ID: 1184740936

View in Genome Browser
Species Human (GRCh38)
Location 22:46428773-46428795
Sequence TGTGCAGTGAGGCAGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 465}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184740936_1184740941 0 Left 1184740936 22:46428773-46428795 CCACCTCACTGCCTCACTGCACA 0: 1
1: 0
2: 5
3: 36
4: 465
Right 1184740941 22:46428796-46428818 GCTCACTCACGGGTCCCCAGCGG 0: 1
1: 0
2: 0
3: 6
4: 126
1184740936_1184740944 14 Left 1184740936 22:46428773-46428795 CCACCTCACTGCCTCACTGCACA 0: 1
1: 0
2: 5
3: 36
4: 465
Right 1184740944 22:46428810-46428832 CCCCAGCGGGCCACACTGCCTGG 0: 1
1: 1
2: 1
3: 17
4: 224
1184740936_1184740940 -10 Left 1184740936 22:46428773-46428795 CCACCTCACTGCCTCACTGCACA 0: 1
1: 0
2: 5
3: 36
4: 465
Right 1184740940 22:46428786-46428808 TCACTGCACAGCTCACTCACGGG 0: 1
1: 0
2: 3
3: 20
4: 186
1184740936_1184740948 27 Left 1184740936 22:46428773-46428795 CCACCTCACTGCCTCACTGCACA 0: 1
1: 0
2: 5
3: 36
4: 465
Right 1184740948 22:46428823-46428845 CACTGCCTGGTGTCCATGTCAGG 0: 1
1: 0
2: 3
3: 11
4: 185
1184740936_1184740942 1 Left 1184740936 22:46428773-46428795 CCACCTCACTGCCTCACTGCACA 0: 1
1: 0
2: 5
3: 36
4: 465
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184740936 Original CRISPR TGTGCAGTGAGGCAGTGAGG TGG (reversed) Intronic
900004357 1:34962-34984 TGTTCAGTCAGGCAGGGAGTGGG + Intergenic
900099811 1:957010-957032 TGTGCAGGAAGCCAGTGAGGAGG - Exonic
900115471 1:1026128-1026150 TGGGGAGTGAGGGAGTGGGGTGG - Intronic
901027302 1:6285406-6285428 TTTGCAGGGAGGAAGGGAGGTGG - Intronic
901789032 1:11644028-11644050 GGAGCAGTGAGCAAGTGAGGAGG - Intergenic
902205815 1:14867302-14867324 TTTGCACTGAGGCTGTGAGTGGG + Intronic
902372928 1:16016881-16016903 TGCAAAGAGAGGCAGTGAGGGGG + Intronic
902517554 1:16997455-16997477 TGTGCAGTGGGGCAGGGTGGGGG + Intronic
902962967 1:19977734-19977756 TGTGCAGAGAGTCAGGGAAGAGG - Intronic
903606068 1:24576107-24576129 TGTGCAGGGTGGCAGTGGTGAGG - Intronic
903683536 1:25113820-25113842 TCAGCAGTGAGACATTGAGGGGG - Intergenic
904424343 1:30413954-30413976 TGTGGTTGGAGGCAGTGAGGGGG - Intergenic
905203263 1:36328018-36328040 TGGGCAGATAGGCAGCGAGGAGG - Exonic
905865788 1:41375903-41375925 TGTGCTGTCAGGGAATGAGGTGG + Intronic
906047416 1:42842730-42842752 TATGTAGTGAGTCAGTGAGCAGG + Exonic
906280110 1:44547262-44547284 TGAGCAGTGAGGCAGTGAAGGGG - Intronic
906720264 1:47998890-47998912 TGGGCAGATAGTCAGTGAGGAGG + Intergenic
907483847 1:54763201-54763223 TGTGCAGTGGAGCACAGAGGAGG - Intronic
907857560 1:58318691-58318713 GATGATGTGAGGCAGTGAGGAGG - Intronic
908764967 1:67546410-67546432 TATCCAGTGAGGCAGTGGGAGGG - Intergenic
910330527 1:86068237-86068259 TGTGGAAAGAGGCACTGAGGAGG + Intronic
910428641 1:87139705-87139727 TGTCCTGGGAGGCAGGGAGGTGG + Intronic
910862384 1:91754627-91754649 TGTGCTGTGAGGGGGTGAGAAGG + Intronic
911047213 1:93638479-93638501 AGTGCAATGGGGCAGTGAGTAGG + Intronic
911566845 1:99472315-99472337 AGGGCAGGGAGGCAGGGAGGTGG + Intergenic
911581288 1:99636310-99636332 TATGCAGTGAAGCAGTGGTGTGG - Intergenic
912345153 1:108956869-108956891 TGAGCTGGGAGGCAGGGAGGCGG + Intronic
912606517 1:110995535-110995557 AGTGGAGTGTGGCAGGGAGGTGG - Intergenic
913024262 1:114820246-114820268 TGTGAAGAGAGGCAGAGAAGTGG + Intergenic
915368072 1:155326452-155326474 TGGGCACTGGGGCAGAGAGGAGG - Intronic
915454416 1:156029993-156030015 TGTGTGGTGAGGGAGGGAGGGGG + Intergenic
917246379 1:173005262-173005284 TGTGGAAAGAGGCATTGAGGAGG - Intergenic
917641270 1:176985320-176985342 TGGGCAGTGGGGCAGTGCTGGGG - Intronic
919148931 1:193670257-193670279 TTTGCAGTGAAGAACTGAGGTGG + Intergenic
919753778 1:201054048-201054070 TGTGCAGGGTGGGAGTGATGGGG - Intronic
919785592 1:201255997-201256019 TGTGGAGTGATGGAGTGAGATGG + Intergenic
919785754 1:201257491-201257513 GGTGGAGTGATGGAGTGAGGTGG + Intergenic
919979830 1:202635972-202635994 AGTGCAGGGAGGCAGGCAGGGGG - Intronic
920344247 1:205295676-205295698 TGGGCAGTGCTGCAATGAGGAGG - Intergenic
920657294 1:207886441-207886463 TGTGCAGTGATGTGGTGGGGAGG - Intronic
920711275 1:208297249-208297271 GGGTCAGTGAGTCAGTGAGGCGG + Intergenic
920921300 1:210299529-210299551 TGGGCAGTATGGCAGTGATGTGG - Intergenic
921056748 1:211548374-211548396 TGTGAGGTGAGGCTGAGAGGCGG + Intergenic
923608197 1:235464490-235464512 TGGGAAGTGAGGGAGGGAGGAGG - Intronic
924635804 1:245786521-245786543 GGTTCAGTGAGGCAATGAGATGG - Intronic
1062978567 10:1703090-1703112 TGTGCAGTGAATCAGTGAACGGG - Intronic
1063121822 10:3109898-3109920 GGGGCAGGGAGGCAGGGAGGCGG + Intronic
1063698779 10:8364425-8364447 TATGAAGTTAAGCAGTGAGGGGG + Intergenic
1064348400 10:14554187-14554209 TGTGGAGTAAGGCAGTGGGAGGG - Intronic
1064558810 10:16575152-16575174 AGTGCAGTGTGAAAGTGAGGTGG + Intergenic
1064958188 10:20934561-20934583 TGTGCAGTCAGGCAAAGAGCGGG - Intronic
1065370464 10:24979886-24979908 TGAGCAGCCAGGCAGTGGGGAGG - Intergenic
1067280578 10:44869137-44869159 TGTGCAGAGACGCAATGGGGAGG + Intergenic
1067827720 10:49591493-49591515 GCTGCTGCGAGGCAGTGAGGAGG + Intergenic
1068839231 10:61591513-61591535 TGTACAATGAGGCTGTGTGGTGG + Intergenic
1069480627 10:68778487-68778509 TGTGCAGTAAGGGAGGGCGGGGG - Intronic
1069908313 10:71745214-71745236 TGTGCAATGGGGCACTGAGAAGG + Intronic
1070758575 10:79008981-79009003 CGTGCAGAGAGGGAGAGAGGTGG + Intergenic
1071466184 10:85941972-85941994 TGTGCAGTGGGGCACTGGAGGGG + Intronic
1073185112 10:101611187-101611209 AGCACAGTGGGGCAGTGAGGAGG + Exonic
1073585873 10:104709290-104709312 TATGCAGGGACACAGTGAGGTGG - Intronic
1073768126 10:106705978-106706000 TGAGCAGTGATGCCGTGACGTGG - Intronic
1074275018 10:111992839-111992861 TGTGCAGCCAGGCAGTGGTGAGG + Intergenic
1074438412 10:113454229-113454251 TGTGCGGGGTGGCAGTGGGGTGG + Intergenic
1075723418 10:124599997-124600019 TGCGGAGTGAGGGAGTGAGAGGG + Intronic
1076529964 10:131137446-131137468 GGTGCAGAAAGGCAGTCAGGCGG - Intronic
1076732064 10:132444095-132444117 TGAGCAGGGAGGGAGTGAGGCGG - Intergenic
1076732114 10:132444228-132444250 TGAGCGGGGAGGGAGTGAGGAGG - Intergenic
1077326275 11:1965410-1965432 TGGGCATCGAGGCATTGAGGAGG + Intronic
1077631838 11:3816419-3816441 TGGGCAGTGGGGTTGTGAGGGGG + Intronic
1077978531 11:7275250-7275272 TGAGCAGTGTGGCTGTGAAGAGG - Intronic
1079132416 11:17755081-17755103 GGTGCCATGAGGCAGTGAAGGGG + Intronic
1080924737 11:36744527-36744549 TGTGCAGTGATACATTGAGATGG + Intergenic
1081596846 11:44465392-44465414 TGTCCAGAGAGGCAGACAGGAGG - Intergenic
1082987070 11:59178232-59178254 TGGGCAGTTAGGCTATGAGGGGG + Intronic
1083054213 11:59804139-59804161 TGTGCAGTATGGCTGTGAAGGGG + Intergenic
1083753603 11:64777746-64777768 TGTGCGCAGACGCAGTGAGGTGG - Intronic
1083790536 11:64982477-64982499 TGTGAATGGAAGCAGTGAGGTGG - Intergenic
1083804682 11:65066753-65066775 TGGGCTGGGAGGCAGGGAGGAGG + Intronic
1084038280 11:66526692-66526714 TGTAGAGGGAGGAAGTGAGGTGG + Exonic
1084327779 11:68411676-68411698 TGTGCGGCGAGGCTGGGAGGTGG - Intronic
1084615265 11:70231611-70231633 TGTGCTGTGAGGGGGTAAGGAGG + Intergenic
1085383328 11:76140224-76140246 TGCTCAGTGAGGCAGTGAGAAGG - Intronic
1085739516 11:79067003-79067025 TGTGGAAGGAGGCACTGAGGTGG - Intronic
1086414601 11:86576337-86576359 AGTGCACTGAGGCAGAGGGGAGG - Intronic
1086491020 11:87357948-87357970 TTTGGAGGGAGGCAGTGAGTGGG - Intergenic
1086925127 11:92631828-92631850 TGTCCAGTGAGCCAGTGACTTGG + Intronic
1087344563 11:96954987-96955009 TGTGCACTCAGGCAGTGACACGG - Intergenic
1087816527 11:102664558-102664580 TGAGCAGTGAGGCACTGAAGAGG + Intergenic
1089004984 11:115083833-115083855 GGGACAGTGAGGCAGTGTGGAGG - Intergenic
1089167656 11:116489466-116489488 TGTGCACAGTGGCAGTGTGGTGG + Intergenic
1089404239 11:118184261-118184283 TCTGGAGGGAGGCTGTGAGGAGG + Intergenic
1089502176 11:118939179-118939201 TCTGCAGTGATGCAGTGGGTGGG - Intronic
1089616962 11:119700168-119700190 TGGTCACTGAGGCAGGGAGGGGG + Intronic
1090458048 11:126866639-126866661 TGTGTGGGGGGGCAGTGAGGAGG - Intronic
1090479918 11:127059111-127059133 TGTGGAGCCAGGCAGTGAGTGGG + Intergenic
1090905740 11:131073187-131073209 TGAGGACTGAGGCAGGGAGGTGG - Intergenic
1091037185 11:132244808-132244830 TGTGCAGTGAGCCGGTGGGCTGG - Intronic
1202809256 11_KI270721v1_random:20589-20611 TGGGCATCGAGGCATTGAGGAGG + Intergenic
1091395059 12:149339-149361 CAGGCAGTGAGGCAGTGTGGAGG - Intronic
1091569311 12:1670532-1670554 TGAGCTGTGAGTGAGTGAGGGGG - Intergenic
1091855493 12:3736056-3736078 TATGGGGTGAGGCAGGGAGGTGG + Intronic
1092008643 12:5090113-5090135 TCTGCTGTGGTGCAGTGAGGGGG - Intergenic
1092303874 12:7279772-7279794 GAGGCAGTGAGGCAGTGAGGGGG - Intergenic
1094741300 12:33292178-33292200 TGGGCAGTAAGGCCCTGAGGTGG + Intergenic
1095368472 12:41437666-41437688 TGTGCACTGATGCAGAGACGGGG + Intronic
1095821819 12:46486729-46486751 TGTGGGGTGAGGCAGGGAGGTGG + Intergenic
1096183064 12:49561304-49561326 TGTCAACTGAGGAAGTGAGGGGG + Intronic
1096275033 12:50199546-50199568 GGTGCTGTGAGGCTGTGAGAGGG - Intronic
1096459816 12:51815807-51815829 TGTGCTGTGGGGCAGATAGGAGG - Intergenic
1096513814 12:52145695-52145717 TGTGCAGTGGGGCCCTGAGCTGG + Intergenic
1096620499 12:52861728-52861750 TGTGCAGTGAGACAGCGTGTTGG - Intergenic
1096743875 12:53713149-53713171 TGTGCAGAGTGGGGGTGAGGAGG - Exonic
1097136182 12:56857924-56857946 TGTACAATGAGGCATTTAGGAGG - Intergenic
1097247778 12:57616065-57616087 TGGGCAGTGAGGGATTCAGGAGG - Intronic
1098387232 12:69932351-69932373 TTTTCAGAGAGGCAGGGAGGAGG + Intronic
1098449431 12:70602654-70602676 TGTGCAGTGGGGGAGTGGGTGGG + Intronic
1098469124 12:70823915-70823937 TGGGTAGTGAGGCTCTGAGGAGG + Intronic
1099767621 12:87008583-87008605 TGTGTTGTGGGGCAGTGGGGGGG + Intergenic
1100218090 12:92474353-92474375 TTTAAAGTGAGGCAGTGAGATGG - Intergenic
1101015858 12:100499596-100499618 TGTGCAATGAGTCAGAGAGTTGG + Intronic
1101877591 12:108606029-108606051 TGGGCAGTTAGGTAGTTAGGTGG + Intergenic
1101923473 12:108952109-108952131 TCTGCAGTGAGGCAGTTTGGTGG - Intronic
1102215421 12:111158182-111158204 TGTGAGGTGAGGAAGAGAGGGGG - Intronic
1102646841 12:114409174-114409196 TGTGCAGGGAGGCAGTCGGCCGG + Intergenic
1103378407 12:120474758-120474780 TGGGCAGAGAGGAAGTGATGGGG + Intronic
1104099186 12:125590067-125590089 TGGTCAGAGAGGGAGTGAGGAGG - Intronic
1104697770 12:130876997-130877019 TGCACAGTGGGGCAGTGTGGGGG + Exonic
1104732209 12:131113716-131113738 TGAGCAGTGAGGCAGGACGGAGG - Intronic
1104828958 12:131734906-131734928 GGTGGGGTGGGGCAGTGAGGGGG + Intronic
1105883689 13:24624774-24624796 GGGGCAGTGGGGCAGTGGGGAGG + Intergenic
1106123687 13:26882759-26882781 TGGGCAGTAAGACAGTGAAGAGG - Intergenic
1106762462 13:32880626-32880648 CCTGCAGTGAGGGAGGGAGGTGG + Intergenic
1106907685 13:34425729-34425751 TGTGCAGCAGGGCAGTGGGGTGG - Intergenic
1107401809 13:40076807-40076829 GGTACAGTGAGACAGAGAGGGGG - Intergenic
1108238867 13:48440336-48440358 TGTTCTGTGAGGCAAAGAGGAGG + Intronic
1108966761 13:56316723-56316745 TGGGCAGTTAGGATGTGAGGAGG + Intergenic
1109163925 13:59010155-59010177 AGTGAAGTGGGGCAGTGAAGAGG - Intergenic
1109188894 13:59302276-59302298 AGTACAGTGGGACAGTGAGGTGG - Intergenic
1110636184 13:77769098-77769120 TGTGGAGGAAGGCTGTGAGGTGG + Intergenic
1113283047 13:108811751-108811773 TGAGGGGAGAGGCAGTGAGGAGG - Intronic
1113399248 13:109976129-109976151 TGTGCAGTGTAGATGTGAGGAGG + Intergenic
1114261398 14:21039168-21039190 TGTGCTGGGAGGGAGTGAAGGGG - Intronic
1114744388 14:25132255-25132277 GAGGCAGTGAGGCAGGGAGGTGG + Intergenic
1115166631 14:30455554-30455576 AATGGAGTGAGGCAGAGAGGAGG - Intergenic
1115722822 14:36181802-36181824 GGTGCCTTGAGGCACTGAGGGGG + Intergenic
1115854695 14:37618312-37618334 TGAGCAGTGAAGCAGTCAGAAGG - Intronic
1116858938 14:49978533-49978555 AGTCAAGGGAGGCAGTGAGGGGG + Intergenic
1118156013 14:63242624-63242646 TGAGCAGTGAGGCACAGAGAAGG - Intronic
1118746026 14:68773838-68773860 TGAGCTGTGGGGCAGTGGGGAGG + Intergenic
1119788166 14:77327878-77327900 GGAGCAGTGAGGCAGGGAGAGGG - Intronic
1120537155 14:85711230-85711252 TATGCAGTGATGCAGCGAGGAGG + Intergenic
1120871174 14:89338723-89338745 TGGGCAGGGAGGCATGGAGGAGG + Intronic
1121713755 14:96058207-96058229 TGTACAGTGACCGAGTGAGGAGG - Intronic
1121912285 14:97802585-97802607 TGTTTAGTGAGTCAGGGAGGGGG + Intergenic
1121946568 14:98128722-98128744 TGGGCAGTGGGGAAGTGAGGTGG - Intergenic
1122127011 14:99584745-99584767 TGGGCAGTGGGGCAGTTATGTGG - Intronic
1122223824 14:100260838-100260860 GTTGCAGTGACGCAGTGACGTGG + Intronic
1122606990 14:102953303-102953325 TGGGCAGGGAGGCCGTGGGGCGG + Intronic
1122942939 14:104990887-104990909 GGTGCTGTGAGGCATAGAGGGGG + Intronic
1123058505 14:105583838-105583860 TTTGCAGGGAGGAAGTGTGGAGG - Intergenic
1123082838 14:105704071-105704093 TTTGCAGGGAGGAAGTGTGGAGG - Intergenic
1123503619 15:20915456-20915478 AGTGCTGTGAGGGAGTGAGGTGG - Intergenic
1123560866 15:21489130-21489152 AGTGCTGTGAGGGAGTGAGGTGG - Intergenic
1123597105 15:21926421-21926443 AGTGCTGTGAGGGAGTGAGGTGG - Intergenic
1124495448 15:30184009-30184031 TGTGCAGGGAGGCAGGCAGGGGG - Intergenic
1124748125 15:32354637-32354659 TGTGCAGGGAGGCAGGCAGGGGG + Intergenic
1125276269 15:37995370-37995392 TGTGGAGTGAGAAAGTAAGGTGG - Intergenic
1125686473 15:41566445-41566467 AGTATAGTGTGGCAGTGAGGGGG - Intronic
1126131741 15:45348474-45348496 AGTGAAGTGAGGAAGGGAGGTGG + Intergenic
1126599817 15:50417526-50417548 TGTGCAGGCAGCCAGTGATGCGG - Intergenic
1127352073 15:58163066-58163088 TGTGCAGAAAGGCAGTTGGGTGG + Intronic
1127508149 15:59614607-59614629 GGGGCAGTGTAGCAGTGAGGAGG + Intronic
1128549954 15:68591613-68591635 TGTGCAATGAGGCGGGGAAGGGG + Intronic
1128765465 15:70248512-70248534 TGGCCATGGAGGCAGTGAGGAGG - Intergenic
1128914440 15:71547004-71547026 CGTCCACTGAGGCAGGGAGGAGG - Intronic
1130304714 15:82705446-82705468 TGTGGAGGGAGGTATTGAGGAGG - Intronic
1130532860 15:84760819-84760841 TCAGCAGGGAGGCAGTGAGTTGG + Intronic
1130770088 15:86915641-86915663 GGTGCAGTGGGGCGGTGGGGGGG - Intronic
1131165030 15:90136029-90136051 TGTGGAGGGAGGCATTGAGGAGG - Intergenic
1131874149 15:96787023-96787045 TTAGCAGTGAGGTAGTGATGTGG - Intergenic
1132449148 15:101955982-101956004 TGTTCAGTCAGGCAGGGAGTGGG - Intergenic
1202969211 15_KI270727v1_random:216294-216316 AGTGCTGTGAGGGAGTGAGGTGG - Intergenic
1132693031 16:1190122-1190144 CGGGCAGTGGCGCAGTGAGGTGG - Intronic
1132864444 16:2086526-2086548 TGGGCATGGAGGCAGTGATGGGG + Intronic
1133415858 16:5606489-5606511 TGAGAAGTGAGGGAGAGAGGAGG - Intergenic
1134462498 16:14441669-14441691 TGTGCAGTGAGGCAGAGGCAGGG - Intronic
1134601148 16:15534668-15534690 TGTGCCATAAGGCAGTGGGGTGG + Intronic
1134901495 16:17942138-17942160 TCTGCAGCGAGACAGTGACGGGG + Intergenic
1135159256 16:20078989-20079011 CATGCAGTTAGGCAGTGAGTGGG + Intergenic
1135668373 16:24354462-24354484 TTTCCAGGGAGGCAGGGAGGTGG + Intronic
1137735128 16:50718171-50718193 TGTGATGGGAGGAAGTGAGGTGG + Intronic
1138268011 16:55674175-55674197 TGAGGAGTGAGGGAGGGAGGGGG - Intronic
1138373524 16:56546505-56546527 TGTGCAGGGTGGCTGTGAGAAGG - Intergenic
1138643725 16:58407191-58407213 AATGCAGGGAGGCAGTTAGGGGG - Intergenic
1138678861 16:58671004-58671026 TGTGCTGTGGGGCTGTGAGATGG + Intronic
1139922178 16:70467350-70467372 TGTGGGGTGGGGCAGTCAGGAGG - Intronic
1140136599 16:72211275-72211297 TGTGCACTGAGTCTGGGAGGTGG - Intergenic
1141088012 16:81110598-81110620 GGTGCACTGAGGGAGTGATGGGG - Intergenic
1142270347 16:89085726-89085748 TCGTCAGTGAGGAAGTGAGGAGG - Intergenic
1142625007 17:1186448-1186470 TGCCTAGGGAGGCAGTGAGGGGG - Intronic
1143029782 17:3961499-3961521 TGTGCAGTGAGGGAGGAGGGTGG + Intronic
1143078845 17:4366622-4366644 CGCGCAGTGAGGCAGTGGCGGGG - Intronic
1143181922 17:4988736-4988758 GGTGGAGTGAGGGAGTGATGTGG - Intronic
1143290194 17:5822468-5822490 TCAGCAGTGAGGCACTGAAGAGG - Intronic
1143332879 17:6150347-6150369 TGTGGAGAGAGGGAGGGAGGAGG + Intergenic
1143357635 17:6342397-6342419 TGTGTAGTGTGGACGTGAGGAGG - Intergenic
1144486941 17:15674519-15674541 TGTGCGGTGGGGCAGTGTGGGGG - Intronic
1144488590 17:15687800-15687822 AGTGCAGTGAGGGAGTGGAGAGG - Intergenic
1144821910 17:18081108-18081130 TGTGCAATGAGCCCTTGAGGTGG - Intergenic
1144914086 17:18707781-18707803 TGTGCGGTGGGGCAGTGTGGAGG + Intronic
1146698666 17:34933459-34933481 TGTGAAGTGAAGCAGTGAAAGGG - Intronic
1146724234 17:35144652-35144674 TGCTCAGGGAGGCAGTGCGGGGG - Intergenic
1148484845 17:47984055-47984077 TGGGCAGAGAGGCAGTGAGTGGG - Intergenic
1148693959 17:49548190-49548212 AGAACAGTGAGGCAGTGGGGCGG - Intergenic
1148700726 17:49585257-49585279 TGTGCCTTGAGACAGGGAGGAGG - Intergenic
1149033197 17:52106326-52106348 AGTGGAGTGAGCCAGGGAGGTGG + Intronic
1149158368 17:53661549-53661571 TGTGAAGAGAGGCAGGGAGAAGG + Intergenic
1149634613 17:58156880-58156902 TGGGGAATGAGGCAGGGAGGTGG - Intergenic
1152709920 17:81866295-81866317 TGTGCTGTGGGGGAGAGAGGCGG - Intergenic
1153964542 18:10167840-10167862 TGAGCCGAGAGGCAGGGAGGAGG - Intergenic
1153978282 18:10288281-10288303 TCAGCAGTGGGGCTGTGAGGTGG - Intergenic
1154214515 18:12406496-12406518 TGTGCAGTGAGGCAGGGAAGTGG - Intergenic
1155878858 18:31119095-31119117 TGAGGAGGGGGGCAGTGAGGTGG + Intergenic
1156582215 18:38391181-38391203 AGTGCAATGAGGCAGAGAGAGGG + Intergenic
1159066182 18:63569925-63569947 TGGGCAGTGAGGCATTGTTGAGG + Intergenic
1160506187 18:79427880-79427902 TGTGCAGTGAGTCGGGGAGGGGG + Intronic
1160636109 19:76571-76593 TGTTCAGTCAGGCAGGGAGTGGG + Intergenic
1160865238 19:1253275-1253297 TGGGGAGGGAGGCAGGGAGGAGG - Intronic
1161057108 19:2196153-2196175 TGTGCTGTGGGACAGTGCGGAGG - Intronic
1161120768 19:2525118-2525140 TCTGCAGGGAGGCAGTTGGGAGG - Intronic
1161133970 19:2608740-2608762 TCTGCACTGAGGCTGTCAGGGGG + Intronic
1161357306 19:3826177-3826199 TGAGCAGGGAGGCATGGAGGAGG - Intronic
1161592748 19:5136106-5136128 TGTCCAGAGGGCCAGTGAGGAGG - Intronic
1161657085 19:5523028-5523050 AGTGCACTGAGGCGATGAGGGGG - Intergenic
1161736434 19:5994915-5994937 TGAGCAGCGTGGCAGCGAGGCGG - Exonic
1161995174 19:7707420-7707442 TGTGGATTGTGGCAGTGGGGTGG + Intergenic
1162037448 19:7949395-7949417 TGAGCAGGCAGGCAGTGAGCAGG - Intergenic
1163633292 19:18427650-18427672 TGGGCAGGGAGGGAGTGGGGAGG - Intronic
1164235228 19:23326012-23326034 TATTCAGTGTGGCAGTGATGTGG - Intronic
1164301537 19:23966568-23966590 TATTCAGTGTGGCAGTGATGTGG + Intergenic
1165926766 19:39331239-39331261 TGTTCAGGGAGGCAGCCAGGTGG + Intronic
1166010101 19:39935322-39935344 TGGGCAGTGAGGGTGGGAGGTGG + Intergenic
1166079313 19:40433946-40433968 TGGGGAGGGAGGCAGGGAGGGGG + Intergenic
1166352046 19:42203880-42203902 TGTCCAGTGTGGCCCTGAGGTGG + Intronic
1166893751 19:46010319-46010341 TGTGCAGTGAACCAGACAGGTGG + Intronic
1166976645 19:46608780-46608802 TGGGGAGAGAGGCAGTGAGAGGG - Intronic
1166987610 19:46670918-46670940 TGTGTACTGAGGTAGGGAGGGGG + Intergenic
1167179972 19:47895569-47895591 GGTGGAGGGAGGGAGTGAGGTGG + Intergenic
1167593090 19:50414952-50414974 GGCGCAGTGAGGCAGTGACCAGG - Exonic
1167603320 19:50466989-50467011 CCTGCAGTTAGGGAGTGAGGGGG + Intronic
1167637008 19:50661133-50661155 TGTGCATGGAGTCTGTGAGGGGG + Intronic
1167648548 19:50718315-50718337 TGTGCGGCGGGGCAGGGAGGAGG - Intronic
1168296145 19:55378131-55378153 TGTGGAGGGAGGCACCGAGGGGG + Exonic
925654077 2:6126021-6126043 GGGGCAGTGAGGCACAGAGGAGG + Intergenic
926966680 2:18422590-18422612 TGTGGAGTGAGGAAGTGATCTGG - Intergenic
926986507 2:18630638-18630660 TGTGCAGTTAGAAAGTGGGGAGG - Intergenic
928631498 2:33197794-33197816 TGTGCAACGAGGCAGTGGGCAGG - Intronic
929594476 2:43167780-43167802 GGTGCAGTGAGGCAAAGGGGTGG + Intergenic
929601977 2:43210244-43210266 TGTGGAGTGGGGCAGGGAGGAGG + Intergenic
929805719 2:45143285-45143307 TGTGCAGTGAGGCAGGATAGAGG - Intergenic
930020359 2:46998144-46998166 TTTGCACTGAGGCTGGGAGGAGG + Intronic
930021059 2:47002563-47002585 AGGGCAGTGAGCCAGGGAGGAGG + Intronic
930851947 2:55970919-55970941 AGTTCAGTGAGGCAGTAATGGGG + Intergenic
932077247 2:68676499-68676521 TGTGGGGTGAGGGAGTGGGGAGG - Intergenic
932731750 2:74226755-74226777 TGTGGGGTGGGGCAGAGAGGAGG - Intronic
934522407 2:95027464-95027486 TGGGAAGTGAGGAAGGGAGGTGG - Intronic
934933513 2:98447106-98447128 AGTTCAGTGAGGCAGAGTGGAGG + Intronic
935052668 2:99536783-99536805 TGGGCAGGGAAGCAGTGAAGAGG + Intergenic
935331632 2:101981599-101981621 TGTGCAGGGTGGCTGCGAGGAGG - Intergenic
936548297 2:113411994-113412016 TGTTCTGAGAGGCAGTGAGCAGG + Intergenic
936565372 2:113578479-113578501 TGTTCAGTCAGGCAGGGAGTGGG - Intergenic
937753615 2:125508877-125508899 TCTGCAGTCAGGCAGTGACATGG + Intergenic
946165942 2:217863920-217863942 TGGGCTGGGAGGCAGGGAGGAGG - Intronic
946326145 2:218985535-218985557 TTTGCAGAGAGTCAGGGAGGCGG - Exonic
946487534 2:220114930-220114952 TTTCCAGGGAGGCAGTGCGGTGG + Intergenic
946891145 2:224278339-224278361 TGTGCAGTGAGCAAGGAAGGTGG + Intergenic
947324403 2:228958867-228958889 TGGGCACTGAGGAAGTGTGGTGG - Intronic
948678045 2:239610650-239610672 GATGCAGGGAGGCAGGGAGGAGG + Intergenic
948888549 2:240896056-240896078 TGTGCAGATGGGCTGTGAGGAGG + Exonic
1168896606 20:1328158-1328180 TGTGCAGAGAGGGAGTAAGGAGG + Intronic
1169730902 20:8784601-8784623 TGTGTAGTAAGGCACTGTGGGGG + Intronic
1171282369 20:23911437-23911459 TGTGCTGGGAGGCAGGGATGTGG - Intergenic
1171407098 20:24918799-24918821 TGTGCAGGGCAGGAGTGAGGTGG - Intergenic
1171468945 20:25354364-25354386 GGGGCAGGGAGGCAGGGAGGGGG + Intronic
1173558095 20:43982314-43982336 TGTGCTGTGGGGCAGACAGGTGG + Intronic
1174297641 20:49560561-49560583 GGTGGTGTGAGACAGTGAGGGGG + Intronic
1175630070 20:60528346-60528368 TGTGCACTGAGTCAGTGCTGAGG + Intergenic
1175630397 20:60530636-60530658 TGTGAAATGAGACAGTGAGAAGG - Intergenic
1175936753 20:62517700-62517722 GGTGTGGTGAGGCTGTGAGGGGG - Intergenic
1176125842 20:63474225-63474247 TGGGCACAGAGGCAGGGAGGCGG - Intergenic
1176208312 20:63903297-63903319 TTTGAGGTGAGTCAGTGAGGTGG - Intronic
1176385998 21:6138780-6138802 GGTGCAGCCAGGGAGTGAGGGGG - Intergenic
1178683010 21:34689024-34689046 TGTGGGGTGAGGGAATGAGGTGG + Intronic
1179365987 21:40759052-40759074 TGTGAAATGGGGTAGTGAGGAGG + Intronic
1179451988 21:41473932-41473954 TGAGGAGTGAGGAGGTGAGGGGG + Intronic
1179737475 21:43399472-43399494 GGTGCAGCCAGGGAGTGAGGGGG + Intergenic
1179822479 21:43944632-43944654 TGTGCCGGGAGGCAGGCAGGGGG + Intronic
1180140974 21:45893215-45893237 TGAGCAGGGAGGGAGTGGGGAGG + Intronic
1180238687 21:46483044-46483066 TGTGCAGTGATGGAGTGAGGGGG + Intronic
1181377909 22:22475083-22475105 TGGGCAGTGACTGAGTGAGGAGG - Intergenic
1181638099 22:24183585-24183607 TGTCCAGTGACACAGTGAAGGGG - Exonic
1182155025 22:28063523-28063545 TGGGCAGTGGGGCAGGGTGGGGG - Intronic
1182593440 22:31399642-31399664 TGTGAAGGGAGACAGTGTGGAGG + Exonic
1182773359 22:32811986-32812008 GGTGCAGTGTGGCATGGAGGAGG + Intronic
1183028754 22:35086094-35086116 TGGGCACTGAGGCACAGAGGAGG + Exonic
1183215686 22:36478340-36478362 TGTTCAGTAAGGAAGTGGGGTGG - Intronic
1184072560 22:42154996-42155018 TGGGCAGTGAGGCAGCCATGGGG - Intergenic
1184379838 22:44138367-44138389 TGAGCAGTGAGGAAGGGAGTTGG + Intronic
1184740936 22:46428773-46428795 TGTGCAGTGAGGCAGTGAGGTGG - Intronic
1185238370 22:49727500-49727522 TGTCCAGCCAGTCAGTGAGGAGG - Intergenic
949509815 3:4758176-4758198 TGTCTTATGAGGCAGTGAGGTGG + Intronic
950119756 3:10474025-10474047 AGAGCAGGGAGGAAGTGAGGTGG + Intronic
950335272 3:12188260-12188282 TGTGCAGTGGGGCAGTGTGGAGG - Intronic
950473473 3:13200997-13201019 TGTGCAGTGAGGCAGGGCTCAGG - Intergenic
950682793 3:14596496-14596518 TGTGGAGTGAGGGAGTGAGATGG - Intergenic
952997082 3:38894934-38894956 TGAGCAGTAAGGCAATGAAGAGG + Exonic
953021416 3:39116143-39116165 TGTGCAGGGAGACAGTGTGTGGG + Intronic
953706937 3:45238297-45238319 TGTGAAGAGAGGAAGTGAAGGGG - Intergenic
953808723 3:46093889-46093911 CCTGCAGTGAGGCTGTGAGGAGG - Intergenic
953821706 3:46212532-46212554 TATGCAGTGAGGAGGGGAGGTGG - Intronic
954364402 3:50138562-50138584 TCTGCAGGGAGGCAGGGAGCTGG - Intergenic
954441648 3:50525456-50525478 GGGGGAGGGAGGCAGTGAGGAGG + Intergenic
954582951 3:51712928-51712950 TGTGGTGGCAGGCAGTGAGGGGG + Exonic
954716486 3:52529347-52529369 GATGCAGGGAGGCAGTGATGGGG + Intronic
954924063 3:54217114-54217136 TGTGCAGTGAGCAAGGGAGAGGG + Intronic
957512259 3:81204155-81204177 TTCACAATGAGGCAGTGAGGTGG + Intergenic
958594893 3:96209978-96210000 TGTTCAGGGAGGCATTGATGTGG + Intergenic
961414432 3:126746963-126746985 GGTGCTGTGGGGCTGTGAGGTGG + Intronic
961474925 3:127140520-127140542 GGTGGGGTGGGGCAGTGAGGTGG + Intergenic
961506416 3:127373458-127373480 TGTGCAGTGAGCCAGGAATGAGG + Intergenic
961648080 3:128403289-128403311 TGTGCAGAAGGGCAGCGAGGAGG + Intronic
961811005 3:129521603-129521625 TGCGGAGGGAGGCAGGGAGGAGG - Intergenic
962108213 3:132415817-132415839 TGAACAGAGAGGCAGTGTGGAGG + Intergenic
962786730 3:138775647-138775669 GGGGCAGTGAGGCAGTGAGGGGG - Intronic
962854300 3:139330162-139330184 TGTGAGGTGAGGCTGTGGGGTGG - Intronic
965345659 3:167546066-167546088 TGAGGAGGGAGACAGTGAGGTGG + Intronic
966621338 3:181967584-181967606 TATGCATTGAAGCAGTGAGAGGG + Intergenic
967867292 3:194200791-194200813 AGTGCAGACAGGCAGAGAGGAGG + Intergenic
968702278 4:2062737-2062759 TGTGCAGAGGGGCAATGGGGAGG + Intronic
968742161 4:2336761-2336783 TGAGGAGTGAGGAGGTGAGGAGG + Intronic
968762236 4:2448727-2448749 AGTGGAGTGAGGCAGGGAAGAGG + Intronic
968948562 4:3678455-3678477 TGAGGAGTGAGGAGGTGAGGAGG + Intergenic
968948567 4:3678478-3678500 TGAGGAGTGAGGAGGTGAGGAGG + Intergenic
968948572 4:3678501-3678523 TGAGGAGTGAGGAGGTGAGGAGG + Intergenic
968948626 4:3678801-3678823 TGAGGAGTGAGGAGGTGAGGAGG + Intergenic
969777980 4:9373921-9373943 TGTGCAGTGAGGGTGGAAGGCGG - Intergenic
969980534 4:11149736-11149758 TGAGAAGGGAGGCAGTGAGATGG + Intergenic
970979714 4:22082077-22082099 TGTGGTGAGAGGCAATGAGGAGG + Intergenic
971351968 4:25863065-25863087 TGGGCAGGGAGGCAGAGGGGAGG - Intronic
971427980 4:26534436-26534458 TTTCCAGTGAGGTTGTGAGGAGG + Intergenic
976507351 4:85863731-85863753 TGTGCAGTGAGCTTGTGAAGTGG + Intronic
977328409 4:95606151-95606173 TGGGTAGTGACCCAGTGAGGTGG - Intergenic
981447311 4:144854850-144854872 AGTGCAGGGAGGTAGTGGGGTGG + Intergenic
982683508 4:158460064-158460086 TGTGGAAAGAGGCATTGAGGAGG - Intronic
983888513 4:173007183-173007205 TGGGCAATGAGGCAGAGAGGAGG - Intronic
984688217 4:182695433-182695455 TGTGCAGGGTGGCATTGGGGTGG + Intronic
984926927 4:184815265-184815287 TGAGCAAAGAGGCAGGGAGGAGG + Intronic
985511226 5:315354-315376 TGCACAGTGAGGCAGGGAGGCGG - Intronic
985720822 5:1487837-1487859 TGGGAAGTGTGGCAGTGAGCAGG - Intronic
985983101 5:3488596-3488618 GGGGCAGAGAGGCAGAGAGGTGG - Intergenic
986199596 5:5569366-5569388 TGTGAAGTTGGGCTGTGAGGAGG - Intergenic
986309790 5:6543533-6543555 TGTGCAGGGAGCTGGTGAGGAGG - Intergenic
986442785 5:7796439-7796461 TGTGCATTGATGCAGTGGGTAGG - Intronic
988306448 5:29499569-29499591 TTTGCAGGGAGGCAATGAAGTGG - Intergenic
988334636 5:29890428-29890450 TGTGCAGTGGGGGAGTGGTGTGG - Intergenic
988828779 5:34967873-34967895 TGAGCAGTGGGGCAGTGAGTTGG - Intergenic
989115533 5:37948928-37948950 TGGGAAGTGAGGCAGGGAAGAGG + Intergenic
989165379 5:38428679-38428701 ACTGCAGAGAGGCAGTGTGGAGG - Intronic
990014619 5:51044618-51044640 TGTTCAGTGAGAAAGAGAGGAGG + Intergenic
991316190 5:65309447-65309469 TGGGCAATGTGGCAGTGGGGGGG + Intronic
993709036 5:91204862-91204884 TGTGAAGTAAGGCTGTGTGGTGG - Intergenic
996058917 5:119011339-119011361 GGCGCAGTGAGGCTGTGAGCCGG + Intergenic
997411119 5:133691695-133691717 TGTTGAGTGAGTCAGTGTGGAGG - Intergenic
997876763 5:137556553-137556575 TGTGTAATGAGGAAGGGAGGAGG + Intronic
998173558 5:139886432-139886454 TGTGTGGTGGGGCGGTGAGGAGG + Intronic
998296787 5:140978269-140978291 TGAACAGTGATTCAGTGAGGAGG + Intronic
999127802 5:149259227-149259249 GGAGCAGTGAGGGAGAGAGGAGG - Exonic
999330180 5:150668479-150668501 TTTACAGTGAGGCGGTGAGGAGG - Intronic
999982396 5:156970301-156970323 TGAGCTGTGAGGAAGTGAGCTGG + Intergenic
1000109023 5:158089446-158089468 AGTGCAGTCAGGCAGTGACATGG + Intergenic
1001306775 5:170580521-170580543 TGAGGCGGGAGGCAGTGAGGGGG - Intronic
1002052347 5:176578145-176578167 TCTGCAGAGAGGCAGAGAGGTGG - Intronic
1002563732 5:180098913-180098935 TGCCCAGTGATGCAGTGATGGGG + Intergenic
1002594251 5:180312007-180312029 GGGGCAGGGAGGCAGGGAGGCGG + Intronic
1002594268 5:180312047-180312069 GGGGCAGGGAGGCAGGGAGGCGG + Intronic
1003268691 6:4588844-4588866 TCTGCAGTGTGGCTGTGAAGAGG - Intergenic
1004266197 6:14150431-14150453 TGGGCAACGAGGCAGTCAGGTGG - Intergenic
1004563454 6:16773239-16773261 AGTGGAGTGAGGCTGTGAAGAGG - Intergenic
1004866835 6:19860981-19861003 TGTGCAATTAGGCAGTGGTGTGG - Intergenic
1005019116 6:21400990-21401012 TCTGCAGTGAGGCTGTGACAAGG - Intergenic
1006316469 6:33294832-33294854 TGTTCTCTGAGGCAATGAGGAGG - Intronic
1007896920 6:45372203-45372225 AGGGAACTGAGGCAGTGAGGTGG - Intronic
1008473597 6:51911607-51911629 TGGGCAGTGGGGCAGAGAGGAGG + Intronic
1011023118 6:82836347-82836369 AGGGCAGTGAGGCAGGGAAGGGG - Intergenic
1011060536 6:83261586-83261608 CATCCAGTGAGGAAGTGAGGAGG + Intronic
1012978680 6:105807366-105807388 TTTGCAGCGAGGTAGTGAGTGGG - Intergenic
1013012404 6:106132509-106132531 TGTGCAGTGAGGCTGAGGGATGG + Intergenic
1013308947 6:108875370-108875392 TGTGCAAGGAGGCAAAGAGGAGG - Intronic
1013338904 6:109193643-109193665 TGTCAAATGAGGCACTGAGGGGG - Intergenic
1014175278 6:118325377-118325399 TGAGAGGTCAGGCAGTGAGGGGG - Intergenic
1015128581 6:129784132-129784154 TGTGCTGTGAGGAAGAGAGGTGG - Intergenic
1015772724 6:136785527-136785549 TGTCCACTGAAGGAGTGAGGTGG + Intronic
1017090351 6:150753695-150753717 TGTGCAAAGCGGGAGTGAGGTGG + Intronic
1017375901 6:153767563-153767585 TGTGCAGAAATGTAGTGAGGTGG - Intergenic
1017980559 6:159397715-159397737 TGGGTAGGGAGGCAGTGAGTTGG - Intergenic
1018639008 6:165889903-165889925 TGAGGAGTGAGGGAGGGAGGAGG - Intronic
1018639022 6:165889947-165889969 TGAGGAGTGAGGGAGGGAGGAGG - Intronic
1018866649 6:167751684-167751706 TGTGCCGTGAGGAAGTTAGGAGG - Intergenic
1019362848 7:614413-614435 TGTGAAGTGGGGCAGTAATGGGG - Intronic
1020134724 7:5580833-5580855 TGAGCTGTGAGTCAGTGAAGGGG - Intergenic
1023481778 7:40642818-40642840 TGAGCAAGGAGGCGGTGAGGTGG - Intronic
1023547161 7:41330357-41330379 TGAGCATCTAGGCAGTGAGGAGG - Intergenic
1023882162 7:44326575-44326597 AGTGCAGGGAGGCAGGCAGGAGG + Intronic
1024607151 7:51031412-51031434 TGTGCAGTGTTGAGGTGAGGTGG - Intronic
1026824647 7:73573850-73573872 TCTGCTTTGAGGTAGTGAGGAGG - Intronic
1026894344 7:74001267-74001289 GTTGGTGTGAGGCAGTGAGGAGG - Intergenic
1027981272 7:85225779-85225801 TGAGCAGTGGGGTACTGAGGAGG + Intergenic
1028467080 7:91164513-91164535 TGTGTAGTTAGGAAGTAAGGAGG + Intronic
1028954474 7:96673638-96673660 TGTGCATGGAGTCAGTAAGGAGG - Intronic
1029344366 7:99967622-99967644 TGTGCAGTGCTGCAGGGAAGTGG - Intronic
1029347121 7:99986858-99986880 TGTGCAGTGCTGCAGGGAAGCGG + Intergenic
1029403742 7:100360696-100360718 AGTGCAGTGCAGGAGTGAGGTGG + Intronic
1030492338 7:110253728-110253750 TTGGCATTGAGGCAGTCAGGTGG + Intergenic
1030630922 7:111894735-111894757 TGAGGAGTGAGGCAGTAGGGAGG + Intronic
1031877322 7:127156365-127156387 TGTGGAGAGGGACAGTGAGGTGG - Intronic
1033147110 7:138880816-138880838 TGGGGAGCGAGGCAGGGAGGAGG + Intronic
1033231729 7:139603472-139603494 TGTGCTGGCAGGCAGTCAGGTGG + Intronic
1033360553 7:140636197-140636219 TGGGCAGAGAGGCAGTGGTGAGG + Intronic
1033596384 7:142862601-142862623 GGGGCAGTGAAGCAGTGAAGCGG - Intronic
1034318407 7:150156050-150156072 CTTGCAGGGAGTCAGTGAGGTGG + Intergenic
1034501421 7:151453244-151453266 TCTGCAGTGGGGCACTGAGGGGG - Intergenic
1034774344 7:153811182-153811204 CTTGCAGGGAGTCAGTGAGGTGG - Intergenic
1035828859 8:2673067-2673089 TGTACAGTGAGGAAGGGAGAAGG + Intergenic
1035956667 8:4088113-4088135 GCTGCAGTGGGGCTGTGAGGAGG + Intronic
1038065200 8:23956737-23956759 TGTCCAATGCGGCAGTGACGTGG - Intergenic
1038162458 8:25052849-25052871 TGTCCACTGATGCAGTGAGAGGG + Intergenic
1038413617 8:27377040-27377062 TGTGCAAAGTGGGAGTGAGGAGG + Intronic
1039647434 8:39303269-39303291 TCTGCCCTGAGGCAGTCAGGGGG - Intergenic
1039807197 8:41010600-41010622 TGGGACGTGAGGCAGTGATGGGG - Intergenic
1040595318 8:48832609-48832631 GGTAGTGTGAGGCAGTGAGGAGG - Intergenic
1041081869 8:54222008-54222030 TGGGCAATGAGGCTGGGAGGTGG - Intergenic
1041939528 8:63371396-63371418 TGAGGAGTGAGGCAGAGAGTCGG - Intergenic
1042148744 8:65759206-65759228 TCTGCAGTCAGCCAGTGATGTGG + Intronic
1044363873 8:91320443-91320465 TGTACTGTGAGGCTGTTAGGTGG + Intronic
1044862456 8:96536229-96536251 AGTGAAGGGAGGCAGTGACGTGG + Intronic
1044873039 8:96638863-96638885 AGAGCAGTCTGGCAGTGAGGAGG - Intergenic
1045199322 8:99963282-99963304 TTTGCAGGGAGGAGGTGAGGTGG + Intronic
1045962059 8:107979879-107979901 TGAGCAGAGAGCCAGAGAGGAGG - Intronic
1046004745 8:108464980-108465002 TCTGGAGTGAGGCAGGGGGGAGG + Intronic
1046049785 8:109009240-109009262 TATGCAGTGAGGGACTGAAGTGG - Intergenic
1046449960 8:114375910-114375932 TGGGAAGTGAGGGAGTGGGGGGG - Intergenic
1046836051 8:118802715-118802737 TGTGCAGTTAGGAAGGGATGAGG - Intergenic
1047007722 8:120638314-120638336 TGTCCAGAGAGGCACTGAGACGG - Intronic
1047158125 8:122344964-122344986 TGGGCAGTCAGGCAGTCAGTAGG + Intergenic
1047218995 8:122903512-122903534 TGTGCAGGGATGGAGTGAGCGGG + Intronic
1047498307 8:125424181-125424203 TGTGCCGTGAGACAGGGAGATGG + Intergenic
1048817701 8:138349204-138349226 TGAACAGTGAAGAAGTGAGGAGG - Intronic
1048864504 8:138749809-138749831 AGTCAAGTGAGGCAGTCAGGTGG - Intronic
1048908215 8:139109082-139109104 TGAGGTCTGAGGCAGTGAGGAGG - Intergenic
1048984955 8:139730327-139730349 GATGCAGGGAGGCAGGGAGGGGG + Exonic
1049566265 8:143340665-143340687 AGTGCAGTGTGGGAGTGAGCTGG - Intronic
1049887052 9:34745-34767 TGTTCAGTCAGGCAGGGAGTGGG + Intergenic
1050002692 9:1095323-1095345 TGAGAAGTGAGCCAATGAGGAGG + Intergenic
1051948456 9:22601162-22601184 TTTTCATTGAGCCAGTGAGGTGG - Intergenic
1053272553 9:36760339-36760361 TGTCCAGGGAGGCAGTTGGGGGG - Intergenic
1053727266 9:41016793-41016815 TGTTCTGAGAGGCAGTGAGCAGG - Intergenic
1054701251 9:68415319-68415341 TGTTCTGAGAGGCAGTGAGCAGG + Intronic
1054879923 9:70134353-70134375 TGTGCAGGGGGAGAGTGAGGGGG - Intronic
1055951463 9:81733541-81733563 CGTGCCGAGAGGCAGAGAGGAGG + Intergenic
1056261690 9:84855056-84855078 TGGGGAATGAGGCAGGGAGGGGG + Intronic
1056271074 9:84948634-84948656 GGTACAGTGAGGCGGGGAGGTGG + Exonic
1057260599 9:93580948-93580970 GGGGCAGGGAGCCAGTGAGGAGG + Intronic
1057851128 9:98567729-98567751 AGTTCAGTGAGGCTCTGAGGGGG + Intronic
1057895418 9:98904947-98904969 TCTACAGAGAGGCAGAGAGGAGG + Intergenic
1057992024 9:99780567-99780589 TTTGCAGTGATGCAGTGACCTGG - Intergenic
1058596445 9:106621008-106621030 TGTGCTGGGAGGCAGACAGGAGG - Intergenic
1058987462 9:110221587-110221609 TTTCCAGTGAGGAAGTGGGGAGG - Intergenic
1059720861 9:116958994-116959016 AGTGCAGTGAGGAGGTGAGAAGG + Intronic
1059735676 9:117097165-117097187 TGTGCAGCGAGGATGGGAGGAGG + Intronic
1060488697 9:124065794-124065816 TTTGCGGTGAGGTAGGGAGGAGG + Intergenic
1060512328 9:124243044-124243066 TGTGCAGAGAAGCAGTCTGGGGG - Intergenic
1061656705 9:132097600-132097622 TGTGCAGTCAGGAATTGATGAGG + Intergenic
1061715540 9:132516460-132516482 AGTGCAGTGTGGAAGGGAGGTGG + Intronic
1061967970 9:134026556-134026578 TGTGTGGTGAGGAAATGAGGCGG - Intergenic
1186449094 X:9657192-9657214 TGGGCAGTGAGGCAGGGAGTAGG + Intronic
1186636238 X:11408227-11408249 TGTGTAAGGAGGCAGGGAGGGGG + Intronic
1186709006 X:12173343-12173365 AGTGGAGTGTGGCACTGAGGTGG + Intronic
1186906253 X:14114301-14114323 CGTGCTGTGGGACAGTGAGGAGG + Intergenic
1188759112 X:34003448-34003470 AGAGCAGTGAGGGAGAGAGGGGG - Intergenic
1188776003 X:34219586-34219608 TCTGCATTGAGCCAGTGAGTTGG + Intergenic
1188779822 X:34268108-34268130 TGTTCTGTGAGGCAGAGAGCTGG + Intergenic
1188929739 X:36092893-36092915 AGGGTAGTCAGGCAGTGAGGGGG - Intronic
1191091123 X:56622909-56622931 TGTACAGTAAAGCAGAGAGGTGG + Intergenic
1193165299 X:78273886-78273908 AGAGTAGTGAGGCATTGAGGAGG + Intronic
1193600883 X:83507941-83507963 GGGGCAGTCAGGGAGTGAGGTGG - Intergenic
1194738774 X:97546860-97546882 TTCTCAGTGAGGCAGTAAGGTGG + Intronic
1195089578 X:101445765-101445787 TGTGGAGGGAGGATGTGAGGAGG + Intronic
1195370638 X:104168790-104168812 TTTTCAATGGGGCAGTGAGGAGG + Intronic
1195669157 X:107454573-107454595 AGTGCAGTGTGGCTGTGAGGTGG - Intergenic
1196892226 X:120302471-120302493 TGTGCAGGGAGGAACAGAGGGGG - Intronic
1197644515 X:129003676-129003698 TTTGGAGTGAGGCATTTAGGAGG + Intergenic
1198251214 X:134880732-134880754 TGAGCAGTGAGGGAGGGAAGGGG + Intergenic
1198883468 X:141306882-141306904 TGAGCAGTGGGGCACTGAAGAGG + Intergenic
1199984719 X:152942090-152942112 TGGTCTGTGGGGCAGTGAGGAGG + Intronic
1200115522 X:153768190-153768212 AGAGCAGAGAGGCAGTCAGGGGG - Intronic
1200833511 Y:7710827-7710849 GTGGCAGTGAGGCAGTGGGGAGG - Intergenic