG + Intergenic
1155645979 18:28078257-28078279 CCAGGAGGTCAACAGCTGATTGG - Intronic
1155860992 18:30899267-30899289 GCAGGTGGCCAAGTGCTGCTAGG + Intergenic
1155975041 18:32119631-32119653 CCAGGAGGCCGAGACCAGCTTGG - Intronic
1156401923 18:36747422-36747444 CCAGCAGACCCAGAGATGCAGGG - Intronic
1157364374 18:47050085-47050107 CCAGGAGTCCCAGACCAGCCTGG - Intronic
1157522465 18:48354883-48354905 CCAGGAGGCCTGGAGCTGAGGGG - Intronic
1157742230 18:50103538-50103560 CCAGGAGTTCAAGAGCAGCTAGG + Intronic
1157948165 18:52004531-52004553 TCAGGAAGCCAAGAGTTGCTAGG + Intergenic
1158125445 18:54095453-54095475 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
1159052849 18:63437616-63437638 CCAGGAGTCCAAGACCAGCTTGG - Intergenic
1159510809 18:69396394-69396416 CCAGGAGTTCCAGAACAGCTTGG + Intergenic
1160023154 18:75196416-75196438 CCAGGAGTTCCAGAGCAGCCTGG + Exonic
1160024495 18:75207093-75207115 CCAGGAGACCCAGCGCAGCCCGG + Intronic
1160043606 18:75367490-75367512 CCAGCAGCCCCAGAGCTGGGAGG - Intergenic
1160057027 18:75492638-75492660 CCAGGAGGCTTAGAGATGCCAGG + Intergenic
1160522243 18:79514363-79514385 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1160776670 19:859707-859729 CTAGGAGGACCAGAACTGCCAGG - Exonic
1161071995 19:2267119-2267141 CCAGGAGGGCCCCAGCTCCTGGG - Intronic
1161072089 19:2267610-2267632 CCAGGAGGCCCCCAGCTCCTGGG + Intronic
1161247179 19:3259548-3259570 CCAGGAGGACCCCAGCTCCTGGG + Intronic
1161260226 19:3333637-3333659 CCAGGGGTCCCAGAGCAGCCCGG - Intergenic
1161261052 19:3337918-3337940 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1161276334 19:3420109-3420131 CCAGGAGTTCCAGACCAGCTAGG + Intronic
1161441805 19:4296126-4296148 CCAGGAGGTCGAGACCAGCTTGG - Intronic
1161478499 19:4499026-4499048 CGAGGAGGCCGTGGGCTGCTGGG + Intronic
1161952575 19:7476009-7476031 CCAGGTGGCTCTGAGCAGCTGGG - Intergenic
1162139892 19:8579367-8579389 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
1162359392 19:10208879-10208901 CCAGGAGGTCAAGACCTGCCTGG - Intronic
1162390244 19:10385470-10385492 CCAGGAGTCCCAGACCAGCCTGG + Intergenic
1162713709 19:12614951-12614973 CCAGGAGTTCCAGACCAGCTTGG - Intronic
1162829191 19:13273955-13273977 CCAGGAGGCCAAGACCAGCCTGG - Intronic
1162841296 19:13358354-13358376 CCAGGAGTTCCAGACCTGCCTGG + Intronic
1162910001 19:13843305-13843327 CCAGGAGGCCGTGAGCCCCTGGG + Intergenic
1163028299 19:14526992-14527014 CCAGGAGTTCCAGAGCAGCCTGG + Intronic
1163034687 19:14563876-14563898 CCTGGGGGCCCAGATCAGCTGGG + Exonic
1163155060 19:15435393-15435415 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1163162971 19:15476395-15476417 CCACTAAGCCCAGAGCTGTTAGG - Exonic
1163208757 19:15824389-15824411 CCAGGAGGCCCAGACCTAAGGGG + Intergenic
1163294319 19:16402428-16402450 CCAGGAGGCCCACAGGAGCCTGG - Exonic
1163296284 19:16414914-16414936 CCAGGAGGTCCAGACCAGCCTGG - Intronic
1163725655 19:18921789-18921811 GCAGGTGGTCCAAAGCTGCTAGG - Intronic
1163752921 19:19089015-19089037 CCAGGAGTTCAAGAGCAGCTTGG - Intronic
1163772264 19:19198250-19198272 CCAGGAGGCTGAGAGGTCCTGGG - Intronic
1163837823 19:19586202-19586224 CCAGGAGTCCCAGACCAGCCTGG + Intronic
1164531322 19:29050454-29050476 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1164826554 19:31288748-31288770 CCAGGAGTTCCAGAGCAGCATGG - Intronic
1165169746 19:33883554-33883576 CCAGGAGTTCCAGACCTGCCTGG - Intergenic
1165253561 19:34559134-34559156 CCTGGTGACCCAGAGCTGCCCGG - Intergenic
1165395279 19:35560480-35560502 CCTGGCGGCCCAGGGCTGCAAGG - Exonic
1165419395 19:35715556-35715578 CCAGGAGGGGCAGCCCTGCTGGG + Intronic
1165747379 19:38237968-38237990 CCAGGAGATCCAGAGGTGTTGGG + Intergenic
1165761970 19:38326855-38326877 CGAGGAGGCCTGGAGCTTCTTGG + Exonic
1165884827 19:39070688-39070710 CCAGGAGTTCAAGAGCAGCTTGG - Intergenic
1165893674 19:39129371-39129393 CCAGAAGGCCCACTGCTGCACGG - Intronic
1166061152 19:40326469-40326491 CCCGGCGGGCCAGGGCTGCTGGG + Exonic
1166351488 19:42200622-42200644 GTTGGAAGCCCAGAGCTGCTGGG + Intronic
1166400670 19:42477270-42477292 CCAGGAGTCCAAGAGCAGCCTGG + Intergenic
1166777417 19:45321666-45321688 CCAGGAGTCCCAGACCAGCCTGG - Intronic
1166928765 19:46288303-46288325 CCAGGAGGTCCAGACCAGCCTGG + Intergenic
1166977955 19:46616009-46616031 CCAGGAGTTCAAGAGCAGCTTGG - Intergenic
1166998179 19:46729763-46729785 CCAGGAAGCCCTCAGCTGCATGG - Intronic
1167426698 19:49433302-49433324 CCAGGAGTTCCAGACCAGCTTGG - Intronic
1168017899 19:53588105-53588127 CCAGGAGTCCAAGAGCAGCCTGG - Intergenic
1168295531 19:55375783-55375805 CCTGGTGGGCCAGAGCTGCTCGG - Intergenic
1168617560 19:57850716-57850738 CCTGGCGGCCCAGAGCTCTTGGG + Intronic
925093311 2:1172795-1172817 CAGGGAGGGCCTGAGCTGCTGGG + Intronic
925916213 2:8608270-8608292 CCAGGAGCTCCAGGGCTGCCAGG + Intergenic
926114512 2:10203981-10204003 GCTGGATCCCCAGAGCTGCTTGG + Intronic
927061187 2:19422684-19422706 CCAGGAGGTCAAGACCAGCTTGG - Intergenic
927882285 2:26697293-26697315 CCAGGAGGTCCAGACCAGCCCGG + Intronic
928296803 2:30090710-30090732 CCTGGAGGCTCAGAGATGTTAGG + Intergenic
928957393 2:36883958-36883980 TCAGGAAGCCTGGAGCTGCTGGG + Exonic
929432799 2:41902609-41902631 CCAGGAGTTCAAGAGCAGCTTGG + Intergenic
929622724 2:43372911-43372933 CCAGGAGTCCAAGAGCAGCCTGG - Intronic
929649949 2:43668761-43668783 CCAGGAGTTCGAGACCTGCTTGG + Intronic
930027902 2:47040602-47040624 CCAGAAAGCCCTGAGCTTCTTGG - Intronic
931153917 2:59606365-59606387 CCAGGAGTCCCAGATCAGATTGG - Intergenic
931349872 2:61477439-61477461 CCAAGAGTCCCAGACCTGCCTGG - Intergenic
931512456 2:63015554-63015576 CCAGGAGGCCCAGTCCAGCCTGG - Intronic
932003089 2:67902414-67902436 CCAGGAGGCTCAGTGCTGGGAGG - Intergenic
932085010 2:68750218-68750240 CCAGGAGTCCAAGACCAGCTGGG - Intronic
932122925 2:69118199-69118221 CCAGGAGTTCCAGAGCTGCCTGG + Intronic
932306913 2:70710395-70710417 CCATCAGGCCCAGAGCTTCTTGG - Intronic
932368842 2:71171032-71171054 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
932572375 2:72944900-72944922 CCAGGGGGCCCAGGACTGCTGGG + Exonic
932794764 2:74684752-74684774 CCAGGAGTTCCAGAGCAGCCAGG + Intergenic
933973659 2:87490527-87490549 CATGGAGGCCCTGATCTGCTTGG + Intergenic
933997289 2:87679286-87679308 GCAGGAGGCCCAGGGTTGTTGGG - Intergenic
934321741 2:91977097-91977119 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
934579530 2:95427331-95427353 CCTGGAGGCCCAGCCCTGCGGGG + Intergenic
934599914 2:95649394-95649416 CCTGGAGGCCCAGCCCTGCGGGG - Intergenic
934662740 2:96151786-96151808 CCAGGAGTTCCAGACCTGCCTGG + Intergenic
934678258 2:96265350-96265372 CCCGGAGGCGCAGGGCTGCCCGG - Exonic
934882681 2:97996894-97996916 CCAGGAGTTCGAGACCTGCTCGG - Intergenic
934931458 2:98429211-98429233 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
935131108 2:100261544-100261566 GCAGGTGGTCCAGGGCTGCTAGG + Intergenic
935299602 2:101682466-101682488 CCAGGAGACTCAGAGCTGGTGGG + Intergenic
935365646 2:102287488-102287510 TCAGGAGTTCCAGAGCAGCTTGG + Intergenic
936296563 2:111271624-111271646 GCAGGAGGCCCAGGGTTGTTGGG + Intergenic
936320068 2:111459686-111459708 CATGGAGGCCCTGATCTGCTTGG - Intergenic
937367731 2:121276421-121276443 CCAGGAGTTCAAGAGCAGCTTGG + Intronic
937904236 2:127045141-127045163 CAAGGAGGCCGAGAGCATCTCGG + Intergenic
938461968 2:131503327-131503349 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
939370582 2:141294511-141294533 CCAGGAGTTCCAGACCAGCTTGG + Intronic
940213131 2:151276261-151276283 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
940960933 2:159785183-159785205 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
941508922 2:166381801-166381823 CCAGGAGTTCAAGACCTGCTGGG + Intergenic
942664041 2:178297386-178297408 CCAGGAGTTCAAGAGCAGCTTGG + Intronic
943530033 2:189068085-189068107 CCAGGAGGACCAGAGGTACCTGG + Exonic
945804240 2:214470697-214470719 CCAGGAGTCCGAGACCTGCCTGG + Intronic
946006775 2:216531904-216531926 CCAGGAGTTCAAGATCTGCTGGG - Intronic
946053060 2:216880140-216880162 CCAGGAGGGCCATGCCTGCTAGG - Intergenic
946143484 2:217711537-217711559 CCCGGAGGCCCAGCCCTGCCAGG - Intronic
946299792 2:218815617-218815639 CCAGCAGGCACTGAGCAGCTTGG + Intergenic
946317178 2:218924011-218924033 CAAGGCTGCACAGAGCTGCTGGG + Intergenic
947733681 2:232444166-232444188 CCAGGGGACACAGAGGTGCTGGG + Intergenic
947873699 2:233454117-233454139 CCAGCAGGCGCAGAACTGCCGGG + Intronic
948106998 2:235422152-235422174 CCAGGAGTTCAAGATCTGCTAGG + Intergenic
948665415 2:239531718-239531740 CGAGGAGACCCAGAGTTCCTGGG + Intergenic
948767489 2:240230798-240230820 GCAGTAGGCCCAGCTCTGCTGGG + Intergenic
948997432 2:241589964-241589986 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997436 2:241590003-241590025 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997440 2:241590042-241590064 CTAGGACACGCAGAGCTGCTCGG + Intronic
948997444 2:241590081-241590103 CTAGGACACGCAGAGCTGCTCGG + Intronic
948997448 2:241590120-241590142 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997458 2:241590196-241590218 CTAGGACACACAGAGCTGCTCGG + Intronic
948997462 2:241590235-241590257 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997486 2:241590391-241590413 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997490 2:241590430-241590452 CTAGGACACGCAGAGCTGCTCGG + Intronic
948997494 2:241590469-241590491 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997498 2:241590508-241590530 CTAGGACACACAGAGCTGCTCGG + Intronic
948997509 2:241590583-241590605 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997519 2:241590661-241590683 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997534 2:241590778-241590800 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997556 2:241590934-241590956 CTAGGACACACAGAGCTGCTCGG + Intronic
948997560 2:241590973-241590995 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997570 2:241591051-241591073 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997585 2:241591168-241591190 CTAGGACACTCAGAGCTGCTCGG + Intronic
948997593 2:241591246-241591268 CTAGGACACTCAGAGCTGCTCGG + Intronic
949026555 2:241769047-241769069 CCTGGAGGCCCTCAGCAGCTGGG + Intergenic
1169485162 20:6024163-6024185 CCAGGAGTTCGAGAGCAGCTTGG - Intronic
1169833661 20:9853611-9853633 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
1170438626 20:16355261-16355283 CAGGGAAGCCTAGAGCTGCTGGG - Intronic
1171307280 20:24117227-24117249 CCAGGAGGGGCACTGCTGCTTGG + Intergenic
1171512263 20:25695758-25695780 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
1171726889 20:28631801-28631823 CCAGGAGCTCCAGACCAGCTTGG + Intergenic
1171978315 20:31609359-31609381 CCAGTAGGCCCACACCTGGTAGG - Intergenic
1172076625 20:32303353-32303375 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1172132320 20:32664120-32664142 CCAGGGAGACCAGAGCAGCTGGG - Intergenic
1172153973 20:32810773-32810795 CTGGGAGGCTCAGAGGTGCTCGG - Intergenic
1172184347 20:33021937-33021959 CCAGGATGCCAAGAGATGCTGGG + Intronic
1172296108 20:33812034-33812056 CCAGGAAGCACAGAAATGCTAGG - Intronic
1172638600 20:36426966-36426988 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1173589810 20:44215956-44215978 CCAGGAGTCCGAGAGCAGCCTGG - Intergenic
1173857740 20:46261674-46261696 CCAGCAGGCACAGTGCCGCTGGG - Intronic
1174560175 20:51425517-51425539 CCAGGAGGCCCAGCCCTGCCGGG + Intronic
1174782025 20:53398539-53398561 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1175105191 20:56610110-56610132 CCAGGAGTTCCAGAGCAGCCTGG - Intergenic
1175291885 20:57881504-57881526 CCTTGAGGCCCAGGGCTGGTGGG + Intergenic
1175780524 20:61679550-61679572 CCAGGAAGCCACTAGCTGCTGGG + Intronic
1175804570 20:61820385-61820407 CCCGGAGGCCCGCAGCTGCGTGG - Intronic
1175900759 20:62359063-62359085 CCCCGAGGCCCAGAGCTGCAGGG - Intronic
1176241936 20:64079441-64079463 CCAGGAGCCCCCGATCGGCTGGG + Exonic
1176262366 20:64188750-64188772 CCAGGAGGCCTAGAGATCTTGGG + Intronic
1176411605 21:6452150-6452172 GCAGGAGGGCCAGCGCTGCGTGG - Intergenic
1178132131 21:29585652-29585674 CCCGGAGGCCCACACCTGTTGGG - Intronic
1178262389 21:31111933-31111955 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
1178473741 21:32918216-32918238 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
1178491078 21:33052281-33052303 CCAGCAGACCCAGATCCGCTCGG - Intergenic
1178506708 21:33168726-33168748 CCAGGAGGCCAAGACCAGCCTGG + Intronic
1178955840 21:37021071-37021093 CCAGGAGGTCGAGACCTGCCTGG + Intergenic
1179227005 21:39463091-39463113 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
1179246800 21:39640297-39640319 ACAGGAGGCGCAGGGCTGGTGGG - Intronic
1179273441 21:39869258-39869280 CCAGGATGCTCAGCTCTGCTGGG + Intronic
1179399256 21:41069188-41069210 GCGGGAGGCCCGGAGCTGCAAGG + Intergenic
1179687099 21:43060472-43060494 GCAGGAGGGCCAGCGCTGCGTGG - Exonic
1179731985 21:43373156-43373178 CCCGGAGCCACAGAGCTGCCAGG + Intergenic
1179800910 21:43811156-43811178 CCAGGAGGGCCACAGCTGCAGGG - Intergenic
1181163814 22:20973193-20973215 CCAGGAGGCTCAGCCCTGCCTGG - Intronic
1181530364 22:23513894-23513916 CCATGAGGCCCAGAGAGGTTAGG + Intergenic
1181579665 22:23821063-23821085 CCAGGAGGATTACAGCTGCTGGG - Intronic
1181718796 22:24757399-24757421 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1182210969 22:28677435-28677457 CCAGGAGTTCCAGAGCAGCCTGG + Intronic
1182464565 22:30506347-30506369 CCAGGAGGTCCAGACCAGCCTGG - Intergenic
1182667362 22:31969617-31969639 CCAGGAGGTCCAGACCAGCCTGG + Intergenic
1182701643 22:32244737-32244759 CCAGGAGTTCCAGACCTGCCTGG - Intronic
1183364635 22:37400404-37400426 CCTGGAGGGCCAGGGCTGCCTGG + Intronic
1183412358 22:37662381-37662403 ACAGGAGGCCCAGAGCATTTGGG + Intronic
1183524308 22:38314678-38314700 CACGGAGGCCCATAGCCGCTTGG + Intronic
1183693419 22:39404372-39404394 CCAGGAGTTCCAGATCAGCTCGG + Intronic
1183706776 22:39479126-39479148 CCAGGAGGTCGAGACCAGCTTGG + Intronic
1183832434 22:40425484-40425506 CCTGGAGGGCAAGAGCTCCTAGG - Intronic
1184020646 22:41819121-41819143 GCAGGAGCCCCAGATTTGCTTGG + Intronic
1184222914 22:43111900-43111922 CCAGGAGGCACAGAAATGCCAGG + Intronic
1184636522 22:45836511-45836533 CCAGGAAGCCCAGGGCTCCCTGG + Intronic
1184653980 22:45932042-45932064 CCAGGGGCCCCAGAACTGCCTGG + Intronic
1184696301 22:46140975-46140997 CCGGGAGGCCCGGAGATGGTGGG + Intergenic
1184700394 22:46167831-46167853 CCAGGAGTCCGAGAGCAGCCTGG + Intronic
1184740931 22:46428746-46428768 CCAGGAGGCCCAGAGCTGCTGGG - Intronic
1184833603 22:47007155-47007177 CCAGGGGTCCCAAAGCTCCTGGG + Intronic
1184874193 22:47262650-47262672 CCAGGAGTCTCAGAGCTTCAAGG + Intergenic
1184913066 22:47549065-47549087 CCTGAAGGCCCTGAGCTCCTGGG + Intergenic
1184913073 22:47549082-47549104 CCTGGGGGCCCTGAGCTCCTGGG + Intergenic
1184982216 22:48102728-48102750 CCAGGTGGCTCCGAGCTGCTGGG + Intergenic
1185071265 22:48658050-48658072 CCAGGAAGCCGAGAGCTGAGGGG + Intronic
1185166471 22:49265468-49265490 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166482 22:49265501-49265523 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166493 22:49265534-49265556 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166504 22:49265567-49265589 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166515 22:49265600-49265622 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166526 22:49265633-49265655 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166561 22:49265732-49265754 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166583 22:49265798-49265820 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166594 22:49265831-49265853 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166618 22:49265897-49265919 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166655 22:49265996-49266018 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166666 22:49266029-49266051 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166701 22:49266128-49266150 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166725 22:49266194-49266216 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166749 22:49266260-49266282 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166773 22:49266326-49266348 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185166797 22:49266392-49266414 CGGGGAGGCCCAGAGCTTCCCGG + Intergenic
1185331810 22:50255356-50255378 CCAGGAGGTTCACAGCTGCGGGG + Exonic
949540628 3:5029305-5029327 CCAGGAGCTCAAGAGCTGCCTGG - Intergenic
950259859 3:11536001-11536023 CCAGGAGCCCCCCAACTGCTGGG + Intronic
950477639 3:13224000-13224022 CCCTCAGCCCCAGAGCTGCTGGG + Intergenic
950528739 3:13540211-13540233 GCTGAAGGTCCAGAGCTGCTTGG - Intergenic
950644340 3:14368194-14368216 CCAGGAGGCCCAGGTGTGGTGGG - Intergenic
951246568 3:20348404-20348426 CCAGGATGGCCAGATCTACTTGG + Intergenic
951846086 3:27086275-27086297 CCAGGAGACCCAGAAGGGCTAGG + Intergenic
951945588 3:28132239-28132261 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
952019762 3:29003942-29003964 CCAGGAGGGCAAGACCAGCTGGG - Intergenic
952323444 3:32298995-32299017 CCAGAAGTCCAAGAGCGGCTTGG - Intronic
952970645 3:38648700-38648722 CCGAGAGGCCAAGAGCTGGTGGG - Intronic
952987702 3:38801022-38801044 CCAGCTGACTCAGAGCTGCTTGG + Intergenic
953162955 3:40438672-40438694 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
953174481 3:40537390-40537412 CCAGGAGTCCGAGACCAGCTTGG + Exonic
953405323 3:42656973-42656995 GCAGGAGGCTCAGACCTGGTTGG + Intronic
953496437 3:43391488-43391510 CCAGGAGGCACAGGGATCCTTGG - Intronic
953607746 3:44422893-44422915 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
953977579 3:47393952-47393974 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
954133411 3:48571117-48571139 CCAGGAGGCCCAGGGGAGCCCGG + Exonic
954164314 3:48744067-48744089 CCAGGAGTCCGAGACCTGCCTGG - Intergenic
954167759 3:48774040-48774062 CCAGGAGTTCCAGACCAGCTTGG - Intronic
954261824 3:49444712-49444734 CCAGGAGTTCCAGACCTGCCTGG - Intergenic
954681073 3:52346273-52346295 CCTGGGGGCCCAGAGCTGCTGGG - Intronic
955061285 3:55493559-55493581 CCAGGAGGGCAAGACCTGGTTGG + Intergenic
955213637 3:56965041-56965063 CCAGGAGTTCCAGACCAGCTTGG + Intronic
955972190 3:64446436-64446458 CCAGGAGCTCCAGACCAGCTTGG + Intergenic
956169080 3:66418777-66418799 CGAGAAGCCCCAGAGCTTCTGGG - Intronic
956318895 3:67972996-67973018 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
957200978 3:77135616-77135638 CCAGGAGGCCAACAGCAGCCTGG - Intronic
957976710 3:87455050-87455072 CCAGGAGCTTCAGAGTTGCTAGG + Intergenic
959697007 3:109259175-109259197 CCAGGAGTTCAAGACCTGCTGGG - Intergenic
960011954 3:112843066-112843088 CCAGGAGGCCCACAACTCCTTGG - Intronic
960565722 3:119129773-119129795 CCAGGAGTTCCAGACCAGCTTGG + Intronic
961035917 3:123641579-123641601 CCAGGAGTTCCAGACCAGCTTGG - Intronic
961329052 3:126128287-126128309 CCAGGAGGCCCGGCCCTGCATGG + Intronic
961721955 3:128902938-128902960 CCAGTAGGAGCAGAGCTGCTTGG + Intronic
961786937 3:129352991-129353013 CCCTCAGCCCCAGAGCTGCTGGG - Intergenic
962145198 3:132833295-132833317 CCAGGAGGCCCAAACCCACTGGG - Intergenic
963165164 3:142194173-142194195 CCAGGAGTTCAAGAGCAGCTAGG + Intronic
963200965 3:142585423-142585445 CCAGGAGCTCCAGACCAGCTTGG - Intergenic
965704862 3:171496142-171496164 CCAGGAGGTCCAGACCAGCCTGG - Intergenic
968226889 3:196978260-196978282 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
968311397 3:197686503-197686525 CCAGGACCCGCAGAGCTGCGTGG - Intronic
968513418 4:1005097-1005119 CCAGGACGCCCAGCCCTGCCTGG - Intergenic
968656456 4:1780351-1780373 TCAGGAGGCCCACACCTGGTGGG + Intergenic
968667684 4:1829603-1829625 CCAGGAGTTCCAGACCAGCTTGG + Intronic
968967443 4:3776301-3776323 CCAGGCTGCCCAGTGCTCCTGGG - Intergenic
969301276 4:6298898-6298920 CCCCGAGGCCCGGAGCTGATGGG + Intronic
969327147 4:6450631-6450653 CCTGGAGCCCCAGAGGTGCACGG + Intronic
969333082 4:6491279-6491301 GCAGGAGGCACAGAGATGTTGGG - Intronic
969432558 4:7164354-7164376 CCAGGAGTTCCAGACCTGCCTGG - Intergenic
969535590 4:7754668-7754690 CCAGGAGGCACAGGGCTGGTAGG + Intergenic
969721636 4:8895508-8895530 CTAGGAGGCCCAGGGCAGCTGGG + Intergenic
970143571 4:13009631-13009653 CCAGGAGGTCAAGAGCAGCCTGG - Intergenic
970189923 4:13505392-13505414 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
971099700 4:23451383-23451405 CCAGGAGTTCCAGACCTGCCTGG - Intergenic
971175919 4:24282629-24282651 CCACTAGGCCCTGTGCTGCTTGG - Intergenic
971289283 4:25321722-25321744 CCAGGAGTTCCAGATCAGCTTGG - Intronic
971320389 4:25600778-25600800 CCAGGAGTCACAGACCAGCTTGG - Intergenic
971407862 4:26339028-26339050 CCAGGAGGTCCAGACCAGCCTGG - Intronic
972576407 4:40356102-40356124 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
972775780 4:42239142-42239164 CCATGAGCACCAGAGCTGCAAGG - Intergenic
973996747 4:56466700-56466722 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
974043473 4:56877872-56877894 CCAGGAGTTCCAGAGCAGCTTGG - Intergenic
974518887 4:62955201-62955223 CCAGGAGTTCCAGATCTGCCTGG - Intergenic
974572248 4:63667994-63668016 TCAGGAGTTCCAGAGCAGCTTGG - Intergenic
974883341 4:67786228-67786250 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
975935690 4:79577318-79577340 CCAGGAGTCCAAGACCAGCTTGG + Intergenic
976815153 4:89139340-89139362 CCAGGAGTCCCAGACCAGCCTGG + Intergenic
976833717 4:89346289-89346311 CCAGAAGGCCAAGACCTGCCTGG - Intergenic
978362336 4:107944513-107944535 CCAGGAGTTCCAGACCAGCTTGG - Intronic
978413249 4:108448151-108448173 CCAGGAGTCCCAGACATGCCTGG - Intergenic
979424742 4:120550923-120550945 GCAGGTGGGCCAGCGCTGCTGGG + Intergenic
981707742 4:147679220-147679242 CCAGGAGTTCCAGACCAGCTTGG + Intronic
982566403 4:156992440-156992462 TCAGCAGGCCCAGGGCTCCTGGG + Intergenic
983039558 4:162909194-162909216 CCAGGAGTTCAAGACCTGCTTGG + Intergenic
983226927 4:165094244-165094266 CCAGGAGTTCCAGACCAGCTTGG - Intronic
983569404 4:169188415-169188437 CCAGGGTGCACAGAGCTGCCTGG - Intronic
983986251 4:174063533-174063555 CCAGGAGGTCGAGACCAGCTGGG + Intergenic
984242484 4:177234357-177234379 CCAGGAGTTCCAGACCTGCCTGG + Intergenic
984347956 4:178555407-178555429 CCAGGAGTTCCAGACCTGCTTGG + Intergenic
984837219 4:184033268-184033290 CCAGGAGTTCCAGACCTGCCTGG - Intergenic
985403592 4:189615403-189615425 CCAGCAGGGCCAGCACTGCTGGG + Intergenic
985790769 5:1925942-1925964 CCAGAAGGCACAGAGCTCCAGGG - Intergenic
987295450 5:16546375-16546397 CCAGGAGTCCCAGACCAGCCTGG - Intronic
987602619 5:20091273-20091295 CCAGGAGTACCAGACCTGCTTGG + Intronic
988792436 5:34620938-34620960 CCAGGAGTTCAAGACCTGCTTGG - Intergenic
990326185 5:54677825-54677847 CCAGAAAGACCAGAACTGCTGGG + Intergenic
990433166 5:55757832-55757854 CCAGGAGTTCGAGACCTGCTTGG + Intronic
990949159 5:61279258-61279280 CCAGGAGTTCGAGACCTGCTTGG + Intergenic
991071603 5:62488791-62488813 CCAGGAGTCCCAGACCAGCCTGG + Intronic
991662142 5:68961351-68961373 CCAGGAGTTCAAGACCTGCTTGG + Intergenic
991955791 5:71994913-71994935 CCAGGATGCCTGGAGCTGCCCGG - Intergenic
992763400 5:79971751-79971773 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
993056849 5:82991271-82991293 TCAATAGGCCTAGAGCTGCTGGG - Intergenic
993859169 5:93113456-93113478 CCAGGAGTTCAAGACCTGCTTGG + Intergenic
994087192 5:95772326-95772348 CCAGGAAGATCAGAGATGCTTGG - Intronic
995714436 5:115068346-115068368 CCAGCAGGCCCAGGGCAGATGGG + Intergenic
996937361 5:128965028-128965050 ACAGGAGAACCAGAGTTGCTGGG - Intronic
997344367 5:133175985-133176007 CCAGGAGTTCCAGAGCAGCCGGG + Intergenic
997426118 5:133803825-133803847 CCAGGAGTCCCATATCTGCAGGG + Intergenic
997933352 5:138089869-138089891 CCAGGAGGCCAAGACCAGCCTGG - Intronic
998152368 5:139764681-139764703 CCAGGAGGCCGAAACCTGATGGG + Intergenic
998305064 5:141067782-141067804 CCAGGAGGTCAAGACCAGCTTGG - Intergenic
998433397 5:142085778-142085800 CCAGGAGTTCAAGAGCAGCTTGG + Intergenic
999163020 5:149521494-149521516 CCAGGAGTTCAAGAGCAGCTGGG - Intronic
999435670 5:151561598-151561620 CCAGGAGTTTAAGAGCTGCTTGG - Intronic
999780618 5:154847172-154847194 CCAGGAGTCCAAGACCAGCTTGG - Intronic
999955469 5:156696717-156696739 CCAGGAGTTCCAGACCAGCTTGG - Intronic
1000299450 5:159942599-159942621 CCAGGAGTTCCAGAGCAGCCTGG + Intronic
1000317586 5:160107789-160107811 CCAGGAGTCCAAGAGCAGCGTGG + Intronic
1000379880 5:160619577-160619599 GCAGGAGGCACAGGGCTGCCTGG + Intronic
1000849507 5:166322628-166322650 CCAGGAGTCCCAGACCAGCCTGG - Intergenic
1000983926 5:167846501-167846523 CCAGGAAGCCTAGAAGTGCTGGG + Intronic
1001436636 5:171704414-171704436 CCAGGCTGCAGAGAGCTGCTAGG + Intergenic
1001551169 5:172603111-172603133 CCAGGGGCCCCAAGGCTGCTGGG - Intergenic
1001646040 5:173283163-173283185 CCAGGACGCCCAGAGCCACAGGG - Intergenic
1002174635 5:177394645-177394667 CCAGGAGTCCAAGACCAGCTTGG + Intronic
1002515406 5:179754383-179754405 CCAGGAGTTCCAGATCAGCTTGG + Intronic
1002573075 5:180155059-180155081 CCAGGAGGCAGGGAGCTTCTGGG + Intronic
1002633118 5:180594053-180594075 CCAGGACCCCAAGCGCTGCTGGG - Intergenic
1002656604 5:180753598-180753620 TGAGGAGTCCCACAGCTGCTTGG - Intergenic
1003020144 6:2502621-2502643 CCAGCAGGCCCACAGCAACTGGG - Intergenic
1003482382 6:6545882-6545904 CCAGGAGCCCGCGAGCTCCTGGG + Intergenic
1003603224 6:7537464-7537486 CCAGGAGTTCCAGATCAGCTTGG + Intergenic
1005050558 6:21679928-21679950 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1005574095 6:27176060-27176082 ACAGGAGGGCCAGAGCCTCTGGG - Intergenic
1005612487 6:27539734-27539756 CCAGGAGTTCCAGATCAGCTTGG - Intergenic
1005631935 6:27716658-27716680 CCAGGAGTTCAAGACCTGCTTGG - Intergenic
1005641094 6:27797078-27797100 CCAGGAGTTCGAGACCTGCTGGG + Intergenic
1005750679 6:28879654-28879676 CCAGGAGTTCCAGAGCAGCTTGG + Intergenic
1005975763 6:30797417-30797439 CCAGGAGGTCAAGACCAGCTTGG - Intergenic
1006321420 6:33321789-33321811 CCATGAGGCTCAGAGGAGCTAGG + Exonic
1006321721 6:33323131-33323153 CCAGGCGTCCCAAAGCAGCTGGG + Intronic
1007033462 6:38650785-38650807 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1007557563 6:42779828-42779850 CCAGGAGTTCAAGAGCAGCTTGG - Intronic
1008080771 6:47192445-47192467 CCAGGAGTTCGAGAGCAGCTTGG + Intergenic
1008221618 6:48861268-48861290 CCAGGAGTTCAAGAGCAGCTTGG - Intergenic
1008654008 6:53592667-53592689 CCAGGAGGTCGAGACCTGCCTGG - Intronic
1010162285 6:72870458-72870480 CCAGGAGTCCGAGAGCAGCCTGG - Intronic
1010385759 6:75277693-75277715 CCAGGAGGTCAAGAGCAGCCTGG + Intronic
1010401374 6:75450185-75450207 CCAGGAGTTCAAGAGCAGCTTGG - Intronic
1011637262 6:89385984-89386006 CTAGGAGCACCAGAGCTGTTAGG - Intronic
1012797167 6:103776982-103777004 ACAGGAGGCCCTGGGTTGCTAGG - Intergenic
1012982226 6:105842923-105842945 GCAGGCGCCCCAGAGCTGTTAGG + Intergenic
1013113562 6:107083408-107083430 CCAGGAGTCCCAGACCAGCCTGG + Intronic
1013297050 6:108767018-108767040 CCAGGAGTCCCAGACCAGCCTGG - Intergenic
1014235947 6:118954962-118954984 CCAGGAGTCCCAGACCAGCCTGG + Intergenic
1015631107 6:135232703-135232725 CCAGGAGTTCGAGAGCAGCTTGG - Intergenic
1015720230 6:136234120-136234142 CCAGGAGTTCGAGAGCAGCTTGG + Intronic
1016406887 6:143740391-143740413 CAAGGAGGCTAAGACCTGCTGGG - Intronic
1017147387 6:151247000-151247022 CCAGGAGGTCCAGACCAGCCTGG - Intronic
1017154417 6:151310151-151310173 CCAGGAGGTCCAGACCAGCCTGG + Intronic
1017906266 6:158759231-158759253 GCAGGTGGCACAGAGCTGCAAGG + Intronic
1018173924 6:161163050-161163072 CCAGGAGAACCAGAGCCTCTGGG + Intronic
1018940674 6:168307545-168307567 CCAGGAGGCCCCGGTCAGCTCGG - Exonic
1019334515 7:476676-476698 ACAGGAGGCCCCGATCTGGTGGG + Intergenic
1019457502 7:1138122-1138144 CCAGGAGACCCAGAGCCCCGGGG - Exonic
1020012943 7:4816324-4816346 GCAGGAGGTCCAGGGCTGCCTGG + Exonic
1020117296 7:5482824-5482846 CCAGGAGTCCCAGAACAGCCTGG + Intronic
1020524257 7:9238391-9238413 CCAGGAGTTCCAGACCTGCCTGG + Intergenic
1021373204 7:19876188-19876210 CCAGGAGACCCAGAGCTTCCAGG - Intergenic
1021378398 7:19936970-19936992 CCAGGAGTTCAAGACCTGCTTGG - Intergenic
1021582020 7:22166134-22166156 CCAGGAGTTCAAGAGCAGCTGGG - Intronic
1022099507 7:27160881-27160903 CCCGGGGGCCCAGTGCTGCCGGG - Intergenic
1023055627 7:36287674-36287696 CCAGGAGGGTCAGGGCTGCCAGG - Exonic
1023055756 7:36288549-36288571 CCAGGAGTTCAAGAGCAGCTTGG + Intronic
1023607529 7:41943688-41943710 CCTGGAGGACCAGAGCTGGAGGG - Intergenic
1023793063 7:43769237-43769259 CCAGGAGTCCGAGACCAGCTTGG - Intronic
1024961680 7:54982904-54982926 GCAGGGGGCACGGAGCTGCTGGG - Intergenic
1026218365 7:68369606-68369628 CCAGGAGTCCGAGAGCTGACTGG + Intergenic
1026347525 7:69487434-69487456 CCAGGAGGACCAGATCAGCCTGG - Intergenic
1026442759 7:70458359-70458381 CCAGAAGGACCAGAGCTGGGGGG - Intronic
1026740264 7:72974754-72974776 CCAAGAGTCCCAGAGCAGCCTGG - Intergenic
1027103469 7:75390316-75390338 CCAAGAGTCCCAGAGCAGCCTGG + Intergenic
1027168664 7:75854201-75854223 CCAGGAGGGCAAGACCAGCTTGG + Intronic
1027270702 7:76516956-76516978 CCAGGAGTTCCAGACCAGCTGGG + Intergenic
1027500565 7:78944946-78944968 CCAGGAGTACCAGACCAGCTCGG - Intronic
1027855635 7:83507726-83507748 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1029185375 7:98734654-98734676 CCAGGAGCTCAAGAGCAGCTGGG - Intergenic
1029359411 7:100077628-100077650 CCAGGAGTTCCAGACCTGCCTGG - Exonic
1029432001 7:100537342-100537364 CCAGGAGGTCCAGACCAGCCTGG + Intergenic
1029473430 7:100768673-100768695 CCAGGCGGCCCCCAGCTGCATGG - Exonic
1029535073 7:101152974-101152996 CCAGGAGTCCCAGACCAGCTTGG + Intergenic
1029936962 7:104435349-104435371 CCAGGAGGTCGAGAGCAGCCTGG - Intronic
1030022575 7:105290618-105290640 CCAGGAGATCCAGACCAGCTTGG + Intronic
1030105025 7:105979841-105979863 CCAGAAGGCCCGGAGCCCCTGGG - Intronic
1030274443 7:107705020-107705042 CCAGGATGGGCACAGCTGCTTGG + Intronic
1030643221 7:112029296-112029318 CCAGGAGACTCAGATATGCTGGG - Intronic
1031201757 7:118697297-118697319 CCAGCAGTCCCAGAGCTCTTGGG + Intergenic
1031997793 7:128244037-128244059 CCAGGAGTTCCAGATCAGCTGGG + Intronic
1032180453 7:129672246-129672268 CCAGGAGTCCCAGACCAGCCTGG - Intronic
1032285694 7:130537022-130537044 CCAGGAGGAGCAGAGGAGCTGGG + Intronic
1032543918 7:132726488-132726510 CCAGGAGGTCAAGAGCAGCCTGG + Intronic
1032697882 7:134353400-134353422 CCAGGTGTCCCAGAGCCACTTGG + Intergenic
1033124187 7:138693302-138693324 CCAGGAGGTCAAGACCAGCTTGG + Intronic
1033145106 7:138864395-138864417 CCAGAAGGCCAGGAGCTCCTGGG + Intronic
1033210649 7:139457695-139457717 CCAGGAGGCCCAGAGGGGAAGGG - Intronic
1033249419 7:139745997-139746019 CCAGGAGGAGCAGAGCAGATGGG + Intronic
1033289371 7:140070007-140070029 CCAGGAGGTCGAGACCAGCTTGG + Intergenic
1033523919 7:142190923-142190945 CCAGGAGTCCGAGGGCAGCTTGG + Intronic
1034525229 7:151655418-151655440 GCAAGAAGCCCACAGCTGCTTGG + Intronic
1035122255 7:156578649-156578671 CGAGGACACCCAGGGCTGCTTGG - Intergenic
1035266494 7:157692678-157692700 GCAGGAGGCCCGGTGCGGCTCGG + Intronic
1035449782 7:158969321-158969343 CCAGGAGGTCGAGACCTGCCTGG - Intergenic
1035585748 8:772108-772130 CCAGGAGGTCAAGAGCAGCCTGG - Intergenic
1035610100 8:956284-956306 CCAGGAGCTCAAAAGCTGCTTGG + Intergenic
1036069404 8:5423912-5423934 CCAGGAGTCCCAGAACAGCCTGG - Intergenic
1036694520 8:10965876-10965898 CCAGGTGGCCCACACCTGCTGGG - Intronic
1037219167 8:16496869-16496891 ACAGGAGGCCCAGAGGAGCCTGG - Intronic
1037241086 8:16778464-16778486 CCAGGAGGTCCAGACCAGCCTGG + Intergenic
1037334438 8:17778605-17778627 CCAGGAGTTCTAGAGCTGCACGG + Intronic
1037724967 8:21475439-21475461 GAAGGAGGCCCACAGCTGATAGG - Intergenic
1037779778 8:21859909-21859931 GCAGGAGGGCCAGAGCTCATGGG + Intergenic
1037851809 8:22336694-22336716 CCAGGAGTTCAAGACCTGCTTGG + Intronic
1038309953 8:26438908-26438930 CCAGGAGTCCAAGACCAGCTTGG - Intronic
1038741940 8:30224043-30224065 GCAGGTGGTCTAGAGCTGCTGGG - Intergenic
1038749436 8:30282120-30282142 CCAGGAGTTCCAGAGCAGCCAGG - Intergenic
1039548874 8:38429355-38429377 CCAGGAGGCTAAGTGGTGCTCGG - Intronic
1039565193 8:38546605-38546627 CCAGGCAGCCTAGAGCTCCTGGG + Intergenic
1039784798 8:40824834-40824856 CCAGGATGCTGAGAGCTACTAGG - Intronic
1040647179 8:49412803-49412825 CCAGGAGTTCGAGACCTGCTTGG + Intergenic
1040771451 8:50982431-50982453 CCATGAGACCCAGCGTTGCTGGG + Intergenic
1041064554 8:54069502-54069524 CCAGGAGTTCAAGACCTGCTTGG + Intronic
1041072060 8:54135239-54135261 CAAGGGCGCCCTGAGCTGCTCGG - Exonic
1042283058 8:67076052-67076074 TAAGGAGGCCCAGAAATGCTGGG - Intronic
1043456010 8:80412763-80412785 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1043468369 8:80536666-80536688 CCAGGAGTCCAAGACCAGCTGGG - Intergenic
1043863008 8:85343181-85343203 CTAGGAGGTCCAGACCAGCTTGG + Intronic
1044023069 8:87130565-87130587 CCAGGAGGTCAAGACCAGCTTGG + Intronic
1044570857 8:93717056-93717078 CCAGGTGTCCCAGACCAGCTTGG - Intronic
1044722290 8:95162103-95162125 CCAGGAGGTCAAGACCAGCTTGG + Intergenic
1045343876 8:101277308-101277330 CCAGGAGTCCCAGATCAGCGTGG - Intergenic
1045455340 8:102373050-102373072 CCAGGAGTTCGAGAGCTGCCTGG - Intronic
1045581465 8:103485435-103485457 CCAGGAGGTCCAGAACAGCCTGG - Intergenic
1045849838 8:106681732-106681754 CCAGGAGTCCAAGACCAGCTTGG - Intronic
1045899152 8:107254880-107254902 CCAGAAGAACCAGATCTGCTAGG + Intronic
1046599018 8:116296260-116296282 CTTGGAACCCCAGAGCTGCTTGG - Intergenic
1046984172 8:120369350-120369372 CCAGGGGGCCCAGGGCTGCCAGG - Exonic
1048023511 8:130562806-130562828 CCAGGTGGCCCAGGGCTGGTAGG + Intergenic
1048284456 8:133130941-133130963 CCAGGAGGCCCAGGGTTAATAGG - Intronic
1049051111 8:140197415-140197437 CCGTGAGGCCCAGAGCAGCACGG + Intronic
1049201794 8:141343916-141343938 CCAGGAAGCCCAGGGCTCCAAGG - Intergenic
1049244690 8:141556058-141556080 CCAGGAGGGACAGAGAAGCTTGG + Intergenic
1049527790 8:143137358-143137380 CCAGGAGTCCCAGACCAGCCTGG + Intergenic
1049550617 8:143256666-143256688 CCAGGAGTTCAAGACCTGCTTGG + Intronic
1049554598 8:143275664-143275686 CAGGGTGACCCAGAGCTGCTGGG - Intronic
1049592007 8:143466848-143466870 CCAGCCTGCTCAGAGCTGCTGGG + Intronic
1049653793 8:143789016-143789038 CCAGGAGGCCCAGAGGCACAAGG + Intergenic
1049878366 8:145043130-145043152 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1050036836 9:1445188-1445210 CCACGAGGGCCAAACCTGCTCGG - Intergenic
1050165458 9:2760431-2760453 CCAGGAGTTCGAGACCTGCTTGG + Intronic
1050538837 9:6652566-6652588 CCAGGAGTTCCAGACCTGCCTGG + Intergenic
1050739408 9:8802840-8802862 CCAGGAGTTCCAGAGCAGCCTGG + Intronic
1051559864 9:18428386-18428408 CCAGGAGCTCAAGAGCAGCTTGG + Intergenic
1051653005 9:19349013-19349035 CCAGGAGTCCAAGACCAGCTTGG - Intronic
1053253166 9:36592059-36592081 CCAGGAGTCCAAGACCAGCTTGG - Intronic
1053491535 9:38508371-38508393 CCAGGAGTTCAAGAGCAGCTTGG - Intergenic
1055101685 9:72472089-72472111 ACAGGAGGCCAAGAGCTGAAAGG + Intergenic
1056646399 9:88415629-88415651 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
1056758247 9:89396304-89396326 CCCAGATGCCCAGAGCTGCCAGG + Intronic
1057476838 9:95410320-95410342 CAGGGAGGGCCAGAGCTCCTGGG + Intergenic
1057817378 9:98305603-98305625 CCAGGAGTCCAAGACCAGCTTGG + Intronic
1058845448 9:108953379-108953401 GCAGGAGTCCCAGAACAGCTAGG + Intronic
1058859173 9:109097707-109097729 CCAGGAGTTCCAGACCTGCCTGG + Intronic
1059050626 9:110920911-110920933 CCAGGAGTCCCAGACCAGCCTGG + Intronic
1059226358 9:112676472-112676494 CCAGGAGTCCCAGACCAGCCTGG + Intergenic
1059557367 9:115294740-115294762 CCAGGAGTTCGAGACCTGCTTGG + Intronic
1059671738 9:116498373-116498395 CCAGGAGGTCAAGATCAGCTTGG + Intronic
1060127685 9:121065695-121065717 TCAGGAGGTCCAGACCAGCTAGG - Intergenic
1060198533 9:121638634-121638656 CCAGCAGGGCCAGGGCAGCTAGG + Intronic
1060198824 9:121640134-121640156 CCAGGACTCCCAGGGCTCCTGGG - Intronic
1061110484 9:128566264-128566286 CCAGGAGTTCGAGAGCAGCTGGG - Intronic
1061173795 9:128979111-128979133 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
1061193284 9:129094490-129094512 CCAGCAGGCCCAGGTCTGGTGGG - Intergenic
1061354915 9:130097362-130097384 CCAGGAGTTCAAGACCTGCTTGG - Intronic
1061453185 9:130679868-130679890 CCAGGAGTTCCAGACCAGCTGGG - Intronic
1061511009 9:131060980-131061002 CCAGAATGCCCAGAGATGGTGGG - Intronic
1061744422 9:132729092-132729114 CCAGGAGTTCCAGAACAGCTGGG - Intronic
1061822346 9:133235569-133235591 CCAGGAGACCCAGTTCTGCCTGG - Intergenic
1062328275 9:136023152-136023174 CCAGGAGACCCAGAGAGGCCAGG - Intronic
1062385724 9:136310775-136310797 ACGGGTGGCTCAGAGCTGCTGGG + Intergenic
1062400192 9:136369163-136369185 CCAGGAGTTCCAGAGCAGCCTGG - Intronic
1062493360 9:136819851-136819873 CCAGGAGGTCGAGACCAGCTTGG + Intronic
1062545585 9:137062352-137062374 CCAGGAGTTCCAGAGCAGCCTGG - Exonic
1062656538 9:137606701-137606723 CCAGGAGGCCCAGTGGGGCCAGG - Intronic
1062670463 9:137705888-137705910 ACAGGAGCCCCAGAGCTGTGGGG - Intronic
1203441710 Un_GL000219v1:15696-15718 CCAGGAGACCCGGTGCAGCTGGG - Intergenic
1203512520 Un_KI270741v1:134605-134627 CCAGGAGACCCGGTGCAGCTGGG - Intergenic
1185892005 X:3829932-3829954 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1185897112 X:3868346-3868368 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
1185902231 X:3906772-3906794 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
1185920193 X:4083108-4083130 CCAGGAGGGACAGAACTGATAGG + Intergenic
1186037247 X:5437890-5437912 CCAGGAGTCCGAGACCAGCTTGG - Intergenic
1186054508 X:5634756-5634778 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
1186972419 X:14862004-14862026 CCAGGAGTTCAAGAGCAGCTTGG - Intronic
1187186172 X:16988061-16988083 CCAGGAGTTCCAGACCAGCTTGG + Intronic
1188060225 X:25591480-25591502 CCAATAGGCTCAGCGCTGCTTGG + Intergenic
1189465875 X:41277101-41277123 CCACCATGACCAGAGCTGCTGGG + Intergenic
1190045567 X:47109257-47109279 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1190069941 X:47271474-47271496 CCAGGAGTTCCAGACCAGCTAGG + Intergenic
1190078036 X:47333074-47333096 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1190102223 X:47530429-47530451 CCAGGAGTTCCAGACCAGCTAGG + Intergenic
1190379848 X:49829169-49829191 CCAGGTGGCACAGAGCCTCTAGG + Intergenic
1190679341 X:52811517-52811539 CAAGAAGGCCCATAGCTGCGGGG - Intergenic
1190733799 X:53241948-53241970 CCAGGAGGCCTGAAGCTGATGGG - Intronic
1190768497 X:53495584-53495606 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1191851638 X:65589813-65589835 CCAGTGGGCCCTGAGCAGCTGGG - Intronic
1191857741 X:65640897-65640919 CCAGGAGTCCCAGATCAGCCTGG + Intronic
1192144322 X:68670962-68670984 CCATCAAGGCCAGAGCTGCTAGG - Intronic
1192227744 X:69241047-69241069 CCAGCAGGCTCAGGGCTGATGGG + Intergenic
1192273382 X:69605612-69605634 CCAGGAGCCCAAGATCTGGTGGG + Intergenic
1192864056 X:75111047-75111069 CCAGGAGTTCGAGAGCAGCTTGG + Intronic
1193466621 X:81855149-81855171 CCAGGAGTCCAAGACCAGCTGGG + Intergenic
1194429037 X:93777792-93777814 CCAGGAGTTCCAGAGCAGCCTGG + Intergenic
1195625557 X:107002756-107002778 CCAGGAGTCCAAGAGCAGCCTGG - Intergenic
1195714474 X:107805241-107805263 CCAGGAGTTCAAGACCTGCTGGG - Intergenic
1195778080 X:108430066-108430088 CAAAGAGGCCCAAAGCTCCTTGG + Intronic
1196752234 X:119128448-119128470 CCAGGAGGGCCAGTGAGGCTAGG - Intronic
1196871272 X:120115727-120115749 CCATGAGGCCTGGAGCTCCTTGG + Exonic
1196872520 X:120126274-120126296 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1197554848 X:127940354-127940376 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1197714101 X:129693856-129693878 CCAGGAGTTCCAGACCAGCTTGG + Intergenic
1198122436 X:133607475-133607497 CCAGGAGTCCCAGACCAGCCTGG - Intronic
1198191599 X:134312413-134312435 CCAGGAGTTCAAGAGCAGCTTGG - Intergenic
1198208584 X:134493928-134493950 CCAGGAGGTCCAGATCTTCAGGG - Intronic
1198326863 X:135582959-135582981 CCAGGAGTTCAAGAGCAGCTTGG + Intergenic
1198679303 X:139164480-139164502 CCAGGAGTTCGAGAGCAGCTTGG + Intronic
1198722179 X:139634884-139634906 CCAGGAGTTCCAGAACAGCTTGG + Intronic
1199793069 X:151173055-151173077 CCTGTAGTCCCAGAGCTACTCGG + Intergenic
1199815797 X:151396093-151396115 CCAGTAGTTCCAGAGCAGCTTGG - Intergenic
1200176093 X:154117316-154117338 CCAGGAGTTCCAGACCAGCTTGG - Intergenic
1201299523 Y:12493835-12493857 AAATGAGGCCGAGAGCTGCTGGG - Intergenic