ID: 1184740934

View in Genome Browser
Species Human (GRCh38)
Location 22:46428761-46428783
Sequence CAGTGAGGTGGAGCGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 298}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184740934_1184740940 2 Left 1184740934 22:46428761-46428783 CCTCCTGGCGCTCCACCTCACTG 0: 1
1: 0
2: 1
3: 35
4: 298
Right 1184740940 22:46428786-46428808 TCACTGCACAGCTCACTCACGGG 0: 1
1: 0
2: 3
3: 20
4: 186
1184740934_1184740941 12 Left 1184740934 22:46428761-46428783 CCTCCTGGCGCTCCACCTCACTG 0: 1
1: 0
2: 1
3: 35
4: 298
Right 1184740941 22:46428796-46428818 GCTCACTCACGGGTCCCCAGCGG 0: 1
1: 0
2: 0
3: 6
4: 126
1184740934_1184740944 26 Left 1184740934 22:46428761-46428783 CCTCCTGGCGCTCCACCTCACTG 0: 1
1: 0
2: 1
3: 35
4: 298
Right 1184740944 22:46428810-46428832 CCCCAGCGGGCCACACTGCCTGG 0: 1
1: 1
2: 1
3: 17
4: 224
1184740934_1184740939 1 Left 1184740934 22:46428761-46428783 CCTCCTGGCGCTCCACCTCACTG 0: 1
1: 0
2: 1
3: 35
4: 298
Right 1184740939 22:46428785-46428807 CTCACTGCACAGCTCACTCACGG 0: 1
1: 0
2: 2
3: 21
4: 191
1184740934_1184740942 13 Left 1184740934 22:46428761-46428783 CCTCCTGGCGCTCCACCTCACTG 0: 1
1: 0
2: 1
3: 35
4: 298
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184740934 Original CRISPR CAGTGAGGTGGAGCGCCAGG AGG (reversed) Intronic
900290816 1:1922892-1922914 CAGTGAGGGGCAAGGCCAGGAGG + Intronic
902384188 1:16067145-16067167 AACTGAGGTGGGGAGCCAGGCGG - Intronic
902508987 1:16955416-16955438 CCGGGAGGTGCAGCGCCAGGAGG + Exonic
903032205 1:20472014-20472036 AAATGAGGTGCAGTGCCAGGTGG - Intergenic
903547731 1:24137110-24137132 CAGTGAGTTGGAGCCCCTGTGGG - Exonic
903849407 1:26297106-26297128 CAGAGAGGTGGGGGGCCAAGAGG - Intronic
903892035 1:26576225-26576247 CAGTGAGGTGGGGAGGCAGGAGG + Intergenic
905166626 1:36086921-36086943 GAGTGTGGTGGAGCTGCAGGTGG - Exonic
905687531 1:39919390-39919412 CCGTGAGGGGGAGTGCCAGGAGG - Intergenic
906264494 1:44418010-44418032 CAGGGACGTGGAGGGCGAGGCGG - Intronic
906609358 1:47191041-47191063 CCCTGAGCTGGAGGGCCAGGTGG - Intronic
906659186 1:47570578-47570600 AAGTGAGGTAGGGTGCCAGGAGG - Intergenic
906719841 1:47997014-47997036 CAGCGAGGTTGAGCGCCCGGGGG - Intergenic
907545684 1:55258137-55258159 CAGGGAGGGGGAGCCCCAGCTGG - Intergenic
911496500 1:98637874-98637896 CAGTGGGGTAGAGCACCAAGTGG + Intergenic
912450734 1:109766043-109766065 CAGTGGGGTGGAGAGGAAGGGGG - Intronic
912915648 1:113812072-113812094 CGGTGAGGGGGAGCGAGAGGGGG + Exonic
915185996 1:154105703-154105725 TAGTGAGGTAGAGCACCAAGTGG + Intronic
916481509 1:165218773-165218795 CAGTGAAGTGGAGGGAGAGGCGG + Intronic
919737002 1:200958942-200958964 CCCTCAGGTGGAGCACCAGGGGG - Intergenic
919914783 1:202132648-202132670 GAGGGAGGTGGAGCGGGAGGAGG + Exonic
920049367 1:203154049-203154071 CAGGGAGGTGGAGGGCCGGGGGG - Intronic
921823127 1:219640614-219640636 CAGTGGGGTAGAGCACCAAGTGG + Intergenic
921990382 1:221359772-221359794 CAGTCAGGTGAAGCCTCAGGAGG - Intergenic
922781535 1:228256688-228256710 CAGGGAGGTGCAGGCCCAGGCGG + Exonic
924516187 1:244768193-244768215 CAGTGGGGTGTAGCACCAAGTGG - Intergenic
1063345729 10:5310908-5310930 CAGTGACGTGGAGGGTCAGGTGG - Intergenic
1065805849 10:29393262-29393284 CAATCACCTGGAGCGCCAGGGGG - Intergenic
1069659508 10:70114370-70114392 CTGGGAGGTGCAGCCCCAGGCGG - Intronic
1071588444 10:86847813-86847835 CAGTGGGATGGAGGGCAAGGAGG - Intronic
1071598291 10:86943484-86943506 TAGCAAGGTGGAGCGGCAGGTGG - Exonic
1071799426 10:89042533-89042555 CAGTGGGGTAGAGCACCAAGTGG - Intergenic
1072549775 10:96468743-96468765 CGGTGGGGTGCAGGGCCAGGTGG - Intronic
1076609322 10:131711319-131711341 CAGGGAGGAGGAGCGGGAGGAGG - Intergenic
1076731050 10:132439057-132439079 CAGTGTGGGCGAGCCCCAGGGGG + Intergenic
1076838105 10:133031529-133031551 CAGTGAGGTGGATCCCCAGCCGG + Intergenic
1077281868 11:1749535-1749557 CGCTGGGGTGGAGCGCCATGGGG - Intronic
1077858875 11:6157642-6157664 CAGTGAGGTAGAGCATCAAGTGG + Intergenic
1081761187 11:45577386-45577408 CAGGGAGGTGGTCTGCCAGGGGG + Intergenic
1083308507 11:61772802-61772824 CAGGTGGGTGGAGCTCCAGGAGG + Intronic
1083404342 11:62446317-62446339 GAGTCAGGTGGGGAGCCAGGTGG - Intronic
1084154281 11:67304875-67304897 GAGTGAGGAGGAGCTCCACGGGG + Exonic
1084778912 11:71396218-71396240 CAGTGAGGAGAAGCCCCACGCGG + Intergenic
1085147323 11:74213006-74213028 CAGTGGGGTAGAGCACCAGGTGG + Intronic
1085935232 11:81133681-81133703 TAGTGAGGTGGATTGCCTGGTGG + Intergenic
1087155074 11:94894275-94894297 CAGTGGTGTGGAGAGGCAGGGGG + Intergenic
1088151363 11:106749425-106749447 CTGTGAGGTGGAGCAGCAGAGGG - Intronic
1089946529 11:122479840-122479862 CAGTGGGGTAGAGCACCAAGCGG + Intergenic
1090839092 11:130473840-130473862 CAGTGGGGTGGAGAGTGAGGGGG - Exonic
1092243766 12:6851694-6851716 CAGTGAGGCGGAGCTTGAGGGGG - Exonic
1092395424 12:8121779-8121801 CAGTGAGTTGGAGTGCAAGCAGG + Intergenic
1094640840 12:32273864-32273886 CTGTGAGGTGGAGGGCCTGTTGG - Intronic
1096842822 12:54389897-54389919 TAGATAGGTGGAGTGCCAGGTGG + Intronic
1097150889 12:56979095-56979117 CAGTGGGGTAGAGCACCAAGTGG - Intergenic
1098435886 12:70468013-70468035 CACTGAGGTGGAGCCCCGGGAGG + Intergenic
1100329328 12:93570312-93570334 CAAGGAGCCGGAGCGCCAGGGGG + Intronic
1101226675 12:102694555-102694577 CAGTGGGGTGGAGCACCAAGTGG + Intergenic
1101835479 12:108292101-108292123 CAGTGTGGTGGAGCTCTAGGAGG + Exonic
1101969744 12:109304698-109304720 CAGGGGGATGGAGAGCCAGGCGG + Intronic
1102554632 12:113718975-113718997 CAGGGAGGAGCAGCCCCAGGAGG - Intergenic
1102687982 12:114739062-114739084 CAGTTAGCTGGAGCACCAGCCGG + Intergenic
1103506208 12:121443588-121443610 CAGTGGGGTGGAGGACCAGCGGG + Intronic
1103987759 12:124778847-124778869 CAGTGAGGGGCAGAGCAAGGGGG + Intronic
1104410116 12:128550813-128550835 AAGTGAGGGGCAGCCCCAGGTGG - Intronic
1104665681 12:130646059-130646081 GAGGGAGGTGGAGAGGCAGGTGG - Intronic
1104665699 12:130646119-130646141 GAGGGAGGTGGAGAGGCAGGTGG - Intronic
1104665706 12:130646143-130646165 GAGGGAGGTGGAGAGGCAGGTGG - Intronic
1104665713 12:130646167-130646189 GAGGGAGGTGGAGAGGCAGGTGG - Intronic
1104665731 12:130646227-130646249 GAGGGAGGTGGAGAGGCAGGTGG - Intronic
1104665748 12:130646287-130646309 GAGGGAGGTGGAGAGGCAGGTGG - Intronic
1104665781 12:130646395-130646417 GAGGGAGGTGGAGAGGCAGGTGG - Intronic
1104731525 12:131108006-131108028 CAGAGGAGTGGAGCCCCAGGAGG + Intronic
1104992819 12:132635649-132635671 CAGGGAGGTGGAGGCCCATGAGG - Intronic
1105511387 13:21054543-21054565 CCGTGTGGTGGAGGGCCAGTGGG - Intronic
1105828676 13:24144825-24144847 CAAGGAGGTGGATGGCCAGGAGG - Intronic
1105968601 13:25406706-25406728 AAGTGAGGTGGATCCCCAGGAGG - Intronic
1107834548 13:44403056-44403078 CAGTAAGGCGGAAAGCCAGGTGG + Intergenic
1110370002 13:74729189-74729211 CAGGGAGGTGGAGTGGCAGAGGG + Intergenic
1110623301 13:77623736-77623758 CAAAGAGGTTGAGCGACAGGTGG + Intronic
1111919569 13:94396148-94396170 CAGAGAGGTGAAGCGCCCTGGGG - Intronic
1112114072 13:96333870-96333892 CAGCAAGCTGGAGCTCCAGGGGG + Intronic
1112940438 13:104854947-104854969 CAGTGGGGTAGAGCCCCAAGGGG + Intergenic
1113065807 13:106373558-106373580 CAGTGACATGGAGGGCAAGGAGG + Intergenic
1113558662 13:111258746-111258768 CAGTGAGGTGGAACATCAAGTGG + Intronic
1113648923 13:112020094-112020116 CAATGAGGGGGAGGGGCAGGAGG - Intergenic
1114635158 14:24183095-24183117 CAGGGAGCGGGAACGCCAGGTGG - Exonic
1115282376 14:31678266-31678288 CAGTGGGGTGGAGCACCATGTGG - Intronic
1115431345 14:33322217-33322239 CAGTGAATTGGAGTGCCAGCAGG + Intronic
1118046790 14:61978757-61978779 CAGTGAGGGAGGGAGCCAGGTGG - Intergenic
1118395728 14:65334867-65334889 GTGTGAGGTGGGGCCCCAGGAGG - Intergenic
1118419938 14:65590827-65590849 CAGGGAGATGGAGTGCCAGAAGG - Intronic
1119045533 14:71315349-71315371 CAGAGAGGTGGAGCTGCAGTGGG + Intergenic
1119329377 14:73782845-73782867 CAATGAGGTGCAAAGCCAGGAGG + Intronic
1120275728 14:82370432-82370454 CAGTGGGGTGGAGCACTAAGTGG + Intergenic
1121304934 14:92900209-92900231 AAGTGAGAAGGAGCGCCAAGAGG + Intergenic
1121338593 14:93092022-93092044 GAATGAGGTGGAGAGCCTGGGGG - Intronic
1122795063 14:104201860-104201882 CAAAGAGGTGGTGGGCCAGGTGG - Intergenic
1124022824 15:25939592-25939614 CAGTGGGGTGGGGCGGAAGGAGG + Intergenic
1124787711 15:32697654-32697676 TGATGAGGTGGAGGGCCAGGAGG + Intergenic
1126225368 15:46262946-46262968 CTCTGAGATGGAGCTCCAGGGGG - Intergenic
1126706884 15:51414318-51414340 TAGTGGGGTGGAGCACCAAGTGG + Intergenic
1128271685 15:66315974-66315996 CAATGAGATGGAGAGCCAGGAGG - Intronic
1128498234 15:68210333-68210355 CAGAGAGCTGGAGCCCCAGCAGG - Intronic
1129250636 15:74307022-74307044 CACTAAGGAGCAGCGCCAGGAGG - Intronic
1129592679 15:76931629-76931651 CGGTGCGGAGGCGCGCCAGGAGG - Intronic
1130380180 15:83365309-83365331 TAGTGCGGGCGAGCGCCAGGAGG - Intergenic
1131021415 15:89102428-89102450 GAGTGAGGTGGAATGTCAGGAGG + Intronic
1131293118 15:91124426-91124448 CAGTGAGGAAGAGAGCCTGGAGG + Intronic
1132032000 15:98446060-98446082 GTGGGAGGTGGAGCGCCGGGGGG - Intronic
1132098474 15:99005712-99005734 CAGCGGGTTGGAGCGCCAGCAGG + Intronic
1132230626 15:100181286-100181308 CAGTGGGGTGGAGCACCAAGTGG - Intronic
1132870634 16:2114295-2114317 CAGTGAGGGGGAGCACGTGGTGG - Exonic
1133623812 16:7551363-7551385 CAGTGAGCTGGGGCCCCTGGAGG - Intronic
1134407032 16:13969774-13969796 CAGTGTGGTGGAGCACCAGGTGG - Intergenic
1136555844 16:31007435-31007457 GAGTGAGGTGGAGAGGAAGGTGG - Intronic
1136576801 16:31130109-31130131 GACTGAGGTGGACCGGCAGGGGG + Exonic
1137445612 16:48530100-48530122 GAGTGAGGTGGGGAGCTAGGAGG - Intergenic
1138468723 16:57214334-57214356 CAGTGAGGGGGAGGGCAGGGAGG - Intronic
1138495133 16:57404208-57404230 GCGTGAGGTGGAGAGCCACGGGG + Intergenic
1139492123 16:67291781-67291803 CAGTGAGGTGGACAGCCTAGGGG - Exonic
1139788289 16:69411795-69411817 GAGTGCGGTGGAGCCCCACGGGG - Intergenic
1140092821 16:71851600-71851622 CAGTGAGGGGAAGAGCCAGCCGG + Exonic
1140409926 16:74735279-74735301 CAGTGAGGTGGGGCTCTTGGTGG + Intronic
1141548460 16:84787996-84788018 CAGGGAGGTGGAGGGCGTGGGGG + Intergenic
1141804773 16:86335508-86335530 CAGCGAGGGGGAGGGGCAGGTGG - Intergenic
1142117951 16:88369904-88369926 CAGGGAGGTGGGTCCCCAGGAGG - Intergenic
1142856172 17:2731562-2731584 CAGTGAGGAGGAGGGGCAGAGGG - Intergenic
1143100923 17:4504276-4504298 CACCCAGGTGAAGCGCCAGGTGG + Intronic
1144728245 17:17512438-17512460 CAGGGAGGTGCAGGGCCAGGTGG - Intronic
1145885775 17:28381572-28381594 CAAGGAGGTGGAGCGCGAGGTGG + Exonic
1145906942 17:28521490-28521512 CAGTGATGCGGAGCGGGAGGTGG + Intronic
1145978413 17:28997533-28997555 CAGTGGGGGTGAGCGCCAGCTGG - Intronic
1149234903 17:54578337-54578359 CAGTGGGGTAGAGCACCAAGTGG + Intergenic
1149527492 17:57367915-57367937 CAGTGATGGGGAGCCACAGGTGG + Intronic
1151035314 17:70792273-70792295 CAGGGAGGTCCAGCGCCAGCAGG - Intergenic
1151293398 17:73166072-73166094 CAGCGAGTTGGATGGCCAGGAGG + Intronic
1152607684 17:81301290-81301312 CAGGAAGGGGGAGCACCAGGAGG - Intergenic
1153581747 18:6581095-6581117 CAGTGATGTGGAGCATCAGATGG - Intronic
1153642366 18:7167882-7167904 CAGAGAGGTGGTGCTGCAGGGGG + Intergenic
1153715041 18:7839161-7839183 CAGTGGGGTAGAGCACCAAGTGG - Intronic
1154246332 18:12702812-12702834 CGGGGAGGTGGAGCGGCGGGCGG - Exonic
1156228909 18:35135389-35135411 CTGGGAGGTGGAGTGCTAGGGGG - Intronic
1157936984 18:51884053-51884075 CAGTGAGGTAGATCACCATGTGG + Intergenic
1158482343 18:57832862-57832884 TACTGAGGAGGAGAGCCAGGAGG - Intergenic
1158959856 18:62580514-62580536 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959867 18:62580558-62580580 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959889 18:62580646-62580668 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959922 18:62580778-62580800 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158959996 18:62581086-62581108 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158960040 18:62581262-62581284 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158960177 18:62581834-62581856 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1158960188 18:62581878-62581900 CAGTGCTGTGGAAGGCCAGGTGG + Intronic
1159384866 18:67710360-67710382 TAGTGAGGTGGAGAGGCTGGAGG - Intergenic
1160017576 18:75156462-75156484 CAGCGAGGTGGAGGGCCTGTTGG - Intergenic
1160948500 19:1654541-1654563 CAGTGAGGTGGAGAGGGATGAGG - Intergenic
1161370521 19:3908602-3908624 CAGTGAGGAGGAGGGGAAGGAGG - Intronic
1163717237 19:18879586-18879608 CAGGGAAGTGGGGGGCCAGGCGG - Intronic
1165108350 19:33487399-33487421 CAGTGAGGTGGAAGGCCCCGAGG + Intronic
1165323854 19:35102708-35102730 CAGTGAGGTGGAGCCATGGGAGG - Intergenic
1165345637 19:35247753-35247775 GAGTGAGGAGGAGCCACAGGAGG + Intergenic
1165996800 19:39849360-39849382 GAGTGAGCTGGAGAGACAGGAGG - Intergenic
1168156126 19:54473793-54473815 GAGGGAGGTGGAGGCCCAGGTGG + Intergenic
925506332 2:4569075-4569097 CAGTGAGGTAGAGCACCAAGTGG - Intergenic
927865063 2:26582960-26582982 CAGTGAGGTGGGGCACAGGGTGG + Intronic
928386289 2:30871402-30871424 CTGTGGGGAGGGGCGCCAGGGGG - Intergenic
929215139 2:39404248-39404270 CAGTGGGGTAGAGCACCAAGTGG + Intronic
930970999 2:57396421-57396443 CAGTGAGGTAGATCACCAAGTGG - Intergenic
931662960 2:64585784-64585806 AAGTGAGGTGGGGGGGCAGGGGG - Intronic
933206450 2:79513022-79513044 GAGTGAGGCGGAGACCCAGGCGG + Intronic
934792183 2:97070695-97070717 CTGGGAGATGGAGCTCCAGGTGG - Intergenic
934814435 2:97313014-97313036 CTGGGAGATGGAGCTCCAGGTGG + Intergenic
934823258 2:97395469-97395491 CTGGGAGATGGAGCTCCAGGTGG - Intergenic
937875558 2:126823009-126823031 CAGGGAGGAGGAGCCCCAGGTGG - Intergenic
937950948 2:127387698-127387720 AAGTGCCGAGGAGCGCCAGGAGG - Intronic
938207676 2:129438074-129438096 CTATGGGGTGGGGCGCCAGGAGG - Intergenic
940348047 2:152647829-152647851 CGGTGAGGAGAAGCGTCAGGCGG + Exonic
940461597 2:153970373-153970395 CAGTGAGGTAGAAAACCAGGAGG - Intronic
941225289 2:162839710-162839732 AGGTGAGGCTGAGCGCCAGGGGG + Intergenic
941745952 2:169087457-169087479 CAGTGGGGTAGAGCACCAAGTGG - Intronic
942037860 2:172028348-172028370 CAGGAGGGTGGAGTGCCAGGAGG + Intronic
942251777 2:174053573-174053595 CAGTGTGGTGGAGGGAAAGGGGG + Intergenic
946558772 2:220889528-220889550 CAGTGAGGAGGAGGGGCTGGAGG - Intergenic
948046530 2:234950521-234950543 CAGTGAGGCGAAGGGGCAGGTGG - Intergenic
948851520 2:240710105-240710127 CTGTGAGGTGGAGCCTCAGACGG - Intergenic
1169551192 20:6703194-6703216 GAGTGGGGTGGAGGGCCAGGGGG - Intergenic
1170112583 20:12821889-12821911 CAATGAGGAGGAGTGCGAGGTGG - Intergenic
1171295892 20:24016697-24016719 CAGTGAGGATGATGGCCAGGAGG - Intergenic
1171430144 20:25077906-25077928 CAGTGAAGAGGGGCGCCTGGAGG + Intronic
1171898149 20:30829903-30829925 CAGTGGGGTAGAGCACCAAGTGG + Intergenic
1171942926 20:31348759-31348781 CAGTGGGGTGGAGTACCAAGCGG + Intergenic
1173322165 20:41998002-41998024 CAGAGAGGAGGAGGGCAAGGAGG - Intergenic
1175893769 20:62327125-62327147 CAGGGAGGGGGAGCTCCATGGGG - Intronic
1176131288 20:63497862-63497884 CGGTGATGGGGAGCCCCAGGGGG + Intronic
1176867048 21:14059445-14059467 CAGTGTGCTGGAGCGGTAGGAGG - Intergenic
1179432398 21:41332143-41332165 AAGTGAGATAGAGCGGCAGGGGG - Intronic
1179437046 21:41369298-41369320 CAGTGAGGAGGGACCCCAGGTGG + Intronic
1180066655 21:45415788-45415810 CAGCCGGGTGGAGCCCCAGGTGG + Intronic
1180323667 22:11347967-11347989 CAGTGGGGTAGAGCACCAAGCGG - Intergenic
1180418782 22:12794920-12794942 CAGTGAGGTGGTGTGCAGGGTGG - Intergenic
1180956814 22:19744890-19744912 CAGTGATGTGGGGCTCAAGGGGG + Intergenic
1182709120 22:32309747-32309769 GTGTGAGGTGGGGTGCCAGGGGG - Intergenic
1183484495 22:38081904-38081926 CGGTCAGGTAGAGCTCCAGGAGG + Exonic
1183832849 22:40428007-40428029 CAGTGTCGTGGGGTGCCAGGGGG - Intronic
1184281372 22:43439491-43439513 CAGGGAGGTGGGGCGGCTGGAGG + Intronic
1184470288 22:44692226-44692248 CTGGGTGGAGGAGCGCCAGGTGG - Intronic
1184529766 22:45047583-45047605 CACTGAGGTGGAGCCCCTGGGGG - Intergenic
1184740934 22:46428761-46428783 CAGTGAGGTGGAGCGCCAGGAGG - Intronic
1185108173 22:48885828-48885850 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1185148027 22:49149830-49149852 CAGTGAGGGGTAGCACCATGAGG + Intergenic
1185317030 22:50183734-50183756 CAGGGAGGGGGAGGGGCAGGAGG - Intergenic
949895065 3:8762566-8762588 CAGTGATGTGGAGAGCATGGTGG - Intronic
951938517 3:28051307-28051329 CAGTGAGGGGGAAGCCCAGGTGG + Intergenic
953134864 3:40173658-40173680 CAGTGAGCTGATGAGCCAGGCGG - Intronic
954187341 3:48927687-48927709 CAGCGATGTGGAGCAGCAGGGGG + Exonic
955274368 3:57533310-57533332 CAGTGGGGTAGAGCACCAAGCGG - Intronic
958147127 3:89640152-89640174 CAGTGAAGTAGAGCACCAAGTGG + Intergenic
958743804 3:98109404-98109426 CACTGGGGTGGAGCCTCAGGAGG + Intergenic
958896806 3:99838537-99838559 CTGTGAGGTGGAGCACAAGGAGG + Intronic
959913711 3:111793487-111793509 CAGTGGGGTAGAGCACCAAGTGG - Intronic
961432003 3:126890085-126890107 CAGTGAGCTGGAGCACCTTGGGG - Intronic
964398432 3:156272683-156272705 CAGTGGGGAGGAGCACCAAGAGG - Intronic
967219312 3:187235692-187235714 AAGTGTTGTGGAGCCCCAGGTGG - Exonic
967579699 3:191137422-191137444 CAGAGAGGTGGAGTGGGAGGAGG + Intergenic
968132095 3:196197880-196197902 CATGGAGGTGGAGCATCAGGAGG - Intronic
968178114 3:196568801-196568823 CAGTGAGGCGGGGCGCGCGGCGG + Exonic
972713863 4:41626034-41626056 AAGAGAGGTGGAGAGACAGGAGG + Intronic
973167115 4:47091799-47091821 CAGAGGCGTGGAGTGCCAGGAGG - Intronic
973226456 4:47790311-47790333 CACTGGGGTGGAGCCTCAGGAGG + Intronic
973363007 4:49182357-49182379 CAGTGAGGTGGTGTGCAGGGTGG + Intergenic
973398088 4:49614499-49614521 CAGTGAGGTGGTGTGCAGGGTGG - Intergenic
973691816 4:53442664-53442686 GATGGAGGTGGAGCGCCTGGTGG - Exonic
974819603 4:67049616-67049638 CAGGGAGGTGGAGGGGAAGGAGG + Intergenic
975313135 4:72925462-72925484 CAGTGGGGTAGAGCCCCAAGTGG - Intergenic
975592777 4:76017048-76017070 CAGTGAGGTAGAGCACCAAGTGG - Intronic
976095848 4:81507515-81507537 CAGTAAGCTGGAGACCCAGGAGG + Intronic
976722062 4:88178589-88178611 CAGTGAGGTAGAGCACCAAATGG + Intronic
976775117 4:88698750-88698772 CAGTGCGGGGGAGGGGCAGGAGG - Intronic
977810130 4:101347736-101347758 CAATGAGGAGGAGCGGGAGGCGG - Intronic
978030931 4:103939233-103939255 CAGAGGGGTAGAGCACCAGGTGG + Intergenic
978654376 4:111049040-111049062 CAGTTGGGTAGAGCACCAGGTGG + Intergenic
979413476 4:120406946-120406968 CAGTGGGGTAGAGCGCCAACTGG + Intergenic
979945838 4:126830348-126830370 CAGTGGGGTAGAGCACCAAGGGG + Intergenic
980596939 4:134966749-134966771 CAGTGAAGTAGAGCACCAAGTGG + Intergenic
981606367 4:146545569-146545591 CACTGGAGTGGAGCCCCAGGAGG - Intergenic
981836884 4:149064844-149064866 CAGTGAGGTAGAGCACAAAGAGG + Intergenic
983017244 4:162628517-162628539 AAGTGAGGTAGAGCACCATGTGG + Intergenic
985792738 5:1939243-1939265 GAGTGATGTGGAGACCCAGGGGG - Intergenic
988465197 5:31483764-31483786 CACTGAGGAGGAGTGGCAGGAGG - Intronic
989434174 5:41391720-41391742 CAGTGGGGTAGAGCACCAAGTGG + Intronic
990313589 5:54563652-54563674 CAGAAAGGTGGAGCATCAGGTGG - Intergenic
993728674 5:91397213-91397235 CAGTGAGGTGGAGAGCCTGTTGG - Intergenic
995713243 5:115055697-115055719 CTGTGAGGTGGAGGGTCTGGAGG - Intergenic
995770617 5:115665386-115665408 CAGTGAGGTAGAGCACCAAGTGG + Intergenic
995840146 5:116436364-116436386 CAGTCAGGAAGAGCACCAGGTGG + Intergenic
999282312 5:150373862-150373884 CAGTGTGCTGGGGCACCAGGGGG + Intronic
999551917 5:152698716-152698738 CAGTGACGAGGAGCCTCAGGAGG - Intergenic
1003235917 6:4295023-4295045 CAGTGAGGGGCAGGGGCAGGGGG + Intergenic
1003263993 6:4550302-4550324 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1003264024 6:4550380-4550402 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1003264029 6:4550396-4550418 CAGGTGGGTGGAGCTCCAGGTGG - Intergenic
1003512016 6:6789731-6789753 CAGGGAGGTGGGCAGCCAGGAGG - Intergenic
1004963543 6:20821007-20821029 AAGTGAGGGAGAGAGCCAGGAGG + Intronic
1005065737 6:21815969-21815991 GAGTGAGGAGGAGCTCGAGGTGG - Intergenic
1006180968 6:32153353-32153375 CGGAGAGGTGGGGCGCCTGGGGG + Intronic
1006191605 6:32212997-32213019 CAGGGAGGTGGCAAGCCAGGAGG + Intronic
1007001638 6:38319235-38319257 CAGTGAGGAAGAGCACCAAGTGG - Intronic
1007653027 6:43434818-43434840 CAGTGAGCTGGTGCCCCATGAGG - Exonic
1008537174 6:52515235-52515257 CAGGAAGGTAGAGCTCCAGGTGG + Intronic
1008940519 6:57041002-57041024 CAGTGAGGAAGAGCACCAAGTGG + Intergenic
1013482415 6:110563901-110563923 CTGTGAGGGGTAGAGCCAGGTGG - Intergenic
1016277931 6:142377294-142377316 CAGTGAGGTGGAGGGCCTGTTGG - Intronic
1016844285 6:148555966-148555988 CAGTCAGGCTGAGGGCCAGGTGG - Intergenic
1017974311 6:159341786-159341808 CAGTGAGGTGGAGGTGGAGGTGG + Intergenic
1018893216 6:167996829-167996851 CAGAGAGGTGGACAGCAAGGGGG + Intronic
1019554822 7:1624018-1624040 GAGTGAGGAGGAGGGCCGGGTGG - Intergenic
1023743388 7:43301046-43301068 CAATGAGGGGGAGAGCAAGGTGG - Intronic
1028022425 7:85792903-85792925 CAGTGAAGTAGAGCACCAAGTGG + Intergenic
1028861660 7:95658802-95658824 CACTGAGGTGGAGCCTCGGGAGG + Intergenic
1029443877 7:100602480-100602502 CAGTGAGGAGGGGCCCCAGGAGG - Exonic
1029508994 7:100981486-100981508 CAGAGAGAAGGAGCGTCAGGAGG + Intronic
1029750381 7:102539634-102539656 CCGTGAGGAGGACGGCCAGGAGG + Intronic
1029768333 7:102638742-102638764 CCGTGAGGAGGACGGCCAGGAGG + Exonic
1030410857 7:109178354-109178376 CAGTTAGGTTGAGAGCCAGGTGG - Intergenic
1031353452 7:120763051-120763073 CAGTGGGGTAGAGCACCAAGTGG - Intergenic
1032683110 7:134205425-134205447 CAATGAGGTGAAGCACCAGCTGG - Intronic
1034581779 7:152050085-152050107 CAGTGGGGTAGAGCACCAAGCGG - Intronic
1035919443 8:3661340-3661362 CAGTGAGGTGGAGAAACAGCTGG - Intronic
1036618211 8:10404775-10404797 CAGTGAGGTGGGTGGCCTGGGGG - Intronic
1037957759 8:23072019-23072041 GACTGGGGTGGAGCGCCATGCGG + Intergenic
1037977029 8:23221047-23221069 GAATGGGGTGGAGCGCCATGGGG - Intronic
1038955050 8:32458885-32458907 CAGTGAGATAGAAAGCCAGGAGG - Intronic
1039527700 8:38231522-38231544 CAGGGAGCTGCAGCGCCGGGCGG - Exonic
1039640787 8:39218841-39218863 CAGTGGGGTAGAGCACCAAGAGG - Intronic
1040949692 8:52925037-52925059 CACTGGGGTGGAGCCTCAGGAGG + Intergenic
1043497472 8:80818041-80818063 CAGTGAGGTAGAGAGTAAGGTGG + Intronic
1046557304 8:115790765-115790787 CAGTGGGGTAGAGCACCAAGTGG + Intronic
1048029878 8:130621230-130621252 CAGTGCAGTGGAGCTCCAAGTGG - Intergenic
1048062556 8:130935505-130935527 CAGGGAGGTGGACTGTCAGGAGG - Intronic
1049006200 8:139857190-139857212 GGGAGCGGTGGAGCGCCAGGAGG + Intronic
1049647039 8:143740172-143740194 CGGGGAGGTGGAGCACCAGGAGG - Intergenic
1049682159 8:143924198-143924220 CAGCGAGCTGGAGCGGCAGAAGG - Exonic
1050037258 9:1450281-1450303 CAGTTAGCTGCAGAGCCAGGAGG + Intergenic
1050536159 9:6632757-6632779 CAGTGAGGTTGAGAGAGAGGTGG - Intronic
1050865187 9:10488932-10488954 CAGTGGGGTAGAGCACCAAGCGG - Intronic
1051483625 9:17585454-17585476 CAGTGAGGTGTAGCCACAAGAGG + Intronic
1052915167 9:33919494-33919516 CAGGGAGCCGGAGCGCCAAGTGG + Exonic
1053120830 9:35546603-35546625 CAGTGCTGTGGAGGGGCAGGTGG + Exonic
1053222080 9:36320599-36320621 CTGGGAGGTGGAGTGGCAGGAGG - Intergenic
1054732413 9:68714636-68714658 CACTGAGGTGGAGAGCCCTGGGG - Intronic
1055827025 9:80339340-80339362 CAGTGGGGTAGAGCACCAAGTGG + Intergenic
1056180379 9:84076821-84076843 CAGTGAGGTAGAGCACCAAGTGG + Intergenic
1056230574 9:84538903-84538925 CAGTGAGGTAGAGCACCAAGTGG - Intergenic
1057371841 9:94480429-94480451 CAGTGTGCTGGAGCGGTAGGAGG + Intergenic
1060222989 9:121774208-121774230 CAGGGAGGTGGAGGGCAAGCAGG - Intronic
1061259068 9:129469666-129469688 CAGTGAGCTGGGGCTCCAGGAGG + Intergenic
1061915583 9:133751495-133751517 CAGTGGGGTAGAGCGCCAGATGG - Intergenic
1062344864 9:136109957-136109979 CCGTCAGGAGGCGCGCCAGGCGG + Intergenic
1062510100 9:136900445-136900467 CAGGGAGGTGGAGAGCCTGCCGG + Exonic
1203371339 Un_KI270442v1:308542-308564 CAGTGGGGTAGAGCACCAAGCGG - Intergenic
1185492838 X:532023-532045 CAGTGGGGTGGGGGGCCAGAGGG - Intergenic
1189194406 X:39140587-39140609 CAGTGATGTGAAGCCCAAGGAGG + Intergenic
1189875682 X:45433738-45433760 CAGTGGGGTAGAGCACCAAGTGG - Intergenic
1191984082 X:66959798-66959820 CAGGGAAGTAGAGCACCAGGTGG - Intergenic
1192304427 X:69944149-69944171 CAGTGGGGTAGAGCACCAAGTGG - Intronic
1192491583 X:71580167-71580189 TAGGGAGGTGGAGGGCCAGTGGG + Intronic
1192904702 X:75538639-75538661 CAGTGAGCTGGAGCCACTGGAGG - Intergenic
1192927107 X:75766945-75766967 CAGTGAGGTAGAGCACCAAGAGG + Intergenic
1193463481 X:81818073-81818095 CAGTGGGGTGGAGCAACAAGTGG - Intergenic
1193596418 X:83451518-83451540 CAGGGAGATAGAGCGCCAAGTGG - Intergenic
1194990724 X:100543975-100543997 CAGGGAGGTAGAGCACCAAGTGG + Intergenic
1195807836 X:108795617-108795639 CAGAGAGGTAGAGCACCAAGTGG - Intergenic
1197053911 X:122094292-122094314 CAGTAAGGTAGAGCACCAAGTGG + Intergenic
1198051211 X:132955391-132955413 GAGTGAAGAGGAGAGCCAGGGGG + Intronic
1198312553 X:135436247-135436269 CCTCGAGGTGCAGCGCCAGGAGG + Intergenic
1198770573 X:140126075-140126097 CAGTGAGGTAGAGCACCAAGAGG - Intergenic