ID: 1184740935

View in Genome Browser
Species Human (GRCh38)
Location 22:46428764-46428786
Sequence AGGCAGTGAGGTGGAGCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 307}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184740935_1184740939 -2 Left 1184740935 22:46428764-46428786 CCTGGCGCTCCACCTCACTGCCT 0: 1
1: 0
2: 2
3: 32
4: 307
Right 1184740939 22:46428785-46428807 CTCACTGCACAGCTCACTCACGG 0: 1
1: 0
2: 2
3: 21
4: 191
1184740935_1184740940 -1 Left 1184740935 22:46428764-46428786 CCTGGCGCTCCACCTCACTGCCT 0: 1
1: 0
2: 2
3: 32
4: 307
Right 1184740940 22:46428786-46428808 TCACTGCACAGCTCACTCACGGG 0: 1
1: 0
2: 3
3: 20
4: 186
1184740935_1184740942 10 Left 1184740935 22:46428764-46428786 CCTGGCGCTCCACCTCACTGCCT 0: 1
1: 0
2: 2
3: 32
4: 307
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data
1184740935_1184740944 23 Left 1184740935 22:46428764-46428786 CCTGGCGCTCCACCTCACTGCCT 0: 1
1: 0
2: 2
3: 32
4: 307
Right 1184740944 22:46428810-46428832 CCCCAGCGGGCCACACTGCCTGG 0: 1
1: 1
2: 1
3: 17
4: 224
1184740935_1184740941 9 Left 1184740935 22:46428764-46428786 CCTGGCGCTCCACCTCACTGCCT 0: 1
1: 0
2: 2
3: 32
4: 307
Right 1184740941 22:46428796-46428818 GCTCACTCACGGGTCCCCAGCGG 0: 1
1: 0
2: 0
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184740935 Original CRISPR AGGCAGTGAGGTGGAGCGCC AGG (reversed) Intronic
900481018 1:2899368-2899390 AGACAGGGAGGTGGAGGGCAGGG - Intergenic
901147089 1:7072624-7072646 AGAAAGTGGGGTGGAGGGCCAGG + Intronic
901530442 1:9849395-9849417 AGGCAGTGGAGTGGAGGGCATGG + Exonic
901727106 1:11250507-11250529 AGGGAGGGAGGAGGAGAGCCAGG - Intronic
902508985 1:16955413-16955435 GGGCCGGGAGGTGCAGCGCCAGG + Exonic
902510912 1:16966478-16966500 GCGCAGTGAGCGGGAGCGCCGGG + Exonic
902619791 1:17644170-17644192 AGGCAGTGAGCCTGAGCGCAGGG + Intronic
902733892 1:18387410-18387432 AGGCAGTTAGGCGAAGTGCCTGG - Intergenic
902834178 1:19036072-19036094 AGGCTGTGATGCCGAGCGCCAGG - Intergenic
903779028 1:25810025-25810047 AGGCACAGAGGTGGAGGGCCAGG - Intronic
904081119 1:27873070-27873092 AGGCAGTGTAGAGGAGGGCCGGG - Intronic
904900609 1:33854423-33854445 AGGCAGTGAGCAGGTGAGCCAGG + Intronic
905107875 1:35574772-35574794 AGGCACTGAGCTGGAGCCCTGGG - Intronic
905229906 1:36508454-36508476 AGACAGTGAGGGGGAGCGTGGGG + Intergenic
905456890 1:38094491-38094513 AGGCAGAGAGGTGGGGGCCCTGG + Intergenic
906208647 1:44000277-44000299 AGGCAGTGAGGTGGGTGGCTTGG - Intronic
906719845 1:47997017-47997039 GGCCAGCGAGGTTGAGCGCCCGG - Intergenic
907910455 1:58821359-58821381 ATGCAGTGAGGAGGGGAGCCAGG + Intergenic
908173252 1:61528759-61528781 AGGGAGTGAGGATGAGCCCCAGG - Intergenic
908472625 1:64459027-64459049 AGGCAGGGAAGTGTAGCACCAGG + Intergenic
910819455 1:91330013-91330035 AGGCAGAGAGCTGGAGCCCCTGG + Intronic
911732448 1:101305224-101305246 ATGCTGTGAGATGGAGCGCCTGG + Intergenic
914691330 1:150030916-150030938 AGCCAGTGTGGTGGCGGGCCTGG - Intergenic
915060408 1:153177480-153177502 TGGCAAGGAGGTGGAGCCCCTGG - Intergenic
915443570 1:155961889-155961911 AGGGATCGAGGAGGAGCGCCAGG - Exonic
918353078 1:183677829-183677851 AGGTAGTGAGGCGGAGAGCTGGG + Intronic
918428761 1:184436919-184436941 GGGCAGTGAGATTGAGCGGCGGG + Intronic
919693078 1:200544791-200544813 AGGAAGTGAGATGGAGCCACGGG + Intergenic
919724449 1:200872932-200872954 AGGAAGGGAGGTGCAGGGCCGGG + Intergenic
920049370 1:203154052-203154074 GAGCAGGGAGGTGGAGGGCCGGG - Intronic
920452043 1:206066641-206066663 AGGCAGGGAAGTGGAGCCTCTGG + Intronic
920743836 1:208606854-208606876 AGGGAGAGAGGTGGGGTGCCAGG - Intergenic
922490308 1:226011305-226011327 AGGCACTGAGGAGGAGCACGCGG + Intergenic
922855652 1:228773148-228773170 AGGCAGTGAGGTGCAGGGGAGGG - Intergenic
922880038 1:228974047-228974069 AGGCAGTGGGGTGGGGAGCTGGG - Intergenic
923044109 1:230342607-230342629 AGGCAGGGAGGGTGAGTGCCAGG + Intronic
924801335 1:247331419-247331441 AGGCTGTGAGGTGAGGAGCCCGG - Exonic
1063345730 10:5310911-5310933 ATGCAGTGACGTGGAGGGTCAGG - Intergenic
1066051745 10:31643015-31643037 AGTCAGTGAGGTGGAGATGCTGG - Intergenic
1066520782 10:36216538-36216560 AGGCACTGAGGAGAAGCACCAGG - Intergenic
1068111960 10:52690414-52690436 AGGGGGTGAGGGGGAGCTCCAGG + Intergenic
1068961462 10:62870751-62870773 AAGCAGTGACTTGGAGCGGCAGG - Intronic
1069709362 10:70478961-70478983 AGGCAGCGACGGGGCGCGCCCGG - Exonic
1069825419 10:71252396-71252418 AGGCAGTGAGGTGGAGGGCGTGG - Intronic
1070497541 10:77038190-77038212 AGGGAGGGAGGCGGAGCGCTTGG - Intronic
1073943914 10:108729772-108729794 AGGGAGTGAGGTGGAGGGGGAGG + Intergenic
1075240540 10:120774542-120774564 TGGCAGAGAGGTGGAGACCCAGG + Intergenic
1075739531 10:124685843-124685865 AGGCAGTGAGGAGGTAGGCCTGG - Intronic
1076529961 10:131137437-131137459 AGGCAGTCAGGCGGAGGGCCCGG - Intronic
1076757073 10:132578266-132578288 AGGGGCAGAGGTGGAGCGCCTGG - Intronic
1077376033 11:2205478-2205500 AGGCTGGGAGGTGGGGAGCCTGG - Intergenic
1080668944 11:34358485-34358507 TGGAGGAGAGGTGGAGCGCCTGG - Intergenic
1083308506 11:61772799-61772821 AGGCAGGTGGGTGGAGCTCCAGG + Intronic
1087157624 11:94920312-94920334 AGGCAGTGAGGTGGAATACAAGG + Intergenic
1087268048 11:96082567-96082589 ACGCTGTGAGGTCGAGCCCCAGG + Intronic
1089329635 11:117680509-117680531 AGGCATGGAGGTGCAGCTCCAGG + Intronic
1089672073 11:120063432-120063454 AGGCAGAGACGAGGAGGGCCAGG + Intergenic
1090156012 11:124439537-124439559 AGACAGTGGGGTGGAGCTTCAGG - Intergenic
1090482398 11:127080068-127080090 AGGAAGTGAGGTGGGGCACATGG - Intergenic
1093216516 12:16368183-16368205 AGGCAGTGAGGAGAAGGGCATGG + Intronic
1094571744 12:31647195-31647217 AGGCAGGCTGGTGGAGGGCCTGG - Intronic
1097733120 12:63151540-63151562 AGGAGGTGAGGTCGAGAGCCAGG - Intergenic
1101835478 12:108292098-108292120 TGGCAGTGTGGTGGAGCTCTAGG + Exonic
1103520195 12:121532975-121532997 AGGCAGTCAGCTGGAGACCCAGG + Intronic
1104706949 12:130954776-130954798 AGGCAGTGAGGTCGGGGACCAGG - Intronic
1105546004 13:21351688-21351710 AGGCACGAAGGAGGAGCGCCAGG - Intergenic
1105828677 13:24144828-24144850 AGGCAAGGAGGTGGATGGCCAGG - Intronic
1105968602 13:25406709-25406731 CGGAAGTGAGGTGGATCCCCAGG - Intronic
1107187878 13:37546070-37546092 CAGCAGTGGGGTGGAGCGCGGGG + Intergenic
1110339336 13:74370748-74370770 AGCCAGTGAGCTGGAGACCCAGG + Intergenic
1110478796 13:75949672-75949694 AGGCAGTGAGGTGAGGTGCAGGG + Intergenic
1112565747 13:100550221-100550243 AGGCATTGAGCTGGAGGGACTGG + Intronic
1113772156 13:112917198-112917220 AGGCAGGGCGGTGCAGTGCCCGG - Intronic
1113973836 13:114211541-114211563 AGGCAGGGAGGGCGAGCACCCGG - Intergenic
1118213747 14:63788701-63788723 AGGCAGTGGGGAGGTGCGGCTGG - Intergenic
1119931709 14:78553871-78553893 AGGCAATAAGGTGGAGGGGCAGG + Intronic
1121338596 14:93092025-93092047 GGGGAATGAGGTGGAGAGCCTGG - Intronic
1121429198 14:93874805-93874827 GGTCAGTGAGGTGCAGGGCCTGG + Intergenic
1121730848 14:96186088-96186110 AGCCAGGGAGGTGGACTGCCTGG - Intergenic
1122053713 14:99078083-99078105 AGGCAGAGAGGTGAAGGGCAAGG - Intergenic
1122275963 14:100590949-100590971 AGGCAGTGGGGTGGAGGCCAAGG - Intergenic
1122898111 14:104770444-104770466 TGGCAGGGAGGTGGGGCACCGGG - Intronic
1122974120 14:105164098-105164120 AGGCTGGGAGGTGGAGGGGCGGG - Intronic
1124625971 15:31307687-31307709 AGGCACTGAGGTGGAGCTTCTGG - Intergenic
1124827540 15:33113731-33113753 TGGCTCTGAGGTGGAGCACCAGG - Intronic
1126421349 15:48476495-48476517 AGTCAGTGAGGGGCAGAGCCAGG + Intronic
1126670352 15:51110426-51110448 AGTCAGAGAGGTGGAGTGACAGG + Intergenic
1127905639 15:63373954-63373976 TGGCAGTGAGGGGGAAGGCCAGG - Intronic
1128330339 15:66751469-66751491 AGGCTGTGAGGTGGCACGCTGGG + Intronic
1128882383 15:71255710-71255732 AGCCAGTGAGGTGTGGGGCCTGG - Intronic
1129858563 15:78842349-78842371 TGGCAGTGAGGTGGGCCGCCAGG + Intronic
1130899015 15:88193134-88193156 TGGCAGTGAGGTGGGGCAGCTGG - Intronic
1131293116 15:91124423-91124445 AGCCAGTGAGGAAGAGAGCCTGG + Intronic
1131413356 15:92229874-92229896 AGGCAGTGTGGTGGAGAGGGTGG - Intergenic
1131541497 15:93279003-93279025 AGGGAGTGAGCTGGAGAGGCAGG + Intergenic
1131676542 15:94675960-94675982 CAGCAGTGAGGTGGAGGGCAAGG - Intergenic
1132841874 16:1982028-1982050 AGCCAGAGAGGTGGGGCACCTGG - Exonic
1133206664 16:4238224-4238246 TGGCTGTGGGATGGAGCGCCTGG - Intronic
1133623813 16:7551366-7551388 AGGCAGTGAGCTGGGGCCCCTGG - Intronic
1134269946 16:12724370-12724392 CGGCAGTGAGCTGTAGCCCCGGG - Intronic
1134419429 16:14071727-14071749 GCACAGAGAGGTGGAGCGCCCGG + Intronic
1134441516 16:14302082-14302104 AGGCAGAGAGGGCGAGAGCCTGG - Intergenic
1134448769 16:14350467-14350489 AGGCAGTGAGTAGGAGCAGCAGG - Intergenic
1135912936 16:26577975-26577997 AGGCAGTGAGGAGGAGCACCTGG - Intergenic
1136021816 16:27445297-27445319 AGGCAGGGAGGTGGTCAGCCTGG + Intronic
1136230741 16:28883842-28883864 AGGCAGGGAGGCGGGGAGCCAGG - Intronic
1136511998 16:30743816-30743838 AGGCAGTGCGCTGGGGGGCCCGG + Intronic
1137061273 16:35793491-35793513 AGGCAGTGAGCTCAAGGGCCTGG - Intergenic
1137061666 16:35795988-35796010 AGGCAGTGAGATCAAGGGCCCGG - Intergenic
1137445613 16:48530103-48530125 AGGGAGTGAGGTGGGGAGCTAGG - Intergenic
1138356376 16:56384229-56384251 AGGCAGTGTGGTGGAGTGGGTGG - Intronic
1138678864 16:58671013-58671035 GGGCTGTGAGATGGGGCGCCAGG + Intronic
1139166299 16:64568479-64568501 AGTCAGTAAGCTGGAGGGCCAGG - Intergenic
1139513917 16:67442373-67442395 AGGCACTGAGCTATAGCGCCAGG - Intronic
1140195113 16:72848909-72848931 AGGCAGGCAGGCAGAGCGCCGGG + Intronic
1140271798 16:73472801-73472823 AGGGAGAGAGGTGGTGTGCCAGG - Intergenic
1140409925 16:74735276-74735298 GGGCAGTGAGGTGGGGCTCTTGG + Intronic
1140781200 16:78298408-78298430 AGGCATTGAGGGGCAGAGCCAGG - Intronic
1141248274 16:82331298-82331320 AAGCAGTGATTTGGAGCTCCAGG + Intergenic
1141990034 16:87604017-87604039 AGGGAGTGATGGGGAGCGCTAGG + Intronic
1142577922 17:921622-921644 GGGCAGTGAGGATGAGAGCCTGG - Intronic
1142577933 17:921665-921687 GGGCAGTGAGGATGAGAGCCTGG - Intronic
1142577945 17:921708-921730 GGGCAGTGAGGATGAGAGCCTGG - Intronic
1142577957 17:921751-921773 GGGCAGTGAGGATGAGAGCCTGG - Intronic
1142577969 17:921794-921816 GGGCAGTGAGGATGAGAGCCTGG - Intronic
1142731327 17:1860233-1860255 AGTCTGGGAGGTGGAGTGCCGGG + Intronic
1143693300 17:8589445-8589467 ATTTAGTGAGGTGGAGTGCCAGG - Intronic
1144578309 17:16443686-16443708 AGGCAGTGGGGAGGAGGTCCGGG - Exonic
1144625440 17:16842084-16842106 CGGCAGTGTGGAGGAGCGGCTGG - Intergenic
1144880989 17:18430637-18430659 CGGCAGTGTGGAGGAGCGGCTGG + Intergenic
1145151242 17:20513750-20513772 CGGCAGTGCGGAGGAGCGGCTGG - Intergenic
1145366146 17:22268430-22268452 AGGCAGTGAGGCCAAGGGCCCGG + Intergenic
1145411335 17:22668850-22668872 AGGCAGTGAGCTCAAGGGCCCGG + Intergenic
1145741538 17:27279051-27279073 AGGCAGAGAGGTGGAGAGGAGGG - Intergenic
1145897262 17:28466420-28466442 AGGCAGTGGGGAGCAGAGCCAGG + Intronic
1145906941 17:28521487-28521509 AGGCAGTGATGCGGAGCGGGAGG + Intronic
1147946374 17:44082560-44082582 AGGCAGTGAGCTGGTGGGGCTGG - Intronic
1148455317 17:47808191-47808213 GGGCAGTGAGGCGGGGAGCCCGG + Exonic
1148750311 17:49941718-49941740 AGGCAGAGAGGAGGATCCCCAGG - Intergenic
1148911628 17:50946086-50946108 AGGCAGGGAGTGGGAGGGCCAGG + Intergenic
1149464850 17:56869835-56869857 AGGCAGTGGGGAGGATGGCCTGG - Intergenic
1152109876 17:78352112-78352134 GGGCAGAGAGGTGGAGCTCCAGG + Intergenic
1152233373 17:79125850-79125872 AGGGAGGGAGGGGGAACGCCAGG + Intronic
1152925208 17:83084525-83084547 GGGCAGTGGGATGGAGCCCCAGG - Intronic
1153987748 18:10368429-10368451 AGGCAGTGAGAGTGAGGGCCAGG + Intergenic
1156304534 18:35864873-35864895 AGGCAGTCAGGAGCAGCACCTGG - Intergenic
1159384867 18:67710363-67710385 AGTTAGTGAGGTGGAGAGGCTGG - Intergenic
1160383495 18:78478769-78478791 AGGCAGTGAGGAGGAGTCCAGGG - Intergenic
1160907838 19:1460107-1460129 AGGGAGTGAGGTGGGGCGCTGGG + Intronic
1160951209 19:1668571-1668593 AGGGAGTGGGGTGGAGCGGGAGG - Intergenic
1162419779 19:10559540-10559562 AGGCAGAGAGGGGGAGGGCATGG + Intronic
1163158865 19:15453194-15453216 AGGCAGCGAGGCGGAGTCCCGGG + Exonic
1163819584 19:19488311-19488333 AGGCAGTGGGGAGGAACCCCTGG - Intronic
1164540692 19:29119649-29119671 TGGCCATGAGGTGGACCGCCAGG + Intergenic
1165222587 19:34329094-34329116 AGACAATGATGTGGAGCACCTGG - Intronic
1165495413 19:36149849-36149871 AGGCAGTGAGGGGGCGGGTCTGG - Exonic
1165948518 19:39459355-39459377 AGGCAGTGTGGTGGATGGCAGGG + Intronic
1166864265 19:45826556-45826578 AGGCAGTGAGGTGGTGCTGCGGG - Intronic
1167525726 19:49982860-49982882 AGGCAGAGAAGTGGAGGGGCTGG - Intronic
925056850 2:863027-863049 AGGGAGGGAGGTGGAGGGCTGGG - Intergenic
925323379 2:2995417-2995439 AGGCAGTCAGGCAGAGAGCCAGG + Intergenic
926216045 2:10905932-10905954 GGGCAGTGAGGAGTAGGGCCAGG - Intergenic
926737394 2:16083780-16083802 AGCCAGTGAGTTGGGGCTCCCGG - Intergenic
927865062 2:26582957-26582979 AGGCAGTGAGGTGGGGCACAGGG + Intronic
932701274 2:73993504-73993526 AGCCAGTGGGGTGGAGGGCGGGG + Intronic
933633504 2:84682304-84682326 AGGCAGTGAGGGGGGACCCCAGG - Intronic
935163201 2:100547128-100547150 AGGCAATGATGCTGAGCGCCTGG - Intergenic
937044274 2:118842994-118843016 GGGCCATGAGGTGCAGCGCCAGG + Exonic
937157185 2:119729457-119729479 AGGCATTGAGGTGGGGGACCAGG + Intergenic
939288053 2:140157758-140157780 AGGCAGTAAGGTGGAGAGACAGG + Intergenic
940213064 2:151275535-151275557 AGGCGGAGAGGTGGACCGCGTGG - Exonic
941725665 2:168857477-168857499 AGGCAGGGAGGTGGGCCTCCTGG + Intronic
942173058 2:173306081-173306103 AGGAAGTGAGGCAGAGGGCCAGG + Intergenic
942886536 2:180931588-180931610 GGGCAGTGTTGTGGAGCTCCTGG - Intergenic
944122828 2:196259338-196259360 AGGCACTGAGGTGGAAGGCAAGG + Intronic
945118239 2:206430611-206430633 AGGCAGTGAAGTGCAGTGGCAGG - Intergenic
946001060 2:216482791-216482813 AGGAAGTGATATGGAGCTCCTGG + Exonic
946398187 2:219453923-219453945 AGGCAGTGAGGGGTGGGGCCAGG + Intronic
946558773 2:220889531-220889553 AGACAGTGAGGAGGAGGGGCTGG - Intergenic
947100840 2:226619812-226619834 AGGAAGTGAGTGGGAGGGCCAGG - Intergenic
947152047 2:227125695-227125717 AGGCAGAGAGGGGGCGCTCCCGG - Intronic
948046531 2:234950524-234950546 AGGCAGTGAGGCGAAGGGGCAGG - Intergenic
948735576 2:240002548-240002570 TGGCAGTGAGGTAGAGTGCTAGG - Intronic
1169551195 20:6703197-6703219 ACGGAGTGGGGTGGAGGGCCAGG - Intergenic
1170414725 20:16127527-16127549 AGGCAGTGAGGTGTAGCGGAAGG + Intergenic
1171412370 20:24956126-24956148 AGGCTGGGTGGTGCAGCGCCGGG - Intronic
1171430143 20:25077903-25077925 AGACAGTGAAGAGGGGCGCCTGG + Intronic
1171994661 20:31722639-31722661 AGGCAGGCAGGTGCAGCCCCCGG + Exonic
1172523180 20:35582381-35582403 GCCCAGTGAGGTGGAGCCCCAGG - Intergenic
1173395420 20:42675069-42675091 AGGCAGTGAGCTGACGGGCCAGG - Intronic
1173559423 20:43992215-43992237 AGGCAGTGAGGTGGAAGAACTGG + Intronic
1173581448 20:44149561-44149583 AGGCAGTGGGATGGAGCAGCAGG - Intronic
1174578304 20:51553236-51553258 AGCCTGTGAGCTTGAGCGCCTGG + Intronic
1175134021 20:56809569-56809591 AGCCAGTGAGGAGCAGGGCCTGG + Intergenic
1175254527 20:57631931-57631953 AGGCAGTGAGCTGGAGGCCAGGG + Intergenic
1175460536 20:59148995-59149017 AGGCTGTGAGGGGCAGAGCCAGG + Intergenic
1177302417 21:19265408-19265430 AAGAAGTGAGGTGGAGACCCAGG - Intergenic
1177736107 21:25092500-25092522 AGGCCGTGAGGAGGTGCACCTGG - Intergenic
1178517898 21:33264247-33264269 AGGAAGGGAGGAGGAGAGCCAGG + Exonic
1178945017 21:36939750-36939772 AGCCTGTGAGGTGAAGAGCCCGG + Intronic
1180006958 21:45027285-45027307 AGGCAGTGAGGAGGTGCTCCGGG + Intergenic
1180162897 21:46006123-46006145 ACGCAGTGAGGTGGTGGGCGGGG + Intergenic
1180786646 22:18551346-18551368 AGGCAGGGAGGAGGAGCCCTGGG + Intergenic
1180796640 22:18608998-18609020 AGCCAGTGAGGTGGATGACCTGG - Exonic
1180869954 22:19140407-19140429 AGGGAGTGAGGGAGAGCCCCAGG - Intronic
1180937905 22:19638074-19638096 GGGCAGTGAGGAGGAGCCCCAGG + Intergenic
1180937917 22:19638114-19638136 GGGCAGTGAGGAGGAGCCCCAGG + Intergenic
1181131937 22:20737159-20737181 AGGCAGGGAGGAGGAGCCCTGGG + Intronic
1181225084 22:21386273-21386295 AGCCAGTGAGGTGGATGACCTGG + Exonic
1181243561 22:21490867-21490889 AGGCAGGGAGGAGGAGCCCTGGG + Intergenic
1181253548 22:21548540-21548562 AGCCAGTGAGGTGGATGACCTGG - Exonic
1183347389 22:37315394-37315416 AGGGACGGAGGTGGAGGGCCCGG - Intergenic
1183623758 22:38989535-38989557 GTGCTATGAGGTGGAGCGCCTGG + Exonic
1183935467 22:41259386-41259408 AGGCAGTCTGGTGAAGCCCCTGG + Intronic
1184321382 22:43744594-43744616 AGGAAGTGAGCTGGACCACCAGG + Intronic
1184390141 22:44199108-44199130 AGGCAGTTAGGTGGATGGACAGG - Intronic
1184451384 22:44584726-44584748 GGTCAGTGAGGAGGAGGGCCTGG + Intergenic
1184529769 22:45047586-45047608 GGTCACTGAGGTGGAGCCCCTGG - Intergenic
1184740935 22:46428764-46428786 AGGCAGTGAGGTGGAGCGCCAGG - Intronic
1185029519 22:48434341-48434363 GGGCAGGGAGGCGGAGCCCCGGG + Intergenic
950887656 3:16375184-16375206 AGGCAGTGGGGAGGGGTGCCTGG + Intronic
953724762 3:45388429-45388451 AGGCCGAGAGGCGGAGCCCCGGG + Intergenic
954973814 3:54674473-54674495 CGGCAGTGGGGAGGAGCCCCTGG + Intronic
960638911 3:119809390-119809412 GGGCAAAGAGGTCGAGCGCCTGG - Intronic
960686319 3:120297590-120297612 AAGCAGTGAGGGGGAGAGTCAGG - Intergenic
961569030 3:127785136-127785158 AGGGGGTGAGGTGAAGCACCTGG - Intronic
967269891 3:187724868-187724890 AGGGAAGGAGGTGGAGCGCAGGG - Intronic
967409925 3:189157025-189157047 TGCCAGGGAGTTGGAGCGCCTGG + Intronic
967459855 3:189733001-189733023 AGGCAGTGGGGTGGAGATCCTGG + Intronic
968547524 4:1206471-1206493 AGGGAGTGACCTGGAGGGCCCGG + Intronic
969312503 4:6362116-6362138 AGGCAGAGAGGGTGAGAGCCAGG + Intronic
969927189 4:10595664-10595686 GGGCAGTGATGGGGAGCACCAGG + Intronic
973631627 4:52825558-52825580 AGGCAGTGAGGTGGGGGGAGCGG + Intergenic
973691817 4:53442667-53442689 AGAGATGGAGGTGGAGCGCCTGG - Exonic
974723724 4:65773534-65773556 AGGCAGTGTGGTGGAGAGTGGGG + Intergenic
978285813 4:107075013-107075035 AGGCAGTGAAGTACAGGGCCAGG - Intronic
980969185 4:139553550-139553572 ACTCAGTGAGGTGGAGAGACTGG - Intronic
982736323 4:159010569-159010591 AGGCAGAGTGGTGCAGAGCCTGG - Intronic
985590785 5:764100-764122 AGGCAGGGAGGTGTAGGGGCTGG - Intronic
985828068 5:2207380-2207402 AGGCGGTGAGGTGCAGACCCAGG - Intergenic
991038420 5:62151547-62151569 AGGGAGTGGGGTGGAGAGTCAGG - Intergenic
998376820 5:141696496-141696518 ACACAGTGAGGTGCAGAGCCTGG - Intergenic
1000628284 5:163564077-163564099 AGGCAGTGAGATGAAAAGCCAGG + Intergenic
1003355787 6:5368711-5368733 AGGCAGTGTGGTGGAGCTGCTGG + Exonic
1003405607 6:5824748-5824770 AGGCAAGAAGGAGGAGCGCCAGG + Intergenic
1003962083 6:11218299-11218321 TGGCAGTGAGGTGGAAAGCAGGG - Intronic
1004025199 6:11811440-11811462 AGGAAATGAGGTGGAGCTGCTGG - Intergenic
1004194243 6:13488998-13489020 TGGCAGTGAGGCGGGGCGCGTGG + Intergenic
1004963542 6:20821004-20821026 AGGAAGTGAGGGAGAGAGCCAGG + Intronic
1006180965 6:32153350-32153372 AGGCGGAGAGGTGGGGCGCCTGG + Intronic
1006925291 6:37650587-37650609 AGACACTGAGGTGGAGACCCAGG - Intronic
1007126710 6:39431845-39431867 AGGTGGTGAGGAGGAGAGCCTGG - Intronic
1007698580 6:43749871-43749893 AGGAAATGAGGGGGAACGCCTGG - Intergenic
1010253385 6:73731479-73731501 TGGCAGTGTGCTGGAGCCCCGGG + Intronic
1012610825 6:101217159-101217181 AGGCAGTGAGGTAGAGGGTTAGG + Intergenic
1012862342 6:104574623-104574645 GGGCAGTGAGGTGAAGGGGCTGG + Intergenic
1014227216 6:118862036-118862058 AGGCAGTGGGGTGGCACCCCTGG + Intronic
1016013200 6:139159520-139159542 AGGAAGTGAGGGTGAGGGCCAGG + Intronic
1018616422 6:165690982-165691004 AGTCAGTGAGCTGGAAAGCCAGG - Intronic
1018852992 6:167654605-167654627 AAGCAGTGAGGAGGAGCATCCGG - Intergenic
1019351431 7:555916-555938 ATGCATTGAGGTGGGGGGCCTGG - Intronic
1019597031 7:1862997-1863019 AGGCAGTGAGGAGGAGGCTCTGG - Intronic
1020257122 7:6508578-6508600 AGGCTGTGAGGGGGATAGCCTGG + Intronic
1020257137 7:6508634-6508656 AGGCTGTGAGGGGGATAGCCTGG + Intronic
1022812557 7:33884346-33884368 AGGAACTGAGGTGGAGTCCCAGG + Intergenic
1023380770 7:39605654-39605676 AGGCAATGAGCTGGAGACCCAGG - Intronic
1025810450 7:64872166-64872188 AGGCAGTGAGCTTAAGGGCCTGG + Intronic
1027862034 7:83596600-83596622 AGGAAGTAGGGTGGAGAGCCAGG - Intronic
1028999567 7:97139066-97139088 ATGCAGTGAGATGCAGCGGCAGG - Intronic
1029443878 7:100602483-100602505 AGGCAGTGAGGAGGGGCCCCAGG - Exonic
1035006429 7:155665263-155665285 AGGCAGTTAGGTGAAGCACAGGG - Intronic
1035075818 7:156176658-156176680 AGCCAGTGAGGTGGAGACCTGGG - Intergenic
1035682159 8:1495989-1496011 AGGCAGTGACGTGGGGCCCCCGG + Intergenic
1038286896 8:26213273-26213295 AAGCAGTGAGCTGGAGGACCCGG - Intergenic
1039527701 8:38231525-38231547 GGGCAGGGAGCTGCAGCGCCGGG - Exonic
1041903671 8:63008826-63008848 AGGCAGTGAGGTCCAGCTCCAGG + Intergenic
1044419081 8:91970819-91970841 CGTCAATGAGGTGAAGCGCCAGG - Exonic
1045695813 8:104807583-104807605 AGGCAGGGAGGTGGAGCAAAAGG - Intronic
1046031025 8:108784447-108784469 AGCCCGGGAGATGGAGCGCCTGG - Exonic
1048389856 8:133952346-133952368 TGGCAGAGTGGTGGAGGGCCAGG + Intergenic
1049383062 8:142326974-142326996 TGGCAGTGAGGTGGGGAGACAGG + Intronic
1049444002 8:142621795-142621817 ACCCAGTGTGGGGGAGCGCCAGG - Intergenic
1049493418 8:142916925-142916947 GGGCAGTGAGGGTGAGCACCCGG - Intronic
1049647040 8:143740175-143740197 CGGCGGGGAGGTGGAGCACCAGG - Intergenic
1049759968 8:144327519-144327541 AGGCGGGGAGGTGGAGAGCCTGG - Intergenic
1053120829 9:35546600-35546622 AGGCAGTGCTGTGGAGGGGCAGG + Exonic
1053409518 9:37906519-37906541 AAGCACTGAGTTGGAGAGCCAGG - Intronic
1053519676 9:38764890-38764912 GGGCAGTGAGGTGGAAAGACGGG - Intergenic
1055387276 9:75775971-75775993 CTGCAGTGAGGTAGAGCACCAGG + Intergenic
1058826267 9:108778391-108778413 AGGCAGTGGGGAGGAGGGCAGGG + Intergenic
1060477854 9:123999410-123999432 AGGCAGTGAGGAAGAGAGCCGGG + Intergenic
1060590504 9:124813310-124813332 AGGCAGTTAAGTGGAGAACCAGG + Exonic
1060996511 9:127877313-127877335 GGGCAGTGACCTGGAGCCCCGGG + Intronic
1061120082 9:128636730-128636752 AGGCAGTGGGGCTGAGTGCCAGG - Intronic
1061150903 9:128827440-128827462 AGGCAGTAAGTGGGAGAGCCAGG - Intronic
1061445011 9:130632647-130632669 GGGCAGGGAGTTGGAGGGCCAGG - Intronic
1061722065 9:132557963-132557985 CGGGAGGGAGGTGGAGTGCCAGG - Intronic
1061888547 9:133605693-133605715 AGGCAGTGAGGTTGCGGCCCCGG - Intergenic
1062060493 9:134492912-134492934 AGTTAGTGAGGTGGAGAGCTGGG + Intergenic
1062091429 9:134680603-134680625 AGGCCTTGAGGTGGGGCCCCAGG + Intronic
1188636276 X:32435887-32435909 AGGAAATGAGGTGGGGCTCCAGG - Intronic
1190322552 X:49187334-49187356 AGGAGGGGAGGTGGGGCGCCGGG - Intergenic
1192904703 X:75538642-75538664 ATGCAGTGAGCTGGAGCCACTGG - Intergenic
1198017952 X:132630937-132630959 AGGCAGTGGGGTGGAGGGGTAGG - Intronic
1198312190 X:135434369-135434391 CGACAGTGAGGTTGAGCGGCGGG + Intergenic
1198312814 X:135437419-135437441 GCGCAGTGAGCGGGAGCGCCAGG + Intergenic
1199672217 X:150156770-150156792 GGGCAGTTAGGTGGTGTGCCAGG - Intergenic
1200704061 Y:6426472-6426494 AGGCAATGAGGTCAAGAGCCAGG - Intergenic
1200708788 Y:6465510-6465532 AGGCAGTGAGGTCAAGGTCCTGG - Intergenic
1200913441 Y:8550933-8550955 AGTCAGTGAGGTCAAGAGCCTGG + Intergenic
1200913998 Y:8555461-8555483 AGGCAGTGAGGTCAAGAGCCTGG + Intergenic
1200917659 Y:8585492-8585514 AGGCAGTGAGGTCAAGAGCCTGG + Intergenic
1200918570 Y:8592906-8592928 AGGCAGTGAGGCTAAGGGCCAGG + Intergenic
1200919298 Y:8598922-8598944 AGGCAGTGAGGTGAATATCCTGG + Intergenic
1200920310 Y:8607268-8607290 AGGCAGTGAAGTCAAGGGCCTGG + Intergenic
1200923355 Y:8632487-8632509 AGGCAGTGAGGTCAAGAGCCTGG + Intergenic
1200923944 Y:8637774-8637796 AGGCAGTGAGGTTAAGGGCCTGG + Intergenic
1200928224 Y:8673668-8673690 AGGCAGTGAGGTCAAGTGCCCGG + Intergenic
1200931555 Y:8701533-8701555 AGGCATTGAGGTCAAGAGCCTGG - Intergenic
1200933688 Y:8719998-8720020 AGGCAGTGAGGTCAAGAGTCTGG - Intergenic
1200935297 Y:8733103-8733125 AGGCAGTGAGGTCAAGAGCCTGG - Intergenic
1200937588 Y:8751847-8751869 AGGCAGTGAGTTCAAGGGCCTGG - Intergenic
1200960404 Y:8991221-8991243 AGGCAGTGAGGTCAAGAGTCTGG + Intergenic
1200964499 Y:9023936-9023958 AGGCAGTGAGGTCAAGAGCCTGG - Intergenic
1200981997 Y:9270995-9271017 AGGCAGAGAGGTCAAGAGCCTGG - Intergenic
1200982310 Y:9273443-9273465 AGGCAGTGAGATTAAGGGCCTGG - Intergenic
1201025324 Y:9699199-9699221 AGGCAGTGAGGTCAAGGTCCTGG + Intergenic
1201030050 Y:9738236-9738258 AGGCAATGAGGTCAAGAGCCAGG + Intergenic
1201038080 Y:9803052-9803074 AGGCATTGAGGTTAAGAGCCCGG + Intergenic
1202128408 Y:21588736-21588758 AGGCAGAGAGGTCAAGAGCCTGG + Intergenic
1202129360 Y:21596068-21596090 AGGCAGTGAGATCAAGGGCCCGG + Intergenic
1202130627 Y:21605547-21605569 AGGCAGTGAGGTCAAGAGCCTGG - Intergenic
1202150883 Y:21842721-21842743 AGGCAGAGAGGTCAAGAGCCTGG - Intergenic
1202152960 Y:21859655-21859677 AGGCAGTGAAGTCAAGAGCCTGG - Intergenic
1202178505 Y:22119468-22119490 AGGCAATGAGGTCAAGTGCCAGG - Intergenic
1202180193 Y:22133216-22133238 AGGCAGTGAGGTCAAGAGTCTGG - Intergenic
1202181724 Y:22145509-22145531 AGGCAGTGAGGTTAAGAACCTGG - Intergenic
1202182764 Y:22153631-22153653 AGGCAGTGACGTCAAGGGCCCGG - Intergenic
1202208595 Y:22432770-22432792 AGGCAGTGACGTCAAGGGCCCGG + Intergenic
1202209636 Y:22440893-22440915 AGGCAGTGAGGTTAAGAACCTGG + Intergenic
1202211167 Y:22453183-22453205 AGGCAGTGAGGTCAAGAGTCTGG + Intergenic
1202212856 Y:22466926-22466948 AGGCAATGAGGTCAAGTGCCAGG + Intergenic