ID: 1184740933

View in Genome Browser
Species Human (GRCh38)
Location 22:46428747-46428769
Sequence GCCAGGAGGCCCAGAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 584}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184740933_1184740939 15 Left 1184740933 22:46428747-46428769 CCAGCAGCTCTGGGCCTCCTGGC 0: 1
1: 0
2: 5
3: 65
4: 584
Right 1184740939 22:46428785-46428807 CTCACTGCACAGCTCACTCACGG 0: 1
1: 0
2: 2
3: 21
4: 191
1184740933_1184740940 16 Left 1184740933 22:46428747-46428769 CCAGCAGCTCTGGGCCTCCTGGC 0: 1
1: 0
2: 5
3: 65
4: 584
Right 1184740940 22:46428786-46428808 TCACTGCACAGCTCACTCACGGG 0: 1
1: 0
2: 3
3: 20
4: 186
1184740933_1184740942 27 Left 1184740933 22:46428747-46428769 CCAGCAGCTCTGGGCCTCCTGGC 0: 1
1: 0
2: 5
3: 65
4: 584
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data
1184740933_1184740941 26 Left 1184740933 22:46428747-46428769 CCAGCAGCTCTGGGCCTCCTGGC 0: 1
1: 0
2: 5
3: 65
4: 584
Right 1184740941 22:46428796-46428818 GCTCACTCACGGGTCCCCAGCGG 0: 1
1: 0
2: 0
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184740933 Original CRISPR GCCAGGAGGCCCAGAGCTGC TGG (reversed) Intronic
900030071 1:364819-364841 GGCAGGAGGCCAAGAGGAGCTGG + Intergenic
900050723 1:593883-593905 GGCAGGAGGCCAAGAGGAGCTGG + Intergenic
900109042 1:997978-998000 GCCTGGAGGGCCAGTGCTGGTGG + Intergenic
900297645 1:1960015-1960037 GCCAGGGGGGTCAAAGCTGCAGG + Exonic
900364158 1:2304011-2304033 CCCAGGAGCCCCAGAGACGCTGG + Exonic
900417674 1:2542596-2542618 ACCCAGAGTCCCAGAGCTGCCGG - Intergenic
900538504 1:3190958-3190980 CCCAGCAGGCCCCAAGCTGCAGG - Intronic
900690889 1:3979691-3979713 GTCAGGGGACCCAGAACTGCAGG - Intergenic
900902570 1:5526976-5526998 GCCAGGCGTCCCAGGGCTGATGG + Intergenic
900952190 1:5864376-5864398 GCCAGGAGGCCACCAGCTGGTGG + Exonic
901409473 1:9072168-9072190 GCCATGAGGCCGAGGCCTGCAGG + Intronic
901511878 1:9721663-9721685 GCCAGGACACCCAGGCCTGCTGG - Intronic
901768281 1:11517541-11517563 CTCCAGAGGCCCAGAGCTGCAGG - Exonic
902246617 1:15124905-15124927 ACGACGAGTCCCAGAGCTGCAGG + Intergenic
902331698 1:15734114-15734136 GGCAGGATGCCCAGGGGTGCCGG - Exonic
902878674 1:19356441-19356463 GCAAGGTTGCCCACAGCTGCTGG - Intronic
903257998 1:22115458-22115480 GACAGGAGTGCCAGAGCTGCAGG - Intergenic
903264992 1:22152832-22152854 TCCTGGAGGCCCCAAGCTGCGGG - Intergenic
903816329 1:26066961-26066983 GGCAAGAGGCCCAGAGCTTTGGG - Intronic
903952780 1:27005826-27005848 GCCAGGAGGCCCAGCACTGCAGG - Exonic
904025999 1:27504198-27504220 GCCAGGAGGAGACGAGCTGCAGG - Intergenic
904271916 1:29355740-29355762 GCCTGGAGGCCCAAGGCTGTTGG + Intergenic
904349322 1:29894588-29894610 GCCCTGAGGCCCAGAACTGGGGG + Intergenic
905120704 1:35679638-35679660 GCCAGGAGGCCTAGAGATGTGGG - Intergenic
905282961 1:36860663-36860685 GCCCCCAGACCCAGAGCTGCAGG - Intronic
906304197 1:44706174-44706196 GCCAGGTGGGCCAGAGCCACAGG + Intronic
907304685 1:53506988-53507010 CCCAGGGGGCCCAGGGCAGCTGG + Intronic
907326560 1:53642087-53642109 TCCAGCAGGCCCAGAGCTTGTGG + Intronic
907834266 1:58094069-58094091 GCCATGGGACACAGAGCTGCTGG - Intronic
908098386 1:60764429-60764451 GCAAGGATGGCCAGAGATGCTGG + Intergenic
912449843 1:109761967-109761989 GCCTGGAGGCCCCGGGCTGAGGG + Intronic
912798488 1:112706854-112706876 GCGAGGGGGCCCGGACCTGCCGG - Intronic
915143057 1:153778682-153778704 GCCAGGTGAGCCAGGGCTGCTGG + Exonic
915554324 1:156652945-156652967 GTCAGGTGACCCAGAGCTGCAGG - Intronic
915621292 1:157086527-157086549 GCCAGGAGGGGCAGCTCTGCAGG - Intergenic
918606783 1:186437248-186437270 CCCAGGAGGGACAGAGCTTCAGG - Intergenic
919855618 1:201704186-201704208 GCCACGAGGCCTAGGGTTGCGGG + Intronic
920341296 1:205276612-205276634 GCCAGCAGGCCCAAATGTGCTGG - Intergenic
920529979 1:206694766-206694788 GCCAGGCTGCTCTGAGCTGCAGG - Intronic
921383996 1:214551614-214551636 GCCGGGAGAGCCAGAGCGGCAGG + Intronic
922195473 1:223355948-223355970 GCCTGCAGGCCCTGACCTGCTGG + Intronic
922236498 1:223726420-223726442 CCCAGGAGGGTCAGGGCTGCAGG + Intronic
922304219 1:224330108-224330130 GCGATGAAGCCCAGACCTGCAGG - Exonic
922724324 1:227915403-227915425 CCCAGGAGGCCCCGGGGTGCAGG - Intergenic
922748691 1:228060818-228060840 CCCAGGCTGCCCAGAGCTGCTGG + Exonic
923137368 1:231130325-231130347 GCCTGGAGCCCCAGAAATGCAGG + Intergenic
923336838 1:232978016-232978038 GGCAGGAGGCCCAGCTCTTCAGG - Intronic
923490254 1:234478315-234478337 GCCCGGACGCCCGGCGCTGCTGG - Exonic
923701418 1:236303653-236303675 CCCAGCAGGGCCAGTGCTGCTGG - Intergenic
924948064 1:248858977-248858999 GCGAGCAGGCCCGGAGCTGCTGG + Intronic
1062800810 10:379080-379102 GTCAGGTTGCCCAGCGCTGCAGG - Intronic
1063264763 10:4435600-4435622 GTCAGGAGGCCGGGAGCTGGAGG + Intergenic
1063371330 10:5524806-5524828 GCAAGCAGGCACAGAGGTGCTGG + Exonic
1063374617 10:5546568-5546590 TCTAGGACGCCCAGAGCTGCAGG - Intergenic
1063442835 10:6087018-6087040 ATTAGGAGGTCCAGAGCTGCAGG - Intergenic
1064876335 10:19998704-19998726 TCCAGGAGGCACAGAGATGGAGG + Intronic
1065484255 10:26221865-26221887 AGCAGGAGGCCAAGGGCTGCAGG + Intronic
1065643127 10:27805364-27805386 CCCAGGAGGCTGGGAGCTGCTGG - Intergenic
1065845156 10:29737095-29737117 GCCAGGGAGCCCTGAGCCGCTGG - Intergenic
1067037710 10:42932275-42932297 GCCCGGAGGCCATGAGCTGTGGG + Intergenic
1067161056 10:43825625-43825647 GCCTGGAGTCTCAGGGCTGCCGG - Intergenic
1067550047 10:47227724-47227746 GCCAGAAGGGCCAGCACTGCAGG + Intergenic
1067669726 10:48307377-48307399 GCCCTGCAGCCCAGAGCTGCAGG - Intronic
1067702935 10:48586880-48586902 TCCTGGAGACCCAGAGCTACTGG + Intronic
1068388262 10:56359911-56359933 GGAAGGAGGCCCAGTGTTGCAGG - Intronic
1068557688 10:58477376-58477398 GCCAGAGGGCCCTGAGCTGGAGG - Intergenic
1069512384 10:69052190-69052212 GCCTCTTGGCCCAGAGCTGCTGG + Intergenic
1069640527 10:69952635-69952657 GGCAGAGGGCTCAGAGCTGCAGG - Intronic
1069849010 10:71393091-71393113 TGCAGGAGGCTCAGAGCTGGGGG - Intergenic
1069958156 10:72064085-72064107 GCCATGAGGCCCAAGGCTGGAGG + Intronic
1070126402 10:73625737-73625759 GCGGGGAGGACTAGAGCTGCTGG - Intronic
1070307986 10:75251165-75251187 GTCAGGAGGCGCAGGGCTGGGGG + Intergenic
1070406780 10:76104498-76104520 GCAGGGAGACCCAGAGCTGCAGG - Intronic
1070406783 10:76104516-76104538 GCAGGGAGACCTAGAGCTGCAGG - Intronic
1070406787 10:76104534-76104556 GCAGGGAGACCCAGAGCTGCAGG - Intronic
1071503194 10:86217908-86217930 GCCCGGTGGCCCGGGGCTGCAGG - Intronic
1071579419 10:86756363-86756385 GCAAGGGGGCGCCGAGCTGCTGG - Intergenic
1072636521 10:97181840-97181862 CCCAGGATGCCCAGGGCTGGGGG + Intronic
1072728227 10:97827894-97827916 CACAGGAGCCCCGGAGCTGCAGG + Intergenic
1074219239 10:111420163-111420185 GACAGGAAGACCAGAGATGCTGG - Intergenic
1075598148 10:123747373-123747395 GCCAGGAGGCCCTGCACTGATGG - Intronic
1076509262 10:131000485-131000507 ATCAGGAGGCCCAGAGAGGCGGG - Intergenic
1076529946 10:131137367-131137389 GCCAGAAGGCCCAGTGACGCAGG - Intronic
1076714548 10:132356728-132356750 GGCAGTGGGCACAGAGCTGCGGG + Intronic
1076747276 10:132520593-132520615 GCCAGCAGGTCCTGAGCAGCCGG - Intergenic
1077097661 11:805743-805765 GCCAGGAGGCTCACTGCTTCTGG - Intronic
1077225767 11:1438509-1438531 GCTAGCAGGGCCAGGGCTGCTGG - Intronic
1077266482 11:1653261-1653283 GCCAGGAGGCCCAGGTCAGGCGG - Intergenic
1077267752 11:1660590-1660612 TCCAGGAGCCTCAGAGCTGATGG + Intergenic
1077269265 11:1667409-1667431 GCCCTGAGGTCCAGGGCTGCAGG - Intergenic
1077271280 11:1683296-1683318 GCCCTGAGGTCCAGGGCTGCAGG + Intergenic
1077316113 11:1920078-1920100 GGCAGGAGGCAGAGAGGTGCGGG + Intronic
1077321795 11:1946180-1946202 GGCAGGGGGCCCAGGCCTGCAGG - Intergenic
1077502810 11:2916953-2916975 GCAGGGAGGCCCAGAGAGGCAGG + Intronic
1077797809 11:5509565-5509587 AGCAGGAGGCCCAGATCTGTGGG + Exonic
1078085384 11:8230542-8230564 TCCTTGAGGCCCAGAGCTACGGG - Intronic
1078230029 11:9432409-9432431 GTCAGGAGTTCCAGACCTGCCGG - Intronic
1079643002 11:22829904-22829926 GCGAGGCGGGGCAGAGCTGCGGG - Intronic
1080838081 11:35958980-35959002 GCCTGGAGGCCCAATGCTGCTGG - Intronic
1081138287 11:39467226-39467248 GCCTGGAGGCTGAGATCTGCAGG - Intergenic
1081558248 11:44187406-44187428 GCCAGGAGTTCAAGAGCTGGAGG - Intronic
1081647530 11:44800332-44800354 GCCAGAGGCCCCAGAGCTGGGGG + Intronic
1081756937 11:45551404-45551426 GCCATGTGGCCCAGAGCACCAGG + Intergenic
1081847897 11:46253735-46253757 GCAAGGAGGCTCAGAGAGGCTGG - Intergenic
1081906879 11:46675803-46675825 GGGAGCAGGGCCAGAGCTGCAGG - Intergenic
1081912793 11:46710891-46710913 ACCAGGAGGCACGGGGCTGCCGG - Intergenic
1082095610 11:48127031-48127053 GACAGGAGGCCCAGAGCAGGAGG + Intronic
1083171963 11:60928534-60928556 GGCAGGAAACCCAGAGCTGGAGG - Intronic
1083491068 11:63015537-63015559 GCCAGGAGGCTCTGAGCTTGGGG - Intronic
1084233179 11:67768168-67768190 GCCAGGAGGACCAGAGCATTTGG - Intergenic
1084272663 11:68037534-68037556 GCCAGCAGGCACACAGCAGCTGG - Intergenic
1084444010 11:69193036-69193058 GCAAGGTGTCCCAGAGCTGAAGG + Intergenic
1084660212 11:70542383-70542405 ACCGGGAGCCCCAGAGCTGGAGG + Intronic
1084775522 11:71372239-71372261 GCAAGGAGGCCCAGGGCCCCAGG + Intergenic
1084806863 11:71584889-71584911 GCCAGGGGGGCAAGAGGTGCTGG - Intronic
1085058754 11:73425279-73425301 GACAGCTGACCCAGAGCTGCCGG + Intronic
1085167068 11:74412064-74412086 GTCAGGAGTTCCAGAGCTCCTGG - Intergenic
1085772341 11:79336828-79336850 CCCAGGAGGCCCCCAGTTGCTGG + Intronic
1086575772 11:88337706-88337728 ACCAGGAAGCCGAGCGCTGCGGG + Exonic
1087501358 11:98958684-98958706 GGCAGAAGGCCCAGGGCAGCAGG + Intergenic
1088783925 11:113163798-113163820 GGCAGTATGCCCAGTGCTGCGGG + Intronic
1088828885 11:113518346-113518368 GCCAGGATGCACAGAGCCCCGGG - Intergenic
1089061513 11:115629762-115629784 TCCAGCAGGGCCAGAGCTACGGG - Intergenic
1089411107 11:118243556-118243578 GCCAGGAGTTCAAGAGCAGCCGG + Intronic
1089448404 11:118572450-118572472 GGCAGCAGGTCCAGAGCTGCTGG + Exonic
1089527758 11:119107988-119108010 GCCAGGAGGCCCCGGACTCCTGG - Exonic
1089616827 11:119699514-119699536 GCCAGAGGGGCCAGAGTTGCAGG - Intronic
1090241494 11:125185160-125185182 GCCACTGGGCACAGAGCTGCAGG - Intronic
1091250753 11:134141814-134141836 GACAGGAGGGCGGGAGCTGCAGG + Intronic
1202804812 11_KI270721v1_random:1493-1515 GGCAGGGGGCCCAGGCCTGCAGG - Intergenic
1091594138 12:1864552-1864574 GGCAGCAGGCACAGAGCTGCTGG - Intronic
1091626096 12:2122073-2122095 TCCAGGAGGTCCAGAGTTGAGGG - Intronic
1091765684 12:3118660-3118682 CCAAGGAGGCCAAGGGCTGCAGG - Intronic
1091797950 12:3307952-3307974 GCTGGGATGTCCAGAGCTGCTGG - Intergenic
1092538650 12:9406611-9406633 GCCAGGGGGCGCAGAGGGGCTGG - Intergenic
1092612867 12:10189916-10189938 GCCAGGATCCTCCGAGCTGCAGG - Exonic
1095547301 12:43387450-43387472 GTCAGGAGGCACAGAGCTCAGGG + Intronic
1095951841 12:47785829-47785851 GGCAGGAGGCGCAGTGGTGCTGG - Exonic
1096121650 12:49092669-49092691 GCCCCGAGGCCCTGACCTGCGGG + Intronic
1096240320 12:49956306-49956328 GCCTTGGGGCCCAGCGCTGCAGG - Exonic
1100449382 12:94690757-94690779 GCCAGGAGGCCCACTGCTCAGGG + Intergenic
1101413104 12:104485419-104485441 GTCAGGAGGGCCACAGCTGCAGG + Intronic
1102254380 12:111407214-111407236 CCCTGGAGGCCCCCAGCTGCAGG - Intronic
1103342833 12:120230244-120230266 GACAGCTGGCCCAGGGCTGCGGG - Intronic
1103629746 12:122250497-122250519 GGCACGAGTCACAGAGCTGCTGG - Intronic
1103718405 12:122959986-122960008 GCCACGAGGCCCGCAGCCGCCGG + Exonic
1104037484 12:125107572-125107594 CCCAGGTGGTCCAGACCTGCAGG - Intronic
1104434832 12:128747608-128747630 GCTGGGAAGCCCAGGGCTGCAGG - Intergenic
1104584712 12:130038679-130038701 ACCTGGAGGCCCTCAGCTGCTGG - Intergenic
1104698180 12:130880197-130880219 GCCGGGTGGGGCAGAGCTGCAGG + Intergenic
1104711791 12:130992537-130992559 GCCAGGAGGGCCACACCAGCTGG - Intronic
1104737185 12:131142976-131142998 CCCAGGACGGCCACAGCTGCTGG - Intergenic
1104746039 12:131211103-131211125 GCCAGCAACCCCTGAGCTGCTGG + Intergenic
1104969467 12:132524642-132524664 GCCTGGGGGCCCAGATGTGCTGG + Intronic
1105064004 12:133181341-133181363 GCCAGGAAGGCCTGAGCTTCCGG + Intronic
1105213384 13:18271009-18271031 GAGATGAGGCCCAGAGCTTCTGG - Intergenic
1105809084 13:23978910-23978932 GCCAGGAGTTCAAGAGCAGCTGG - Intergenic
1105851510 13:24340148-24340170 GGCAAGCGGCTCAGAGCTGCGGG + Intergenic
1106411353 13:29513712-29513734 GCCTGGAGGCCGTGAGCTGAAGG + Exonic
1106413644 13:29528099-29528121 GCCAGGCGCCCCAGGGCTGAAGG - Intronic
1106914153 13:34494326-34494348 GCCAGGAGTTCCAGACCAGCCGG + Intergenic
1107330471 13:39294846-39294868 GGCAGAAGTCCCAGAACTGCAGG + Intergenic
1107883675 13:44855978-44856000 TCCAGGTGGCCCAGAGGGGCTGG - Intergenic
1107949278 13:45447177-45447199 ACCAGGACGCCAGGAGCTGCAGG - Intergenic
1108466021 13:50715928-50715950 GCCAGGTGGCAGGGAGCTGCAGG - Intronic
1108580834 13:51826936-51826958 GCCAGGATGCCAGAAGCTGCCGG + Intergenic
1112365043 13:98749301-98749323 GCCAGGAGGCTGAGATCTGGTGG + Intronic
1112783579 13:102927856-102927878 TGCAGGAAGCCCAGTGCTGCAGG - Intergenic
1113381957 13:109812600-109812622 GTCAGAAGGCCCAGAGTTGTGGG + Intergenic
1113741700 13:112715999-112716021 GCCAGCCTGCCCAGAGCTGCTGG - Intronic
1113964641 13:114145816-114145838 GCCAGGAGGCCTGGAGCTGCTGG - Intergenic
1114065396 14:19055090-19055112 GGCAGTCGGCCCACAGCTGCAGG - Intergenic
1114096866 14:19344912-19344934 GGCAGTCGGCCCACAGCTGCAGG + Intergenic
1114205227 14:20564635-20564657 GCCAGGAGGACCAGACCACCTGG + Intergenic
1115265988 14:31500760-31500782 GACAGGATTCCCAGAACTGCAGG + Intronic
1115592048 14:34874339-34874361 GCCAGGAGGCAGAGAACCGCGGG + Intronic
1115851774 14:37595109-37595131 AAGAGGAAGCCCAGAGCTGCGGG + Intronic
1115987296 14:39115242-39115264 GCCAGGAGTTCCAGACCAGCTGG - Intronic
1117744448 14:58854119-58854141 GCCAGGAGTTCCAGAGCAGTTGG - Intergenic
1117841971 14:59870042-59870064 GCCAGGAGGCTCCGAGCTGTAGG - Intronic
1118330687 14:64813460-64813482 GCCAGGAAGCCAAGAGCTTGGGG + Intronic
1118751714 14:68812575-68812597 CCCAAGAGGCCCAGAGGGGCAGG - Intergenic
1119205048 14:72787963-72787985 CCCAGGAGGCCCACAGGTGCTGG + Intronic
1119745672 14:77042207-77042229 GCCAGCAGGCACAGAGCTGAAGG + Intergenic
1119878267 14:78078612-78078634 GGCTTGAGGGCCAGAGCTGCTGG + Intergenic
1121173635 14:91874277-91874299 GCAAGGAGGCTGGGAGCTGCTGG - Intronic
1121252927 14:92513400-92513422 GTGGGGAGGCCCAGAGCTGGCGG - Intergenic
1121456901 14:94044130-94044152 GCCAGGAGGAGCAGAGCTGTGGG - Intronic
1121598451 14:95184694-95184716 GCCTGGAGACTCAGAGCTGCTGG - Exonic
1122003638 14:98684675-98684697 GCCAGGTGGCCCAGGACTGCAGG - Intergenic
1122353156 14:101109089-101109111 GCCAGGGGGCCCCGTGCTCCGGG - Intergenic
1122580329 14:102767761-102767783 GCCAGGAGGACCAAAGCCTCTGG + Intergenic
1122614592 14:103008360-103008382 GCAGGGAGGCCCAGGGCTGTGGG + Intronic
1122651254 14:103228395-103228417 GACAGGCGAACCAGAGCTGCAGG + Intergenic
1122862816 14:104590122-104590144 TCCAGGGAGCCCAGAGTTGCGGG + Intronic
1122970521 14:105150346-105150368 GCTAGGAGCCCCCGGGCTGCTGG - Intronic
1122972113 14:105156582-105156604 GCCAGGGGCACCACAGCTGCTGG + Intronic
1123499560 15:20867307-20867329 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1123556812 15:21441037-21441059 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1123593035 15:21878273-21878295 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1124440010 15:29678802-29678824 GTCAGGAGGACCAGAGCTGCTGG - Intergenic
1124611953 15:31215354-31215376 GCCCGGCGTCCCAGAGCTGCTGG + Intergenic
1124828672 15:33126395-33126417 GCCTGGAGGCCCAGAGCTTCTGG + Intronic
1125722922 15:41853693-41853715 GCCAGGCCCCCCGGAGCTGCAGG + Exonic
1126096579 15:45094813-45094835 GGCAGGAGGCACAGAGCTGATGG - Intronic
1126185848 15:45829770-45829792 AGCTGGAGGCCCAGATCTGCAGG + Intergenic
1127761732 15:62146306-62146328 GGCAGGAGGTCCTGAGCAGCAGG - Intergenic
1128113993 15:65094224-65094246 GACAGGAGGCAGAGAGCAGCAGG - Intronic
1128243634 15:66118325-66118347 GCTAGGAAGCCCAGATCTACAGG + Intronic
1128512368 15:68321348-68321370 CCCAGGAGCCCCAGAGCCTCTGG + Intronic
1129218658 15:74117775-74117797 GCCAGGATGCCCTGACCTCCAGG - Intronic
1129314812 15:74735251-74735273 AGCAGGTGGCCCAGAGCTTCTGG + Intergenic
1129737854 15:77975858-77975880 GCCGGGAGGGCCTGTGCTGCTGG + Intergenic
1129740636 15:77987982-77988004 GCCAGGTGGCACAGGGCTGCAGG - Intronic
1129845108 15:78764575-78764597 GCCAGGTGGCACAGGGCCGCAGG + Exonic
1129848227 15:78777752-78777774 GCCGGGAGGGCCTGTGCTGCTGG - Intronic
1130533668 15:84767373-84767395 GCCAGCAGCCTCAGACCTGCTGG - Intronic
1130934685 15:88458939-88458961 GCCAAGAGCCCCAGAGGTGAGGG + Intergenic
1202965155 15_KI270727v1_random:168226-168248 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1132574493 16:658258-658280 AGCAGGTGGCCCAGAGCTGCAGG - Exonic
1132715480 16:1288106-1288128 GCCAGGTGGCTCAGAGCAGCAGG - Intergenic
1132764374 16:1526830-1526852 GCCAGGGGGCCCTGAGGTGCTGG - Intronic
1132894838 16:2223833-2223855 GCCCGGATGGCCCGAGCTGCGGG + Intronic
1133007326 16:2891355-2891377 GGCAGGAGGACCAGAGTGGCAGG + Intronic
1133224889 16:4336355-4336377 GCCAGGAGTTCCAGACCAGCAGG - Intronic
1134316154 16:13120683-13120705 CCCAGGATGCCCCGAGCTGTGGG + Intronic
1134439906 16:14293204-14293226 CCCAGGAGGCCAAGAGCTCCAGG - Intergenic
1137013104 16:35344168-35344190 ACCAGGAGACCCAGTGCAGCCGG - Intergenic
1137033054 16:35543355-35543377 ACCAGGAGACCCAGTGCAGCAGG - Intergenic
1137384832 16:48031745-48031767 GCCAGGTGAACCAGAGGTGCTGG - Intergenic
1138119646 16:54389149-54389171 GCCAGGCTGCCCCTAGCTGCGGG - Intergenic
1138351363 16:56347820-56347842 GCCTGGCTGCCCAGAGCTGTGGG - Exonic
1138460547 16:57145231-57145253 GGCAGGAAGCCCAGAGCTTGAGG - Intronic
1138541657 16:57691325-57691347 GCCAGGAGGCCCAGCCATCCAGG - Intergenic
1138776531 16:59729923-59729945 TCTAGCAGGCCCAGGGCTGCTGG - Intronic
1139295498 16:65897021-65897043 GCAAGGATGCCCACAGCTTCCGG + Intergenic
1139428866 16:66900458-66900480 GACAGGACACCCAGATCTGCTGG - Intergenic
1139586542 16:67907656-67907678 CACACAAGGCCCAGAGCTGCTGG - Intronic
1139964950 16:70740278-70740300 GCCACGGGGCCCAATGCTGCTGG - Intronic
1140123872 16:72104764-72104786 TCCCCGAGTCCCAGAGCTGCAGG - Intronic
1141365675 16:83440518-83440540 GCCTGTAGTCCCAGAGCTTCAGG + Intronic
1141473441 16:84255085-84255107 GCCAGAAGCCCCAGAGCTGAGGG + Intergenic
1141624544 16:85254335-85254357 GCCAGGAGAACCAGGTCTGCAGG - Intergenic
1141878116 16:86840297-86840319 GCTGGGAGGACCAGAGCAGCAGG - Intergenic
1142151077 16:88512807-88512829 GCCAGGTGGGCCAGAGTCGCAGG + Intronic
1142192726 16:88725355-88725377 GCCAGCAGGCACAGACATGCTGG + Intronic
1142262166 16:89048130-89048152 GCCTGGAGGGCCGGCGCTGCTGG + Intergenic
1142326509 16:89418930-89418952 GTCAGGAGGTCCAGATCAGCCGG - Intronic
1142337647 16:89500516-89500538 TCCACGAGGCCCAGAGGAGCTGG - Intronic
1143112914 17:4562813-4562835 GCTAATAGGTCCAGAGCTGCAGG - Intergenic
1143517463 17:7426989-7427011 GGCCTGAGGCCCAGGGCTGCCGG + Exonic
1143893728 17:10120985-10121007 GGCAGGAGTGGCAGAGCTGCAGG + Intronic
1144304644 17:13957029-13957051 TCCAAGAGGCCCACAGCTTCTGG - Intergenic
1144348631 17:14372961-14372983 GCCAGGAGGCCTTGAACTGTTGG + Intergenic
1144386186 17:14751203-14751225 AGCAGGAGGCCCAGAGCACCTGG - Intergenic
1144848123 17:18230602-18230624 GCAAGGAGACACTGAGCTGCCGG - Intronic
1145023916 17:19453398-19453420 GCCACGAGGCCCACAGCAGCTGG - Intergenic
1145038175 17:19555812-19555834 GGAAGGAGGCCCAGTCCTGCAGG - Exonic
1145911483 17:28546016-28546038 CCTAGGAGGCCCAGAAGTGCTGG - Intronic
1146009092 17:29179970-29179992 CCCAGGTGGCCCGGAGCTGCGGG - Intronic
1146535445 17:33646868-33646890 GCCAGCAGGCACAGTGCTGGGGG + Intronic
1146790791 17:35749412-35749434 ACCATGAGGTCCAGAGCTGATGG + Intronic
1147140745 17:38459388-38459410 TGCAGGAGCCCCAGAGCTTCCGG - Intronic
1147187944 17:38722735-38722757 GCGGGGAGGCCAGGAGCTGCTGG - Exonic
1147357538 17:39909627-39909649 GCAAGGTGGCCAAGAGCAGCAGG + Intronic
1148110825 17:45144003-45144025 GCCAGGAGGCCCGGACCAGTTGG + Exonic
1148795763 17:50195947-50195969 GCCAGGAGGACCAGCGGGGCCGG + Exonic
1148975945 17:51528323-51528345 GCCACGGGGGCCAGAGATGCTGG - Intergenic
1149582256 17:57758756-57758778 ACCAGGAGGCCCAGAGAGGCTGG + Intergenic
1150425622 17:65074799-65074821 GCCAGGGGGCTCTAAGCTGCTGG - Intergenic
1150811996 17:68363951-68363973 GCCAGTGGGCTGAGAGCTGCAGG + Intronic
1151050567 17:70973775-70973797 GCAAGGTGGCCCAGATTTGCAGG + Intergenic
1151384890 17:73748925-73748947 GCCAGCAGGTACAGAGCAGCGGG - Intergenic
1151415064 17:73956780-73956802 CCCAGGAGGCCAAGGCCTGCAGG - Intergenic
1151758671 17:76088718-76088740 GCCAGGAGGCATCGTGCTGCCGG - Intronic
1152037050 17:77880056-77880078 GCTGGGGGGCCCAGCGCTGCCGG + Intergenic
1152234677 17:79132552-79132574 GGCAGGAGTGCCAGAGCTGCTGG + Intronic
1152239845 17:79155569-79155591 GCCCGGAGGGCCACAGCTGGGGG + Intronic
1152407752 17:80107376-80107398 GCCAGGGTGCCAAGGGCTGCAGG + Intergenic
1152651906 17:81498870-81498892 GCCAGGGGCCTCAGAACTGCGGG - Intergenic
1152682032 17:81673453-81673475 GCCGGGAGGCCCAAAGTGGCTGG + Exonic
1152875987 17:82786486-82786508 GCCAGGCTGACGAGAGCTGCAGG - Intronic
1152949686 17:83221741-83221763 GGCAGGAGGCCAAGAGGAGCTGG - Intergenic
1152992822 18:378279-378301 GCCAGGCTGCACAGAGCTGAGGG + Intronic
1153372618 18:4336458-4336480 GCAATGAGGCCCAAAGATGCTGG + Intronic
1153647602 18:7209120-7209142 GTCAGGAGTTCCAGAGCAGCCGG + Intergenic
1153838824 18:8988379-8988401 ACCAGGAGCCTGAGAGCTGCAGG + Intergenic
1154457619 18:14544182-14544204 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1155007727 18:21742990-21743012 GCCAGGAGTTCCAGACCAGCCGG - Intronic
1155607183 18:27620175-27620197 GTCAGGTGGCCCAGGACTGCAGG - Intergenic
1155644713 18:28063630-28063652 AGCAGGAGGCCCATAGCTTCAGG + Intronic
1156401925 18:36747423-36747445 TCCAGCAGACCCAGAGATGCAGG - Intronic
1157134866 18:45044429-45044451 CCTTGGTGGCCCAGAGCTGCGGG - Intronic
1157442439 18:47721133-47721155 TCCCCAAGGCCCAGAGCTGCTGG + Intergenic
1157520561 18:48342412-48342434 GCCAGGAGGGACAGGGCTGGGGG + Intronic
1157522467 18:48354884-48354906 GCCAGGAGGCCTGGAGCTGAGGG - Intronic
1157566811 18:48683919-48683941 ACCATGAGGCCCAGGGCTGCTGG + Intronic
1158393797 18:57064208-57064230 GCCATGAGGGGCAGAGCTGCTGG - Intergenic
1158411315 18:57208462-57208484 GCCAGGAAGACCAGGGCTGTGGG - Intergenic
1158456554 18:57613280-57613302 GCCAGGAGTTCCAGAGCAGACGG + Intronic
1158559285 18:58499869-58499891 GCCATGAGGATCAGATCTGCTGG + Intronic
1160505624 18:79425344-79425366 GCCATGAGGCCCGCGGCTGCCGG + Intronic
1160707183 19:535164-535186 CCCTGGAGGTCCAGATCTGCTGG - Intronic
1160710134 19:547582-547604 TCCAGGAGTCCCACAGCCGCAGG - Intronic
1160716305 19:578300-578322 GCCAGGCCGCCCAGCGCTGGTGG - Intronic
1160983235 19:1826323-1826345 GCCAGGAGACCCAGGGGTCCAGG + Intronic
1161072087 19:2267609-2267631 ACCAGGAGGCCCCCAGCTCCTGG + Intronic
1161124123 19:2546416-2546438 GCCGTGGGGCCCAGGGCTGCGGG + Intronic
1161154928 19:2727606-2727628 GGCAGAGGGTCCAGAGCTGCTGG + Intronic
1161478498 19:4499025-4499047 GCGAGGAGGCCGTGGGCTGCTGG + Intronic
1161698367 19:5782651-5782673 GCAAGGCTGCCCAGAGCAGCAGG - Intergenic
1161844728 19:6706372-6706394 GCCAGGAGGCCCAGGCCTGAGGG - Intronic
1161953357 19:7479553-7479575 GCCCTAAGGCCCAGGGCTGCCGG - Intronic
1161953989 19:7482866-7482888 GCCTGGAGGCCCATCCCTGCCGG - Intronic
1162418987 19:10555125-10555147 GCCAGAAGGCCCAGAACTCATGG - Exonic
1162512492 19:11128001-11128023 GCAACGTCGCCCAGAGCTGCAGG - Exonic
1162716497 19:12637758-12637780 GTCAGGAGTTCCAGAGCAGCTGG + Intronic
1162776785 19:12984734-12984756 GCCAGGAGGCCCCCAGGTGGGGG - Intergenic
1162894863 19:13759205-13759227 TCCAGGAGGCCCAGAGCGCCTGG + Exonic
1163208755 19:15824388-15824410 GCCAGGAGGCCCAGACCTAAGGG + Intergenic
1163218444 19:15897524-15897546 GCCAGGAGGCCCCGACCAGCAGG + Exonic
1163268062 19:16233419-16233441 GCCACTAGGGCCAGAGCTGTTGG + Intronic
1163772266 19:19198251-19198273 GCCAGGAGGCTGAGAGGTCCTGG - Intronic
1164137400 19:22427468-22427490 GCCTGGAGCCCCAGAGGTCCGGG + Intronic
1164157869 19:22607474-22607496 GGCAGGAGGCACAGGGCAGCTGG - Intergenic
1164160785 19:22624179-22624201 GCCTGGAGACCCAGAGGTCCAGG - Intergenic
1164179390 19:22806547-22806569 GCCTGGAGCCCCAGAGTTCCCGG + Intergenic
1165747377 19:38237967-38237989 GCCAGGAGATCCAGAGGTGTTGG + Intergenic
1165899775 19:39163752-39163774 GGCAGTAGTCCCAGAGCAGCAGG - Intronic
1166351487 19:42200621-42200643 GGTTGGAAGCCCAGAGCTGCTGG + Intronic
1166861684 19:45815182-45815204 GCCAGGAGGCACAGATCTCTAGG + Exonic
1167493529 19:49805373-49805395 GTCAGGAACCCCAGAGCTCCCGG - Intronic
1168230278 19:55026974-55026996 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230298 19:55027028-55027050 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230318 19:55027082-55027104 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230338 19:55027136-55027158 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230358 19:55027190-55027212 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230378 19:55027244-55027266 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230396 19:55027298-55027320 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230433 19:55027406-55027428 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
1168230453 19:55027460-55027482 GGCAGGAAGCCCTGGGCTGCAGG - Intronic
925237466 2:2292205-2292227 GCCACGGACCCCAGAGCTGCAGG - Intronic
926008745 2:9392343-9392365 GCAATGAAGCCCAGAGATGCTGG - Intronic
926163792 2:10505538-10505560 CCCAGGAGGCCCACAGCCACAGG - Intergenic
926465460 2:13181298-13181320 GCCAGGGCGACCAGAGCAGCAGG + Intergenic
927110076 2:19858317-19858339 GCCAGGGGCCCCACAGGTGCTGG - Intergenic
927111980 2:19869943-19869965 GGCAGGAGGCCCAAAGCTGTAGG + Intergenic
927229199 2:20803332-20803354 GCCAGGAGCCCCAGACCAGGTGG + Intronic
928121940 2:28590106-28590128 GCCAAGAAGCCCAGTGCAGCCGG - Intronic
929143317 2:38685328-38685350 GCCTGGGGGCACAGAGTTGCTGG + Intronic
929420044 2:41781225-41781247 GCAAGGGGGCCCAGAGATGTAGG - Intergenic
929505761 2:42526534-42526556 GCCAGGGTGCCCAGAGATGACGG - Intronic
929581515 2:43084382-43084404 GCCAGGAGCACCAGAGGTGGGGG - Intergenic
929771558 2:44896611-44896633 CCCAGGAGGCAGAGAGCTGAGGG + Intergenic
929919192 2:46160610-46160632 GGCAGGAGCCCCAGTGCTGTGGG + Intronic
930512944 2:52368820-52368842 GCCAGGAGGCCAGGTCCTGCAGG - Intergenic
932085012 2:68750219-68750241 GCCAGGAGTCCAAGACCAGCTGG - Intronic
932144698 2:69307090-69307112 GCCGGGAGCCCCAGACCCGCCGG - Intergenic
932572373 2:72944899-72944921 CCCAGGGGGCCCAGGACTGCTGG + Exonic
932657945 2:73626562-73626584 GATAGGAGGCCCAAAGCTGTAGG - Intergenic
932664624 2:73686901-73686923 GATAGGAGGCCCAAAGCTGTAGG - Intergenic
932698777 2:73978870-73978892 GCCAGGGGGCCCAGAGAAGGTGG - Intergenic
933061260 2:77739879-77739901 GCCAGGAGTCCAAGATCAGCTGG + Intergenic
933997290 2:87679287-87679309 GGCAGGAGGCCCAGGGTTGTTGG - Intergenic
934300939 2:91775735-91775757 GAGATGAGGCCCAGAGCTTCTGG + Intergenic
934579528 2:95427330-95427352 GCCTGGAGGCCCAGCCCTGCGGG + Intergenic
934599916 2:95649395-95649417 GCCTGGAGGCCCAGCCCTGCGGG - Intergenic
934883993 2:98008494-98008516 GCCAGGTTTTCCAGAGCTGCTGG + Intergenic
935299600 2:101682465-101682487 CCCAGGAGACTCAGAGCTGGTGG + Intergenic
936081489 2:109435470-109435492 GCTAGGAGGCCCTGAAGTGCTGG + Intronic
936296562 2:111271623-111271645 GGCAGGAGGCCCAGGGTTGTTGG + Intergenic
936491088 2:112972753-112972775 GCAAGGAAGCCCACAGATGCAGG - Intergenic
936534987 2:113304883-113304905 GCTAGAAGGCCCAGAGCTTTTGG - Intergenic
937064319 2:119005844-119005866 GCCAGTCTGCCCAGAGCTGCAGG - Intergenic
937447754 2:121973128-121973150 GCCTGGAGGCCGAGAGCCGGGGG - Intergenic
938383491 2:130849285-130849307 GCCAGGGGGCAGAGAGATGCAGG + Intronic
938473934 2:131590538-131590560 GCCAGAAGCCCCACAGCTGTTGG + Intergenic
938482658 2:131674092-131674114 GGCAGTCGGCCCACAGCTGCAGG - Intergenic
940998880 2:160180388-160180410 GCCTGTAGTCCCAGAGCTGGAGG - Intronic
941554828 2:166964607-166964629 GCTGGTAGTCCCAGAGCTGCAGG - Intronic
942460315 2:176163791-176163813 GCCAGGTGGGTCAGAGGTGCAGG - Intronic
943611911 2:190044613-190044635 GACTGGAGGCCCAGACCTGGAGG + Intronic
945600917 2:211864004-211864026 GCCAGAAGGTCCAGTCCTGCTGG + Intronic
946044525 2:216810369-216810391 GGCGGGAGGCCCAGACCGGCAGG + Intergenic
946431811 2:219630270-219630292 CCCAGGTGGTCCAGAGCAGCAGG + Exonic
947263503 2:228251605-228251627 ACCAGCAGGCCCAGGGCTGTTGG + Intergenic
947541966 2:230985903-230985925 GCCAGTAAGCCCACATCTGCAGG + Intergenic
947836442 2:233179336-233179358 GGCAGGATGCACGGAGCTGCAGG - Intronic
947873697 2:233454116-233454138 ACCAGCAGGCGCAGAACTGCCGG + Intronic
948250486 2:236524658-236524680 GCCAGAGGACCCAGAGCTCCAGG - Intergenic
948251543 2:236533983-236534005 GCCAGGAGAGTCAGAGCTGGAGG - Intergenic
948365463 2:237451855-237451877 GTCAGGAGCCCCAGGGGTGCCGG - Intergenic
948478950 2:238238867-238238889 GTCAGGCTGCCCAGGGCTGCGGG + Exonic
948711906 2:239830416-239830438 GCCACAGGGACCAGAGCTGCAGG - Intergenic
948940036 2:241190931-241190953 GGCTGGAGGCCCAGGGCTGGTGG + Intronic
949046223 2:241873707-241873729 GACAGGAGGGGCTGAGCTGCTGG - Exonic
949054870 2:241922174-241922196 GACAGGAGGCCAGGAGGTGCCGG + Intergenic
1170351475 20:15446660-15446682 GCTTGGAGCCCCTGAGCTGCCGG - Intronic
1170438627 20:16355262-16355284 GCAGGGAAGCCTAGAGCTGCTGG - Intronic
1172184345 20:33021936-33021958 TCCAGGATGCCAAGAGATGCTGG + Intronic
1172483324 20:35284577-35284599 GCCGGGAGGCCGAGAGGGGCGGG - Intronic
1174045695 20:47731065-47731087 ACAAGGAGGCACACAGCTGCTGG + Intronic
1174361566 20:50032044-50032066 GCAAGCAGCCCCAGAGCAGCAGG + Intergenic
1174362046 20:50035028-50035050 GCAAGCAGCCCCAGAGCAGCAGG + Intergenic
1174560173 20:51425516-51425538 ACCAGGAGGCCCAGCCCTGCCGG + Intronic
1174892551 20:54412346-54412368 GCCAGGAGGCCCAGAATGTCTGG + Intergenic
1175832616 20:61974520-61974542 GGCGGGAGGCCCAGTGCTGGGGG - Intronic
1175900761 20:62359064-62359086 TCCCCGAGGCCCAGAGCTGCAGG - Intronic
1175949134 20:62573344-62573366 GCCAGGAAGACCAGACCAGCAGG + Intergenic
1176241934 20:64079440-64079462 GCCAGGAGCCCCCGATCGGCTGG + Exonic
1176253722 20:64139688-64139710 GCCCTGGGGCCCACAGCTGCCGG - Intergenic
1176816538 21:13609156-13609178 GCCAGAAGCCCCACAGCTGTTGG + Intergenic
1178132133 21:29585653-29585675 GCCCGGAGGCCCACACCTGTTGG - Intronic
1178378629 21:32089955-32089977 GGCAGGAGGCCCAGGGTCGCAGG - Intergenic
1178850763 21:36210296-36210318 GTCAGGAGGTCAAGAGCAGCCGG + Intronic
1179007794 21:37530261-37530283 GCCTGGAGTCCCAGAGATTCTGG + Intergenic
1179246801 21:39640298-39640320 GACAGGAGGCGCAGGGCTGGTGG - Intronic
1179439946 21:41386602-41386624 ACCTGGAGGCCCCGATCTGCAGG - Intronic
1179625291 21:42645811-42645833 CCCAGGAGGCCCCGGGCTGAGGG + Intergenic
1179642563 21:42757066-42757088 GCCTCGCTGCCCAGAGCTGCTGG - Intronic
1179800912 21:43811157-43811179 GCCAGGAGGGCCACAGCTGCAGG - Intergenic
1179997511 21:44980830-44980852 GCCAGGAAACCAAGGGCTGCCGG - Intergenic
1180093995 21:45546280-45546302 GCCTGGAGCCCCGGAGCTCCTGG + Intergenic
1180163627 21:46009125-46009147 GGCAGGAGGCACAGAGCCCCGGG + Intergenic
1180483886 22:15777710-15777732 GGCAGTCGGCCCACAGCTGCAGG - Intergenic
1180716437 22:17875801-17875823 GCCGGGCGGCCCACAGCTGCGGG - Intronic
1180816216 22:18791409-18791431 GAGATGAGGCCCAGAGCTTCTGG - Intergenic
1180945232 22:19688897-19688919 GAGAGGACGCCCAGAGCTGCAGG - Intergenic
1181202405 22:21225741-21225763 GAGATGAGGCCCAGAGCTTCTGG - Intronic
1181699301 22:24610873-24610895 GAGATGAGGCCCAGAGCTTCTGG + Intronic
1182015097 22:27032626-27032648 GCCAGCTGGCCCAGAGCACCCGG - Intergenic
1183314217 22:37128302-37128324 CCCAGGAGTCCCAGACCTGGTGG - Exonic
1183332421 22:37228702-37228724 GCCCGAAGGCACAGAGCTGGGGG + Intronic
1183382495 22:37497123-37497145 CCCAGGGGGCCCAGAGCCGCAGG - Exonic
1183411726 22:37658893-37658915 GCCGGGCGCCCCGGAGCTGCTGG + Exonic
1183412357 22:37662380-37662402 GACAGGAGGCCCAGAGCATTTGG + Intronic
1183612913 22:38922722-38922744 GTGAGGAGACCCAGAGCTGAGGG + Intergenic
1183710208 22:39498851-39498873 GCCAGGTGCCCCTTAGCTGCAGG - Intergenic
1184242906 22:43220839-43220861 CTCAGCAGGCCCAGAGCTGGGGG - Intronic
1184404829 22:44293909-44293931 GCCAGGACCCCCTGTGCTGCTGG + Intronic
1184505785 22:44901232-44901254 TCTAGGATGCCCTGAGCTGCTGG + Intronic
1184602139 22:45549837-45549859 CCCAGGAGTCCCAGACCTGGTGG + Intronic
1184740933 22:46428747-46428769 GCCAGGAGGCCCAGAGCTGCTGG - Intronic
1184982214 22:48102727-48102749 CCCAGGTGGCTCCGAGCTGCTGG + Intergenic
1185071263 22:48658049-48658071 TCCAGGAAGCCGAGAGCTGAGGG + Intronic
1185217466 22:49609681-49609703 GGCGGGAGGCCTGGAGCTGCTGG + Intronic
1185322816 22:50209702-50209724 GCCAGGAGCCCCCAAGGTGCAGG - Intronic
1185331808 22:50255355-50255377 TCCAGGAGGTTCACAGCTGCGGG + Exonic
1203224508 22_KI270731v1_random:69672-69694 GAGATGAGGCCCAGAGCTTCTGG + Intergenic
1203266319 22_KI270734v1_random:17120-17142 GAGATGAGGCCCAGAGCTTCTGG - Intergenic
950311409 3:11961683-11961705 GCCAGGAGTTCCAGACCAGCCGG + Intergenic
950359642 3:12441251-12441273 GCCAGGCCTCCCAGGGCTGCAGG + Intergenic
950415956 3:12869171-12869193 GCCAGGAGGCGGTGAGCGGCGGG - Intronic
950481737 3:13248343-13248365 GCCAGGAAGTCCAGAGCTCGGGG - Intergenic
950644342 3:14368195-14368217 GCCAGGAGGCCCAGGTGTGGTGG - Intergenic
950841992 3:15976633-15976655 GGCAGGAGGCAGAGAGCAGCAGG - Intergenic
953326168 3:42013903-42013925 CCCAGGAGCGCCAGAGCGGCAGG + Intronic
953886483 3:46717244-46717266 GTCTGGAGGCCCAGAGCTCTGGG - Intronic
954365308 3:50142909-50142931 GACAGCAAGGCCAGAGCTGCAGG + Intergenic
954410886 3:50370429-50370451 GCCGGGGGGCTCAGAGCTGACGG + Intronic
954681075 3:52346274-52346296 CCCTGGGGGCCCAGAGCTGCTGG - Intronic
954867009 3:53738196-53738218 TCCTGGAGGCACAGATCTGCAGG - Intronic
958966070 3:100559974-100559996 GCCTGCAGGCCCAGAGCAGACGG + Intronic
959839290 3:110955798-110955820 GCCTGGAGGACCAGAGTTGGAGG - Intergenic
960149019 3:114232302-114232324 GCCTGGAGGTCCAGGGCTGGGGG + Intergenic
960290502 3:115878670-115878692 GCCAGGAGTTCTAGAGCAGCCGG - Intronic
961165389 3:124760029-124760051 GTCTGGAGCCCCAGAGCTGGGGG + Intergenic
961822954 3:129584577-129584599 GCCTGGACCCCCAGAGCTGAGGG - Intronic
962277899 3:134029789-134029811 GGCAGGAGCCCCATGGCTGCGGG + Exonic
966220606 3:177547570-177547592 CCCAGGATTCCAAGAGCTGCTGG - Intergenic
966350382 3:179027776-179027798 GCCAGGAGGCCGAGTGATCCTGG - Exonic
967111389 3:186297256-186297278 GACAGGAGCCCCAGAGATGGAGG + Intronic
967503064 3:190222557-190222579 GGCTGGAGGCCCAGAACTGTAGG + Intergenic
967544673 3:190710911-190710933 GCCAGGTATCCCAGAGCTGAAGG + Intergenic
968491477 4:892723-892745 CCCAGGACGCCCAGAGCTGAGGG + Intronic
968588538 4:1446208-1446230 CCCAGGAGACCCCGAGCTGCCGG - Intergenic
968632302 4:1658366-1658388 GGCAGGAGGGCCTGAGCTTCAGG - Intronic
968656455 4:1780350-1780372 GTCAGGAGGCCCACACCTGGTGG + Intergenic
968728280 4:2258328-2258350 ACAGGGAGGCCCAGAGCTGCAGG + Intronic
968815095 4:2818015-2818037 GACAGGAGGCCCACATCTGTTGG - Intronic
968864390 4:3198567-3198589 GCCAGGCAGCCCAGATCTGGGGG + Intronic
968909384 4:3469758-3469780 GCCAGGGGGCAAAGCGCTGCAGG - Intronic
968967445 4:3776302-3776324 GCCAGGCTGCCCAGTGCTCCTGG - Intergenic
969182629 4:5453959-5453981 GACAGGAGACCCAGAGCTCAGGG - Intronic
969441264 4:7218063-7218085 GCCAGGGTGGGCAGAGCTGCCGG + Intronic
969721635 4:8895507-8895529 ACTAGGAGGCCCAGGGCAGCTGG + Intergenic
970528036 4:16952732-16952754 CCCAGGAGGCTCTGAGCTCCTGG - Intergenic
972554878 4:40171814-40171836 TCCAAGAGTCCCAGAGCTGATGG + Intergenic
974069298 4:57109920-57109942 GCCAGAGGGCCGAGAGCCGCGGG - Exonic
981711178 4:147710156-147710178 GCTAGCAGACACAGAGCTGCAGG + Intergenic
983986249 4:174063532-174063554 GCCAGGAGGTCGAGACCAGCTGG + Intergenic
985209478 4:187576943-187576965 GCCAGGAAGCTCAGGGCTTCAGG + Intergenic
985403590 4:189615402-189615424 GCCAGCAGGGCCAGCACTGCTGG + Intergenic
985790771 5:1925943-1925965 ACCAGAAGGCACAGAGCTCCAGG - Intergenic
985901923 5:2803243-2803265 GCCATGAGGCCTTGAGCTGTGGG - Intergenic
986307727 5:6528223-6528245 GCAGGGAGACCCACAGCTGCTGG - Intergenic
987534769 5:19170434-19170456 GCCAGAAGACCCAGAGCAACAGG - Intergenic
988486562 5:31672502-31672524 GGCAGGAGGCCCTGGGCTGGAGG - Intronic
988532337 5:32038678-32038700 GCCAGCAGGCACAGTGCTGAGGG - Intronic
989028685 5:37094112-37094134 GCCAGGAGGGCCAGAGAGTCAGG + Intergenic
989170660 5:38468254-38468276 GCCAGAAGTCCCAGGGCTGCCGG + Intergenic
990500296 5:56389915-56389937 GGCTGGAGGCCCAGACCTGGGGG - Intergenic
991647757 5:68818463-68818485 GGCAGCAGGCCCAGTGCTTCAGG + Intergenic
993056850 5:82991272-82991294 GTCAATAGGCCTAGAGCTGCTGG - Intergenic
995503643 5:112835781-112835803 GCCAGGAGTTCAAGAGCAGCTGG - Intronic
996096062 5:119400439-119400461 ACAGGGAGGCCCAGAGCTCCAGG + Intergenic
997344365 5:133175984-133176006 CCCAGGAGTTCCAGAGCAGCCGG + Intergenic
997363361 5:133309568-133309590 GCTAGGAGTCCCACAGCTGGTGG - Intronic
997426116 5:133803824-133803846 CCCAGGAGTCCCATATCTGCAGG + Intergenic
997462005 5:134059147-134059169 GCAAGGAGCTCCAGAGCTCCAGG + Intergenic
998152366 5:139764680-139764702 GCCAGGAGGCCGAAACCTGATGG + Intergenic
1000041210 5:157486474-157486496 GCCAGCAGTCCCAGGGGTGCAGG + Intronic
1000254574 5:159525530-159525552 CCCAGGGGGACCAAAGCTGCTGG + Intergenic
1001551171 5:172603112-172603134 GCCAGGGGCCCCAAGGCTGCTGG - Intergenic
1001638684 5:173230546-173230568 GCCAGCTGGCCCAGACCTTCAGG + Intergenic
1001646042 5:173283164-173283186 TCCAGGACGCCCAGAGCCACAGG - Intergenic
1001797626 5:174515333-174515355 GCCAGGAGGCGGGGAGCTGAGGG - Intergenic
1002191247 5:177478852-177478874 GCCCGGAGGCACACAGCTGGTGG + Intergenic
1002423630 5:179163412-179163434 GAACAGAGGCCCAGAGCTGCTGG + Intronic
1002633120 5:180594054-180594076 GCCAGGACCCCAAGCGCTGCTGG - Intergenic
1002743918 5:181455553-181455575 GGCAGGAGGCCAAGAGGAGCTGG - Intergenic
1002854186 6:1022963-1022985 GCCAAGGGGGCCTGAGCTGCAGG - Intergenic
1002925754 6:1604921-1604943 CCCAGAAGGCTCAGAGCTGGGGG + Intergenic
1002935693 6:1670174-1670196 GGCAGAAGTCCCCGAGCTGCTGG - Intronic
1003020146 6:2502622-2502644 GCCAGCAGGCCCACAGCAACTGG - Intergenic
1003178922 6:3775561-3775583 GCCAGGAGCCACAGAGCAGTGGG - Intergenic
1003396630 6:5758998-5759020 GCCAGGAGGCCCTGAGATGGTGG + Intronic
1003654392 6:7992365-7992387 GGCAGGAGGAGCAGAGCAGCAGG + Intronic
1004190171 6:13456780-13456802 CCCAGGAGGCTCAGACCTCCTGG - Intronic
1004291667 6:14373374-14373396 TGCAGGAGCCCCAGACCTGCTGG - Intergenic
1004455253 6:15785931-15785953 CCCAGGTGGCCCACAGCTGGGGG + Intergenic
1004970943 6:20909803-20909825 GCCAGGAGGGACTGAGCAGCAGG + Intronic
1005574096 6:27176061-27176083 GACAGGAGGGCCAGAGCCTCTGG - Intergenic
1005712537 6:28515716-28515738 GACAGGAGGCCTGGAACTGCTGG + Exonic
1005852794 6:29834880-29834902 GTCAGTAGGACCAGAGCTGAAGG + Intergenic
1006850386 6:37093765-37093787 GTCAGGAAGCCCAGAGCAGGAGG + Intergenic
1007215743 6:40235807-40235829 GGCTGGAGGCCCAGACCTGGAGG - Intergenic
1007439518 6:41846103-41846125 GTCAGGAGGTCGAGAGCAGCTGG + Intronic
1007719054 6:43874645-43874667 GCCAGGAGGGCCAGTCCTGCAGG - Intergenic
1009035020 6:58106576-58106598 GCCTGGAGGCCCTGAGCTGACGG - Intergenic
1015605530 6:134951633-134951655 TCTGGGAGGCCCAGAGCAGCTGG + Intergenic
1017415298 6:154213966-154213988 GTCATGAAGCCCACAGCTGCCGG + Intronic
1017906262 6:158759196-158759218 AGCAGGTGGCACAGAGCTGCAGG + Intronic
1017906264 6:158759213-158759235 TGCAGGTGGCACAGAGCTGCAGG + Intronic
1018870416 6:167778444-167778466 CCCAGGAGGGCAGGAGCTGCAGG - Intergenic
1019016622 6:168884990-168885012 TCCAGGGGGTCCAGACCTGCAGG + Intergenic
1019115154 6:169754262-169754284 GTCAGGAGGCACAGAGGGGCTGG + Intronic
1019248777 6:170728782-170728804 GGCAGGAGGCCAAGAGGAGCTGG - Intergenic
1019266483 7:120029-120051 GCCAGGAGCCCCTGAGGAGCAGG + Intergenic
1019298530 7:291255-291277 GCCAGGCGCCCCTGAGCGGCGGG - Intergenic
1019457504 7:1138123-1138145 GCCAGGAGACCCAGAGCCCCGGG - Exonic
1019755017 7:2762630-2762652 GCCATGAAGCACAGAGCGGCAGG + Intronic
1021963095 7:25891985-25892007 GCCAGGTGGGCAAGAGATGCAGG - Intergenic
1022099509 7:27160882-27160904 TCCCGGGGGCCCAGTGCTGCCGG - Intergenic
1022519721 7:30998358-30998380 GCCATCAAGCTCAGAGCTGCAGG + Intergenic
1023004318 7:35846837-35846859 TCCATGAGGCCCAGAGTTCCTGG + Intronic
1023607531 7:41943689-41943711 CCCTGGAGGACCAGAGCTGGAGG - Intergenic
1023794737 7:43782415-43782437 GCCAGGATTCCTAGAGCTACTGG + Intronic
1024374124 7:48618574-48618596 GCCAGGAGGCAGAGGGCAGCTGG + Intronic
1024428770 7:49261775-49261797 GCCAGGAGGCCCAGAGTGCTAGG + Intergenic
1024961681 7:54982905-54982927 GGCAGGGGGCACGGAGCTGCTGG - Intergenic
1025004755 7:55345032-55345054 GCCAGGCAGCTCAGAGCAGCGGG + Intergenic
1025023670 7:55498877-55498899 CCCAGTAGGCCCAAAGCTCCTGG + Intronic
1026032627 7:66807554-66807576 GACAGGTGACCCAGAGCTGCAGG - Intronic
1026442761 7:70458360-70458382 ACCAGAAGGACCAGAGCTGGGGG - Intronic
1026674391 7:72416888-72416910 GCCAGGAGGCAGAGAAGTGCAGG + Intronic
1026832336 7:73617935-73617957 GCCAGGAGGCCAAGACATTCAGG + Intronic
1026936083 7:74256499-74256521 GCCAGGAGAACCAGAGATGGAGG + Intergenic
1027112631 7:75452964-75452986 GCTAGGAAGCACAGAACTGCAGG + Intronic
1027284877 7:76637569-76637591 GCTAGGAAGCACAGAACTGCAGG + Intergenic
1028905880 7:96153550-96153572 TGCAGGGGACCCAGAGCTGCAGG + Intronic
1029408144 7:100390167-100390189 TTCAGGAGCCCCATAGCTGCAGG - Intronic
1030643223 7:112029297-112029319 GCCAGGAGACTCAGATATGCTGG - Intronic
1031201755 7:118697296-118697318 GCCAGCAGTCCCAGAGCTCTTGG + Intergenic
1032017112 7:128387372-128387394 GCGAGGAAGCCAGGAGCTGCAGG - Intergenic
1033145104 7:138864394-138864416 GCCAGAAGGCCAGGAGCTCCTGG + Intronic
1033210651 7:139457696-139457718 ACCAGGAGGCCCAGAGGGGAAGG - Intronic
1033210795 7:139458857-139458879 GCCAGGGTGCCCAGAGGTACAGG - Intronic
1033249417 7:139745996-139746018 GCCAGGAGGAGCAGAGCAGATGG + Intronic
1034315216 7:150124591-150124613 GCCAGGATCCCCAGAGATACAGG - Intergenic
1034417135 7:150971160-150971182 GGCAGGAGGCCCAGAGGAGTGGG + Intronic
1034447971 7:151123062-151123084 GCGACGAGGCCCAGAGGGGCGGG + Intronic
1034791675 7:153976208-153976230 GCCAGGATCCCCAGAGATACAGG + Intronic
1034968578 7:155405864-155405886 GCTGGGAGGCCAGGAGCTGCTGG - Intergenic
1035220053 7:157401060-157401082 GCGAGGAGGCCGACAGCTGCCGG - Intronic
1035499268 8:78553-78575 GGCAGGAGGCCAAGAGGAGCTGG + Intronic
1036694522 8:10965877-10965899 ACCAGGTGGCCCACACCTGCTGG - Intronic
1037759400 8:21732087-21732109 GCCAGCGGGCCAAGAGCTCCTGG + Intronic
1037890857 8:22623086-22623108 GCCAGGAGGGGCAGAGCCACAGG + Intronic
1038124140 8:24652373-24652395 GCCAGGAGGGGCAGAGGTGATGG + Intergenic
1038741941 8:30224044-30224066 GGCAGGTGGTCTAGAGCTGCTGG - Intergenic
1038752168 8:30305652-30305674 GCAAGGACGCCCAGAGCCACAGG - Intergenic
1040610378 8:48977313-48977335 CCAAGGAGCCCCAGACCTGCGGG + Intergenic
1040771449 8:50982430-50982452 GCCATGAGACCCAGCGTTGCTGG + Intergenic
1041109379 8:54470420-54470442 GCCAGTAGGCCCAGCGATGAGGG - Intergenic
1041382182 8:57261478-57261500 GCCAGGTGCCCCTGAGCTCCTGG + Intergenic
1041480840 8:58318346-58318368 GCCAGGAGTCCCAGAGGAGAAGG - Intergenic
1041561798 8:59226505-59226527 GGCTGGAGGCCCAGGCCTGCAGG - Intergenic
1042283059 8:67076053-67076075 GTAAGGAGGCCCAGAAATGCTGG - Intronic
1044702281 8:94975511-94975533 TCCAGGAGGCCAGCAGCTGCAGG - Intronic
1045406623 8:101873159-101873181 CCCAAGAGGCCAAGGGCTGCTGG - Intronic
1045565502 8:103310473-103310495 GCCAGGAGGTCGAGACCAGCCGG - Intronic
1046614761 8:116463828-116463850 GACAGGAGGCAGAGAGCAGCTGG - Intergenic
1046638405 8:116698659-116698681 GCAAGGATGCCGAGAGATGCAGG - Intronic
1048101657 8:131358852-131358874 GCCAGGAGGCCAACACCTGCTGG - Intergenic
1048876003 8:138837532-138837554 GCCTGGGAGCCCAGAGCTGTGGG - Intronic
1049092835 8:140529703-140529725 CCCAGGGAGCCCAGGGCTGCAGG + Intergenic
1049269148 8:141684934-141684956 ACCAGGCGTGCCAGAGCTGCAGG + Intergenic
1049401679 8:142430461-142430483 GCTGGGAGGCACAGAGCTGCAGG + Intergenic
1049554599 8:143275665-143275687 GCAGGGTGACCCAGAGCTGCTGG - Intronic
1049559884 8:143304684-143304706 GCCTGGTGGCTCACAGCTGCAGG + Intronic
1049733515 8:144191466-144191488 GCCCAGAGGCCCAGTGCTGCTGG + Intronic
1053295149 9:36907446-36907468 CACAGGAGGCCCAGGGCTGTTGG - Intronic
1054760414 9:68999625-68999647 TCCAGGATGCTCAGAGCTGAAGG - Intronic
1056954949 9:91074258-91074280 GCCAGGAAGCCCAGAGCAAGAGG - Intergenic
1057046352 9:91889282-91889304 GCCAGGAGTCCCAGGGCCCCAGG + Intronic
1057476837 9:95410319-95410341 GCAGGGAGGGCCAGAGCTCCTGG + Intergenic
1057508088 9:95652984-95653006 GCCTGCAGGGCCAGTGCTGCAGG + Intergenic
1059293738 9:113250972-113250994 GCCAGAAGCCCCAAAGATGCTGG + Intronic
1059473421 9:114524708-114524730 GCCAGCAGGGCCAGAGCTGGAGG + Intergenic
1060033433 9:120234929-120234951 GCCAGGAATCCCAGAGCTCTGGG - Intergenic
1060829877 9:126706526-126706548 GCCACCAGGCTCAGAGCTGGCGG - Intergenic
1060992791 9:127858254-127858276 GCCAGGAAGGCCAGGGCTGCAGG + Intergenic
1061207399 9:129172956-129172978 GCCCAGAGCCTCAGAGCTGCAGG - Intergenic
1061806929 9:133141935-133141957 GCCAGGGAGCCCACGGCTGCAGG + Intronic
1061884090 9:133582909-133582931 GCGAGGAAGGCCACAGCTGCCGG + Intronic
1061903664 9:133685615-133685637 GCCAGGAGGAACAGAGCATCTGG + Intronic
1062015165 9:134287696-134287718 GGCAGCAGGCTCAGAGCAGCAGG + Intergenic
1062438149 9:136556266-136556288 GCCAGGAGGGCCGGGGCTCCAGG + Intergenic
1062562143 9:137146380-137146402 GCCATGAGGTGCAGAGCTTCAGG - Intronic
1062631104 9:137463535-137463557 GGGAGGGGGCCCGGAGCTGCTGG + Intronic
1062637109 9:137497330-137497352 GGCTGGGGGCCCAGGGCTGCAGG - Intronic
1062670464 9:137705889-137705911 GACAGGAGCCCCAGAGCTGTGGG - Intronic
1203530819 Un_GL000213v1:140311-140333 GCCAGAAGCCCCACAGCTGTTGG - Intergenic
1203609733 Un_KI270748v1:86046-86068 GGCAGGAGGCCAAGAGGAGCTGG - Intergenic
1187237001 X:17476855-17476877 GCCCGTAGGCTCAGAGATGCAGG + Intronic
1187260251 X:17678953-17678975 GCCCAGACTCCCAGAGCTGCTGG + Intronic
1188445062 X:30247114-30247136 GCCCGGAGGCCACGGGCTGCCGG + Intronic
1188757991 X:33987733-33987755 GCCATGAGGCCCAGCAATGCCGG - Intergenic
1189259882 X:39670724-39670746 TGCAGGAGGGGCAGAGCTGCAGG + Intergenic
1189267788 X:39730079-39730101 GCCAAGAGGCCCAGGGAGGCTGG - Intergenic
1189281755 X:39824047-39824069 CCCAGGAGGCCCAGCCCAGCAGG + Intergenic
1189717925 X:43883816-43883838 GCCAAGAAGCCCACAGCTTCAGG - Intergenic
1189906077 X:45760927-45760949 GCCAGGTGGACAAGAGCTGTAGG + Intergenic
1189988422 X:46573809-46573831 GCCGGGAGGAGCAGAGCCGCGGG - Exonic
1190679342 X:52811518-52811540 ACAAGAAGGCCCATAGCTGCGGG - Intergenic
1190733801 X:53241949-53241971 GCCAGGAGGCCTGAAGCTGATGG - Intronic
1192227742 X:69241046-69241068 GCCAGCAGGCTCAGGGCTGATGG + Intergenic
1193009179 X:76657027-76657049 GTCAGTAGGCTCAGAGCTGTAGG + Intergenic
1194593975 X:95835806-95835828 GGCTGGAGGCCCAGACCTGGAGG + Intergenic
1198018528 X:132635608-132635630 GCCAAGTGGCCCAGAGTTGGGGG - Intronic
1198208586 X:134493929-134493951 TCCAGGAGGTCCAGATCTTCAGG - Intronic
1199597967 X:149522997-149523019 GGCGGGATGCCCAGAGCTCCTGG - Intronic
1199844256 X:151679307-151679329 GCCAAGAGGCCCAAAACTCCTGG + Intergenic
1200250867 X:154553030-154553052 GCCTCGGGTCCCAGAGCTGCAGG + Intronic