ID: 1184740937

View in Genome Browser
Species Human (GRCh38)
Location 22:46428776-46428798
Sequence AGCTGTGCAGTGAGGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 359}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184740937_1184740944 11 Left 1184740937 22:46428776-46428798 CCTCACTGCCTCACTGCACAGCT 0: 1
1: 0
2: 2
3: 33
4: 359
Right 1184740944 22:46428810-46428832 CCCCAGCGGGCCACACTGCCTGG 0: 1
1: 1
2: 1
3: 17
4: 224
1184740937_1184740948 24 Left 1184740937 22:46428776-46428798 CCTCACTGCCTCACTGCACAGCT 0: 1
1: 0
2: 2
3: 33
4: 359
Right 1184740948 22:46428823-46428845 CACTGCCTGGTGTCCATGTCAGG 0: 1
1: 0
2: 3
3: 11
4: 185
1184740937_1184740941 -3 Left 1184740937 22:46428776-46428798 CCTCACTGCCTCACTGCACAGCT 0: 1
1: 0
2: 2
3: 33
4: 359
Right 1184740941 22:46428796-46428818 GCTCACTCACGGGTCCCCAGCGG 0: 1
1: 0
2: 0
3: 6
4: 126
1184740937_1184740942 -2 Left 1184740937 22:46428776-46428798 CCTCACTGCCTCACTGCACAGCT 0: 1
1: 0
2: 2
3: 33
4: 359
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184740937 Original CRISPR AGCTGTGCAGTGAGGCAGTG AGG (reversed) Intronic
900080624 1:854537-854559 AGCTACGAAGGGAGGCAGTGGGG + Intergenic
900850305 1:5137155-5137177 AGTGGTGGAGTGAGGGAGTGGGG - Intergenic
901496712 1:9626511-9626533 AGCTGGGCAGGGAGGAAGGGAGG + Intergenic
901771342 1:11531878-11531900 AGCTCTGCAGTTAGGCGGTCTGG - Intronic
902234187 1:15047299-15047321 AGCTGTGCAGTGGGGGAGCTGGG - Intronic
902517438 1:16996944-16996966 AGAGGTGGAGTGAGGCAGGGTGG - Intronic
902517551 1:16997452-16997474 ATGTGTGCAGTGGGGCAGGGTGG + Intronic
902843547 1:19091606-19091628 AGATGTGCAGTGATTCCGTGTGG - Intronic
902881172 1:19372774-19372796 AACTGAGCACTGAGGCAGAGGGG - Intronic
903542779 1:24106211-24106233 AGCTGAGCAGGGTGGCACTGTGG + Intronic
904652064 1:32013475-32013497 AGCAGTGGAGGGAGGCTGTGGGG - Intergenic
904701958 1:32362979-32363001 AGCTCTGGAGTGGGTCAGTGGGG + Intronic
904754366 1:32760090-32760112 ACCTGTGCAGTGAGGGGTTGAGG + Intronic
904942047 1:34170757-34170779 AGCTGAGCAGAGAGGCAGGCTGG - Intronic
905310005 1:37042636-37042658 AGCTGTGGAGGCAGGCAGTCAGG + Intergenic
905404388 1:37723252-37723274 GGCTGAGGAGTGAGGCAGGGTGG + Intronic
905452021 1:38063055-38063077 AGCTGTGGAGTGTGCCAATGTGG + Intergenic
906462037 1:46042047-46042069 AGCTGTGCAGTCAGGCACCCTGG - Exonic
907316614 1:53576557-53576579 AGCTGGGCAGTGAGGAGGTGGGG - Intronic
907744146 1:57195867-57195889 AGCTTTGTAGGTAGGCAGTGTGG + Intronic
908112665 1:60912511-60912533 AGCTGAGCAGTGAGCTAGTAAGG - Intronic
908256988 1:62310941-62310963 AGCTGTGGAGTCAGGCAGAATGG - Intronic
910604090 1:89064481-89064503 AGCACTTCAGTGAAGCAGTGGGG + Intronic
911095966 1:94055312-94055334 AGCTCTGCAGTGAGGCGGAGAGG + Exonic
912518964 1:110232487-110232509 AGCCTTGCATGGAGGCAGTGGGG - Exonic
912573702 1:110644327-110644349 GGCTTTCCAGTGAGGAAGTGAGG + Intergenic
912688635 1:111786843-111786865 ATCTGTGCAGTGATCCTGTGAGG + Intronic
912760438 1:112361315-112361337 AGCTTTGCAGTCAGGCTGTTAGG - Intergenic
915538267 1:156550743-156550765 AGGTGTGCAATGAGGCATAGGGG - Intronic
916845281 1:168644075-168644097 AAGTGTGCAGTGAGGCCCTGAGG - Intergenic
918211897 1:182358547-182358569 AGCTTTTCAGAGAGGCAGGGAGG + Intergenic
918645939 1:186904567-186904589 ACTTGTGCAATGAGGAAGTGAGG + Intronic
919515906 1:198522435-198522457 AGCTGTGCAGGTAAGCAGTTTGG + Intergenic
919911621 1:202114543-202114565 AGCTGTGCTGTAGGCCAGTGAGG + Intergenic
920427194 1:205887824-205887846 AGTTGTGGAGGGAGGCATTGAGG + Intergenic
920679587 1:208062416-208062438 AGCTGGGCAGTGAGGGAAGGAGG - Intronic
920746276 1:208631920-208631942 AGCTCTGCCTTGAGGCAGAGTGG + Intergenic
923523551 1:234755380-234755402 AGCTGTGTGGTGAGGAAGTGGGG - Intergenic
923669825 1:236030920-236030942 AGCTGTGCAGGGAAGGAGTGGGG + Intronic
924494785 1:244576246-244576268 GCCACTGCAGTGAGGCAGTGGGG + Intronic
924608197 1:245552927-245552949 AGGTAGGCAGTGGGGCAGTGCGG + Intronic
1062918140 10:1257629-1257651 CACTGTGCAGTGAGGGTGTGTGG + Intronic
1063015740 10:2075216-2075238 AGCTCTGCACTGGGGCAGTAGGG + Intergenic
1063251328 10:4278536-4278558 AGCTGTTCAATGAGACAGGGTGG + Intergenic
1067267445 10:44757682-44757704 AGCTGTGCCCTGAGGGGGTGGGG - Intergenic
1067730910 10:48810918-48810940 GTCTGTGCAGTGAGGCTGCGGGG - Intronic
1067882200 10:50055603-50055625 AGCTTTCCAATGAAGCAGTGTGG + Intergenic
1068790787 10:61029056-61029078 AGCTGTGATGTGAGGTAGTCTGG + Intergenic
1068891111 10:62149122-62149144 GGCTGTGCAGTGAAGCACTCTGG - Intergenic
1069282286 10:66669896-66669918 AGCAACACAGTGAGGCAGTGAGG + Intronic
1069771766 10:70904926-70904948 AGCTGTGGAGGGAGGAGGTGTGG + Intergenic
1070013125 10:72496587-72496609 AGCTGGGCAGTCAGGCACGGTGG - Intronic
1070360719 10:75686042-75686064 AGCTGTGCAGTGGGAGAGTTGGG + Intronic
1070882799 10:79864181-79864203 AGCGTGGAAGTGAGGCAGTGAGG - Intergenic
1071649364 10:87380483-87380505 AGCGTGGAAGTGAGGCAGTGAGG - Intergenic
1074116805 10:110462347-110462369 AGCTGTGCAGTGGGGCAGGCTGG - Intergenic
1074596929 10:114876386-114876408 AGCTGAGCAGTGATGGAGTCTGG - Intronic
1075223684 10:120605935-120605957 AGCTGGGCAAGGAGGCAGGGAGG + Intergenic
1076063890 10:127433454-127433476 AGCTGAGCAGTGAGGGCTTGGGG + Intronic
1076252279 10:128994250-128994272 ATCTGTGCAGTGTGGCTGGGTGG + Intergenic
1076461874 10:130653336-130653358 TGCTGTGCAGTCAGGGAGGGAGG + Intergenic
1077077319 11:707503-707525 CGGTGTGAAGTGAGGCAGAGCGG - Intronic
1077211597 11:1373479-1373501 TCCTGTGCAGTGGGGCTGTGTGG + Intergenic
1077254595 11:1574579-1574601 ACCTGTGCCGGGAGGCGGTGCGG - Intergenic
1077525683 11:3063125-3063147 AGCTGTGCAGTGTGCCGCTGTGG + Intergenic
1077552510 11:3207260-3207282 TGCTGTGCTGAGAGGTAGTGGGG - Intergenic
1078016950 11:7623321-7623343 AGCTATGCAGACAGGCAGTTGGG - Intronic
1078545407 11:12243421-12243443 AGGTGTGCTGTGAGGGAGGGAGG - Intronic
1079952659 11:26823837-26823859 AGCAGTGCAGAGAGGAATTGTGG - Intergenic
1080839706 11:35972487-35972509 AACTGTGCAGTGAAGCAGCAGGG - Intronic
1081578489 11:44334681-44334703 AGCTGTGCTGAGAGACTGTGGGG - Intergenic
1082092553 11:48101651-48101673 AGCTGGGCAGTGGGGAAGGGAGG + Intronic
1083186586 11:61021424-61021446 AGCAGCCCAGGGAGGCAGTGAGG - Intergenic
1083210489 11:61181909-61181931 ACCTTTGCAGAGAGGCAGAGAGG + Intergenic
1083262618 11:61531384-61531406 GGCTGTGCAGGGAGGCAGGGTGG + Intronic
1083804681 11:65066750-65066772 AGCTGGGCTGGGAGGCAGGGAGG + Intronic
1085269444 11:75261686-75261708 CGCTGTGCAGTGACCCTGTGGGG + Intergenic
1085320483 11:75570938-75570960 AGCTGTTCTGTGAGGCTGTCTGG + Intronic
1085527789 11:77174139-77174161 TGCTGGGCTGTGAGGCTGTGGGG - Intronic
1086791456 11:91043647-91043669 AGATTTGTAGTCAGGCAGTGCGG - Intergenic
1087129701 11:94657746-94657768 AACTGTGCAGGGAGACAGGGAGG + Intergenic
1087497614 11:98910278-98910300 AGCAGTGCAGAGAGGAAATGTGG + Intergenic
1088452615 11:109998030-109998052 AGCTGTGAAGGGAGGCCTTGAGG + Intergenic
1088469419 11:110177307-110177329 AGTTGTGCAGTGCAGCAATGGGG - Intronic
1088826256 11:113496803-113496825 AGCCCTGCAGTGTGGGAGTGAGG + Intergenic
1089065043 11:115656334-115656356 AGCTGTGCAGATAGGCAGATAGG + Intergenic
1089810247 11:121125724-121125746 AGCTGTGCACAAAAGCAGTGGGG - Exonic
1090637552 11:128700387-128700409 ACCTGTGCCAAGAGGCAGTGTGG - Intronic
1090660930 11:128880967-128880989 TACTGTGAAGTGAGGCAGGGTGG + Intergenic
1092303877 12:7279775-7279797 AGTGAGGCAGTGAGGCAGTGAGG - Intergenic
1092768776 12:11877902-11877924 AGCTCAGCAGTGAGGCAGGGGGG - Intronic
1093191016 12:16075027-16075049 AAATGTGCAGTGAGGCAGTGTGG + Intergenic
1095174298 12:39073308-39073330 AAAAGGGCAGTGAGGCAGTGAGG - Intergenic
1095936110 12:47683356-47683378 AGGTGTTCTGTGAGGCACTGTGG - Intronic
1095942292 12:47735194-47735216 AGGTGTGCAGAAAGGGAGTGTGG - Intronic
1096743876 12:53713152-53713174 AGCTGTGCAGAGTGGGGGTGAGG - Exonic
1100172585 12:91992523-91992545 AGGTGTGCAATGAGGGAATGGGG + Intronic
1100627652 12:96352432-96352454 AGCTGTGCTGTGAAACAGAGAGG + Intronic
1102554722 12:113719350-113719372 ATCTGTGCAGTGGGCCACTGTGG - Intergenic
1102877512 12:116459339-116459361 GGCTGTGCAAAGAGGCATTGGGG - Intergenic
1105429821 13:20326454-20326476 GTTTGTGCAGTGAGGCACTGAGG + Intergenic
1105614686 13:22001075-22001097 AGCTTTGAAGTGAGGCAGCCTGG - Intergenic
1105883688 13:24624771-24624793 ATCGGGGCAGTGGGGCAGTGGGG + Intergenic
1106410613 13:29508724-29508746 AGCTGTGCAGAGAGGAAGGCAGG - Intergenic
1106699460 13:32213356-32213378 AGCTGCCCAGTGATGCAGTGAGG - Intronic
1106907687 13:34425732-34425754 ACCTGTGCAGCAGGGCAGTGGGG - Intergenic
1107651903 13:42553372-42553394 AGCTGGGCAGTCTGGCTGTGTGG + Intergenic
1108292636 13:48976357-48976379 AGAGGTGCAGAGGGGCAGTGGGG + Intronic
1111831890 13:93340531-93340553 AGATCCGCAGTGAGGAAGTGAGG + Intronic
1113180590 13:107620806-107620828 GTCTGTGCAGTGAGGGAATGAGG + Intronic
1113292187 13:108919266-108919288 TGCTGTGCAGTGAGGGAAGGTGG - Intronic
1113668927 13:112162088-112162110 AGCTGAGCAGAAAGGCACTGTGG - Intergenic
1114531488 14:23399286-23399308 GGCTGTGCTGTGAGGCACTGTGG - Intronic
1114693608 14:24607305-24607327 AGCTGTGCAGTGTGGCTGGCTGG - Exonic
1118407184 14:65436781-65436803 AGTTGTGCAGTGTAGCAGTCTGG + Intronic
1119730395 14:76947486-76947508 AGCTGGCCAGTGAGGCAGAAGGG - Intergenic
1120370321 14:83626007-83626029 AGGGTTGCAGTGAGGCAGTGGGG + Intergenic
1121009197 14:90510001-90510023 AGAGGTGCAGAGAGGCAGGGCGG + Intergenic
1121382935 14:93490016-93490038 AGCTGAACAATGAGGCACTGGGG + Intronic
1121592517 14:95127196-95127218 AGGTGTTCAGGGAGGCAGTAGGG - Intronic
1121816571 14:96933427-96933449 AGCTGGGGAGGAAGGCAGTGGGG + Intergenic
1122111805 14:99508554-99508576 AGCTGGGCCGTGAGGAAGGGAGG + Exonic
1122468660 14:101951074-101951096 AGGTGTTTAGTGAGCCAGTGGGG + Intergenic
1122606989 14:102953300-102953322 AGGTGGGCAGGGAGGCCGTGGGG + Intronic
1123412635 15:20072950-20072972 AGCTGAGCAGTGAGTCAGCAGGG - Intergenic
1123521977 15:21080063-21080085 AGCTGAGCAGTGAGTCAGCAGGG - Intergenic
1124237241 15:28001487-28001509 AGCTGGGCACTGGGGCAGTGTGG + Intronic
1125102946 15:35936274-35936296 GGCTGTTCAGTGAAGCACTGTGG - Intergenic
1126111855 15:45179834-45179856 AGCTGGGCTGGGAGGCCGTGGGG + Intronic
1127388240 15:58484723-58484745 AAGTGTGTTGTGAGGCAGTGTGG - Intronic
1128389985 15:67176221-67176243 AATTCTGCACTGAGGCAGTGAGG + Intronic
1128740099 15:70077883-70077905 AGCTGGGCAGTTTGGAAGTGGGG - Intronic
1128756005 15:70184483-70184505 AGCTCAGCAGTCAGGCAGAGCGG + Intergenic
1128980773 15:72184153-72184175 AACAGGGCAGTGAGGCCGTGGGG - Intronic
1129680699 15:77656934-77656956 AGCTGTGCAGTGAGGGAGCAAGG + Intronic
1130131003 15:81142682-81142704 GGCTGTGCTGTGAGGCACTATGG - Intronic
1130647454 15:85741437-85741459 AGCTGCGCCGGGAGGCAGAGCGG + Exonic
1131085431 15:89572127-89572149 AGGAGGGCAGTGGGGCAGTGGGG - Intergenic
1131942323 15:97581015-97581037 AGCTTTGGACTGAGACAGTGGGG + Intergenic
1132279805 15:100602823-100602845 AGAGGTGCAGGGAGGCAGGGAGG - Exonic
1132283475 15:100641521-100641543 AGATGTGCAGAGATGAAGTGAGG - Intronic
1132327806 15:100986324-100986346 AGCTGAGCAGGGAGGAAGAGGGG + Intronic
1133030360 16:3007991-3008013 AGGTGGGCAGTGAGCCCGTGAGG + Intergenic
1135613617 16:23890256-23890278 AGGTTTGCAGAGAGGCAGTGAGG - Intronic
1138712578 16:58986306-58986328 AGCGGTGCAGTGCAGCAGTGAGG + Intergenic
1138810318 16:60141264-60141286 ATCTGTGCAGCAAGGCATTGTGG + Intergenic
1139406696 16:66724745-66724767 GACTCTGCAGTGAGACAGTGAGG + Intronic
1139631416 16:68234149-68234171 AGCTGGGCAGGCAGGAAGTGAGG + Intronic
1139967928 16:70755916-70755938 AGCTGTGCTGTGAGGAATGGTGG - Intronic
1142551271 17:741512-741534 TGCTGTGCAGGAAGGCAGTCCGG + Exonic
1143037353 17:4007044-4007066 AGCTGAGCACTGAGGATGTGGGG + Intronic
1144486944 17:15674522-15674544 AGGTGTGCGGTGGGGCAGTGTGG - Intronic
1144914085 17:18707778-18707800 AGGTGTGCGGTGGGGCAGTGTGG + Intronic
1145224600 17:21117348-21117370 AGCTGTGCAGTGATGCTGGAGGG - Intergenic
1146564505 17:33900799-33900821 AGCTGTGCTGTGAGCCACAGTGG + Intronic
1148247463 17:46043454-46043476 ACCTGTGAAATGAGGCAGTGGGG + Intronic
1148693960 17:49548193-49548215 TGCAGAACAGTGAGGCAGTGGGG - Intergenic
1148778542 17:50109260-50109282 AGCGGGGCAGGAAGGCAGTGAGG - Intronic
1149660529 17:58332080-58332102 AGCAGGGCAGTGAGGGAGTCAGG - Intergenic
1150295532 17:64005433-64005455 AGCTGTCCATTGAGGCAGTCTGG + Intronic
1150325818 17:64256470-64256492 TGCTGTGCAGAGGGGCAGAGAGG - Intronic
1150650250 17:67005442-67005464 ACCTGTGCAGTGATTCAGAGGGG - Intronic
1151075627 17:71269015-71269037 GACTGGGTAGTGAGGCAGTGAGG - Intergenic
1151166719 17:72210000-72210022 CCCTCTGCAGTGAGGCAGGGAGG - Intergenic
1151214676 17:72569410-72569432 AGCTGGGGAGGGAGGCCGTGGGG + Intergenic
1151618858 17:75232748-75232770 TGCGGTGGAGTGAGGCTGTGAGG + Intronic
1151972057 17:77463019-77463041 AGCTGAACAGTGAGCCCGTGGGG + Intronic
1152667066 17:81577256-81577278 AGCTGTGCGGACAGGCAGTCTGG - Intronic
1152708044 17:81855504-81855526 AGCTGCGCCGTCAGGCAGGGTGG + Exonic
1152892803 17:82892026-82892048 ACCTGTGCAGGGGGGAAGTGGGG - Intronic
1153456779 18:5291575-5291597 AGCTGGGGAGTGAGGAAGTTCGG - Exonic
1153501678 18:5756118-5756140 AGATGTGCAGTAAGACAGTAAGG - Intergenic
1153984383 18:10339957-10339979 AACTGTGGTGTGAGGCAGTCTGG + Intergenic
1154310582 18:13263481-13263503 AGCTGTGCAGTGAGGCAGGCAGG + Intronic
1154411367 18:14143835-14143857 TGCTGTCCAGTGAGGCAGGAGGG + Intergenic
1156077550 18:33299190-33299212 AGCTTTGTAGTCAGGTAGTGTGG - Intronic
1157319799 18:46625217-46625239 AGCTGTGGAATGGGGCCGTGTGG - Intronic
1157831411 18:50860040-50860062 AGCTGTGCAGTAAGGGAGACAGG - Intergenic
1159232450 18:65627063-65627085 AGCTGTGCACTGAGGAAATGGGG + Intergenic
1160017857 18:75158005-75158027 CGCTGTGCAGTGAGGGAGCCTGG - Intergenic
1160719716 19:591783-591805 AACTGGGCAGGGAGGCTGTGGGG + Intronic
1161276852 19:3423301-3423323 AGCAGAGCTGGGAGGCAGTGAGG - Intronic
1161335187 19:3709082-3709104 AGCTTTGCAGGGAGGGATTGGGG + Intronic
1162464009 19:10830119-10830141 CGCTGTGGAGTGGGGCTGTGAGG - Exonic
1162523442 19:11194791-11194813 AGATGTGCAAGCAGGCAGTGAGG - Intronic
1163083516 19:14961941-14961963 AGCTGGGAAGTCAGGCTGTGGGG - Intronic
1163633293 19:18427653-18427675 ATCTGGGCAGGGAGGGAGTGGGG - Intronic
1164855054 19:31514153-31514175 AGCTGTGCAGAGAGCCGGAGGGG + Intergenic
1165091095 19:33388802-33388824 GGGTGTGCACTGGGGCAGTGTGG - Intronic
1165416003 19:35693948-35693970 AGCCCTGGAGTGAGGCAGAGGGG - Intergenic
1166122577 19:40694266-40694288 AGCTGTGGAGAGGGGCAGAGGGG - Intronic
1166719624 19:44989633-44989655 AGCTCTGCACTCAGGGAGTGAGG - Intronic
1167287921 19:48609209-48609231 AGCTGTGCTGTGACCCTGTGAGG + Intronic
1167380338 19:49134606-49134628 AGAGGTGAAGTGAGGGAGTGAGG - Intronic
924988393 2:290009-290031 AGCTGGGCGGGGAGGCAGCGTGG + Intergenic
925001709 2:408013-408035 AGGTGTGGAGTGTGGAAGTGTGG + Intergenic
925840789 2:7990039-7990061 AGCCCTGCAGTGAGCCAGGGTGG - Intergenic
926018665 2:9475409-9475431 AGCAAAGCAGTGAGGCGGTGTGG + Intronic
926161615 2:10493892-10493914 AGCCATCCAGGGAGGCAGTGAGG + Intergenic
926290736 2:11527656-11527678 AGCTATTCAGTGAGGCAGCCAGG + Intergenic
926751404 2:16201456-16201478 TGCTGTTCAGTGAAGCTGTGTGG - Intergenic
927212942 2:20649848-20649870 GGCTGTGCAGCGGGGCAGGGAGG + Intronic
928446167 2:31335461-31335483 AATTTTGCAATGAGGCAGTGGGG - Exonic
930857347 2:56033129-56033151 CCCTGTTCAGTGAGGCAGCGTGG + Intergenic
931228358 2:60352935-60352957 ACCTGGTCCGTGAGGCAGTGTGG - Intergenic
931265465 2:60656330-60656352 TGCTGTGCTGTGAGGCATTATGG - Intergenic
931845183 2:66196319-66196341 TGATGTGCAGTGTGGCTGTGAGG + Intergenic
932619699 2:73258372-73258394 AGCAGTACAGTGGGGTAGTGGGG - Exonic
934564548 2:95331032-95331054 AGCTGTCCAGGCAGGCAGAGGGG + Intronic
936088726 2:109487650-109487672 AGCTGGGCAGTGAGGCAGCAGGG + Intronic
936947344 2:117942455-117942477 AGCAGTTCAGTGGGGCACTGGGG - Intronic
937139883 2:119590813-119590835 AGGAGTACAGTGAGGCAGGGAGG - Intronic
937206203 2:120238681-120238703 AGGAGTACGGTGAGGCAGTGGGG + Intergenic
937228808 2:120384912-120384934 GCCTGTGCACAGAGGCAGTGTGG + Intergenic
938951529 2:136259112-136259134 ATGTGGGCAGTGAGGCAGTAAGG - Intergenic
939669341 2:144990779-144990801 AGCTTTGCTGTGAGCCAGTCAGG + Intergenic
940236413 2:151515546-151515568 AGGTGGGCAGTGAGGCACAGAGG + Intronic
940303428 2:152200272-152200294 GGCTCTGCAGTCAGGCTGTGCGG - Intergenic
940581783 2:155589084-155589106 AGGTGTTCAGTGAGGCATTCAGG - Intergenic
941072866 2:160974193-160974215 AGCTGTGCATTGGGCCACTGTGG - Intergenic
941380200 2:164783505-164783527 AGCAGTTCAGTGAATCAGTGTGG + Intronic
943647667 2:190424816-190424838 AGCTGTGCATTAAGACCGTGTGG - Intronic
944513480 2:200487501-200487523 AGCTTTTCAGTGATGCTGTGTGG + Intergenic
945217360 2:207447906-207447928 AACTGTTCATTGAAGCAGTGAGG - Intergenic
945466924 2:210180866-210180888 TGCAGTGAAGTGGGGCAGTGTGG + Intergenic
948310225 2:236980036-236980058 ACCTATCCAGTGAGGCTGTGAGG - Intergenic
948321903 2:237076461-237076483 AGCCAGGCAGTGAGGGAGTGAGG - Intergenic
948874169 2:240818554-240818576 GGCTGTGGAGTGGGGCAGTCAGG - Intronic
948888548 2:240896053-240896075 AGCTGTGCAGATGGGCTGTGAGG + Exonic
1168869901 20:1119080-1119102 AGCTGTGCCGTGAGGGACTCTGG - Intronic
1168896605 20:1328155-1328177 AGTTGTGCAGAGAGGGAGTAAGG + Intronic
1168968882 20:1917281-1917303 ACCTGTGTGGTGAGCCAGTGGGG + Intronic
1169730899 20:8784598-8784620 GGCTGTGTAGTAAGGCACTGTGG + Intronic
1172031939 20:31988390-31988412 ACCTGTTCACAGAGGCAGTGGGG + Intronic
1173659706 20:44724855-44724877 CGCTGTGCAGCGAGGATGTGCGG + Exonic
1175689785 20:61057036-61057058 AGCTCTGCAGTGTGGCTGAGAGG - Intergenic
1175889113 20:62308300-62308322 AGCTGAGCAGTGTGGCTCTGGGG + Intronic
1176861690 21:14014582-14014604 TGCTGTCCAGTGAGGCAGGAGGG - Intergenic
1176987878 21:15458536-15458558 AGGTGAGCAGTGTTGCAGTGAGG - Intergenic
1177634797 21:23773506-23773528 AGATGTCCAGTCAAGCAGTGGGG + Intergenic
1177975565 21:27845446-27845468 AGCTTTGCAATGAGGGAGGGTGG + Intergenic
1178627744 21:34232517-34232539 AGCTGTGGAATGCTGCAGTGAGG - Intergenic
1179769807 21:43606131-43606153 AGCAGAGCAGGGAGGCCGTGAGG + Intronic
1181107217 22:20582497-20582519 AGGTGTGTGGTGAGGCTGTGCGG + Intronic
1181691484 22:24564518-24564540 ATGTGTGCAGTGAGACTGTGGGG + Intronic
1181952117 22:26562079-26562101 ATCTGTGGATTGAGGCTGTGTGG - Intronic
1182271863 22:29158869-29158891 AGCTGAGCAGTGAGCCAGCCTGG - Intronic
1182359649 22:29739062-29739084 TGAGGTGCAGGGAGGCAGTGAGG + Intronic
1183345853 22:37307323-37307345 AGCTGTGCAGGGGGGCAGACGGG - Intronic
1183391726 22:37549144-37549166 AGCTGTGGAGTAAGGCAGGCAGG + Intergenic
1183481877 22:38069648-38069670 AGCTCTGCAGTGTGCCTGTGGGG + Intronic
1184103807 22:42355705-42355727 CCCTGTGCAGTGCTGCAGTGGGG - Intergenic
1184740937 22:46428776-46428798 AGCTGTGCAGTGAGGCAGTGAGG - Intronic
1184747664 22:46465440-46465462 AGCTGGGCAGGGAGCCAGAGAGG + Intronic
1185366847 22:50440780-50440802 TGCTGTCCAGTGAGGCAGGAGGG - Intronic
949924753 3:9032284-9032306 AGGTGTGAAGTGAGGGAATGGGG + Intronic
950136173 3:10582583-10582605 AGGTCTGCAGTTGGGCAGTGAGG + Intronic
950252161 3:11474895-11474917 AGCAGTGCAGTGAATTAGTGGGG + Intronic
950335273 3:12188263-12188285 GTCTGTGCAGTGGGGCAGTGTGG - Intronic
950487140 3:13280613-13280635 GGGTGAGCAGTGAGGCTGTGGGG - Intergenic
950733082 3:14979730-14979752 AGCAGTGCAGGGAGGGAGGGAGG + Intronic
951017985 3:17750170-17750192 AAATGTGTAGTGAGGCAGTCTGG - Intronic
953280232 3:41547861-41547883 AGCATTGCAGTGAGCCAGGGAGG + Intronic
954924750 3:54223459-54223481 AGGAGTGGAATGAGGCAGTGGGG + Intronic
954964783 3:54600645-54600667 CGGTGTGCTGTGAGGCAATGAGG + Intronic
955575919 3:60363241-60363263 AGCTGGGGAGTGATTCAGTGGGG - Intronic
955992541 3:64643145-64643167 AAATGCGCACTGAGGCAGTGGGG + Intronic
956726679 3:72162346-72162368 AGCGGTGCAGAGAAGCAGGGTGG - Intergenic
962854301 3:139330165-139330187 AGGTGTGAGGTGAGGCTGTGGGG - Intronic
965833469 3:172825247-172825269 AGCTGTTCAGTGGAGCAGTCAGG - Intergenic
966933655 3:184691674-184691696 AGTTGTGCAGCGTGGCCGTGAGG - Intergenic
967592939 3:191299650-191299672 AGCAGTGCAGAGGGGAAGTGTGG + Intronic
968702277 4:2062734-2062756 GGCTGTGCAGAGGGGCAATGGGG + Intronic
969475653 4:7421186-7421208 GGCTCTGCAGTGAGTCAGAGGGG + Intronic
969600803 4:8175143-8175165 AGCTGTGAAGTGGGTCAGGGTGG - Intergenic
970429026 4:15971743-15971765 AGCACTGCAGTGAGGCACGGTGG - Intronic
970477703 4:16440445-16440467 AGCTGTGCTGTGAGACAGCTCGG - Intergenic
970646594 4:18128526-18128548 AGCTGTGCAGTTTGGCAGGTAGG - Intergenic
971351969 4:25863068-25863090 GGCTGGGCAGGGAGGCAGAGGGG - Intronic
972922322 4:43959387-43959409 AGCTCTGTAGTCAGGCAGAGAGG - Intergenic
974463362 4:62219998-62220020 AGGTGAGCAGTGTGGCGGTGTGG + Intergenic
975041331 4:69747426-69747448 GGCTGTGCACTAAGCCAGTGTGG + Intronic
975044187 4:69782787-69782809 AGCAGTGCAGTCAGGAAGAGAGG + Intronic
975394017 4:73853884-73853906 AGTTGGGCAGTGGGGCAGTGGGG - Exonic
975405212 4:73981420-73981442 AGTTGGGCAGTGGGGCAGTGGGG + Exonic
977406214 4:96602700-96602722 AGCCGTGCATATAGGCAGTGTGG - Intergenic
980209526 4:129768559-129768581 AGCTATTAAGTGAGACAGTGGGG - Intergenic
981191724 4:141872295-141872317 GGCAGTGCAGTGGGGAAGTGTGG - Intergenic
981447310 4:144854847-144854869 AGGAGTGCAGGGAGGTAGTGGGG + Intergenic
982730140 4:158947017-158947039 AGCTGAGCAGTGGGGGAGTAGGG - Intronic
983935131 4:173497310-173497332 AGGTAGGCAGTGAGGCAGTGTGG - Intergenic
985511227 5:315357-315379 CGCTGCACAGTGAGGCAGGGAGG - Intronic
985632414 5:1020937-1020959 AGCCCTGTAGTGAGGGAGTGAGG + Intronic
985803367 5:2020917-2020939 CGCCGTGCAGAGAGGCCGTGTGG + Intergenic
986034294 5:3923509-3923531 AGGTGTGCAGGGAGACAGTGGGG + Intergenic
989003713 5:36787197-36787219 AGCTGTGAGGTGAGGGAGTTGGG + Intergenic
990021544 5:51133503-51133525 AGCTGAGTAATGAGGCAGTAAGG + Intergenic
992189895 5:74281384-74281406 AGCTGGGCAGTGACTCAGAGAGG - Intergenic
993145768 5:84091576-84091598 AGGTTTTCAGTGAGGCACTGGGG + Intronic
993630646 5:90282085-90282107 ATCTTTTCACTGAGGCAGTGGGG - Intergenic
994141508 5:96346872-96346894 AGGTGTGAATTGAGGCACTGCGG + Intergenic
994399210 5:99257669-99257691 AAATGTGCAATGAGGCAGAGGGG + Intergenic
995700009 5:114924975-114924997 AGCTGTGCACTGGGGGAATGGGG + Intergenic
995997894 5:118322905-118322927 AGCTGCACAGAGAAGCAGTGGGG + Intergenic
996117356 5:119633362-119633384 TGGTGTGCAGTCAGGCAGTCAGG + Intronic
998163468 5:139826870-139826892 AGCAGTGAAGTGTGGCTGTGAGG - Intronic
998802678 5:145886322-145886344 AGCTCTGCTCAGAGGCAGTGAGG - Intergenic
999101538 5:149029560-149029582 AGCAGGGGAGTGAGGGAGTGAGG + Intronic
999260505 5:150235666-150235688 GCCTGTGCAGTGAGCCAGAGGGG + Intronic
1000233533 5:159336670-159336692 AGCTGTGGACTGAGTAAGTGAGG + Intergenic
1001032401 5:168272368-168272390 ATGTGTGGAGTGAGGGAGTGGGG - Intergenic
1001072446 5:168598717-168598739 AGCTATGCTGAGAGGCCGTGTGG + Intergenic
1002052348 5:176578148-176578170 ATCTCTGCAGAGAGGCAGAGAGG - Intronic
1002595958 5:180323363-180323385 GGCCGTGCTGTGAGGCAGGGAGG - Intronic
1003195173 6:3908010-3908032 AGCTGAGCAGTGTTTCAGTGAGG + Intergenic
1004881081 6:20009188-20009210 TTCTGTGCAGTGAGGCAGTTGGG - Intergenic
1006575480 6:35042246-35042268 AACTTAGCAGTAAGGCAGTGAGG + Intronic
1007556749 6:42772658-42772680 CCCTGGGCAGTGAGGCAGTGAGG + Intronic
1007625552 6:43244220-43244242 AGGTGTGGAGGGAGGCAGAGGGG - Intronic
1007749611 6:44063925-44063947 ATGGGTGCAGTGATGCAGTGAGG + Intergenic
1010630512 6:78192144-78192166 CGCTGGGCAGTGGGGCAGTGGGG + Intergenic
1013461381 6:110378162-110378184 AGCAGTGCGCTGGGGCAGTGTGG + Intergenic
1014263010 6:119241342-119241364 AGCCGTTCAGTGAGGCAGCCAGG - Intronic
1016738186 6:147502944-147502966 AGCTTTGGAGCAAGGCAGTGTGG - Intergenic
1017068554 6:150551854-150551876 AGCTGTTCAGTGAGGAATTAGGG + Intergenic
1017215423 6:151901118-151901140 GGCTGTGCTGTGGGGCAGGGGGG + Intronic
1017515081 6:155149152-155149174 AGCTCTGCATGGAGGCAGGGTGG + Intronic
1018757834 6:166864844-166864866 AGCAGTGCAGGGAGTAAGTGTGG - Intronic
1019525786 7:1479850-1479872 ACCTGTGATGTGAAGCAGTGAGG + Intronic
1019702463 7:2480533-2480555 AGCTCTGCAGAGGGGCAGCGGGG + Intergenic
1020839232 7:13194668-13194690 AGCAGTGCAGTGTAGCAGTTAGG + Intergenic
1022103306 7:27181956-27181978 GGCTGTGGAGTGTGGCAGTTTGG - Exonic
1022727767 7:32996453-32996475 AGCTATGCAGTGGGGCAGCATGG - Intronic
1025045818 7:55691188-55691210 AGCTATGCAGTGGGGCAGCATGG + Intergenic
1025247631 7:57329020-57329042 TGCTGTGCTGTGAGCCACTGTGG - Intergenic
1026928607 7:74210512-74210534 GGCTGGGCAGGGAGGCAGTGGGG - Intronic
1027160816 7:75800803-75800825 AGCTCTGCTGGGAGGCAGAGGGG - Intergenic
1027233772 7:76286263-76286285 AGCTGTGTAGTGCGGAAGAGGGG - Exonic
1028967889 7:96823033-96823055 GGCTGTGCACTGGGGCAGTCAGG - Intergenic
1029274200 7:99394432-99394454 AGCTCTGCAGGGAGGCAGAACGG - Exonic
1030124870 7:106144145-106144167 AGCTGTGCAGCCCTGCAGTGGGG - Intergenic
1030502998 7:110383762-110383784 AGCTGTACTGAGAGACAGTGGGG - Intergenic
1034709642 7:153179703-153179725 AGCTGTGCATTCTGGCATTGGGG + Intergenic
1035524643 8:302942-302964 AGCTATGAAGGGAGGCAGCGGGG - Intergenic
1035826448 8:2649185-2649207 AGGTGTGCACTGAGGCAGGCTGG - Intergenic
1035872872 8:3154607-3154629 TGCGGTGCAGTGAGACAGGGAGG + Intronic
1036186555 8:6627309-6627331 AGCTGTGGAGAGTGGCAGAGAGG + Intronic
1036222732 8:6934275-6934297 AGCTGTGAAGTGTCTCAGTGGGG + Intergenic
1036234447 8:7026213-7026235 AGCTGTGCATTGTCTCAGTGGGG + Intergenic
1036235541 8:7036399-7036421 AGCTGTGTAGTGTCTCAGTGGGG + Intergenic
1036243932 8:7100898-7100920 AGCTCTGGAGGGGGGCAGTGCGG + Intergenic
1036256867 8:7213153-7213175 AGCTCTGGAGGGGGGCAGTGCGG - Intergenic
1036308917 8:7671752-7671774 AGCTCTGGAGGGGGGCAGTGCGG - Intergenic
1036360622 8:8074359-8074381 AGCTCTGGAGGGGGGCAGTGCGG + Intergenic
1036707352 8:11055550-11055572 TGCTGTGCTGTGAGGCGGGGCGG - Intronic
1036890348 8:12592607-12592629 AGCTCTGGAGGGGGGCAGTGCGG - Intergenic
1037640695 8:20739964-20739986 AGCTGTGAAGTGAAGCACTTGGG - Intergenic
1039107901 8:34009207-34009229 ATCTGTGCAGTGACCAAGTGTGG + Intergenic
1039339039 8:36626749-36626771 AGCAGTGCATGGAGGCACTGAGG + Intergenic
1040388828 8:46932804-46932826 AGCTGTGGAATGTGGCAGTGAGG - Intergenic
1041568786 8:59312166-59312188 AGCTGTACAGTGGGGCAGGAGGG - Intergenic
1041893278 8:62895788-62895810 AGTTTTGCAGAGAGGGAGTGGGG - Intronic
1042570990 8:70164592-70164614 ATCTGTCCAAGGAGGCAGTGTGG - Intronic
1042648496 8:71013411-71013433 GGCTGGGTATTGAGGCAGTGCGG + Intergenic
1043877305 8:85500128-85500150 AGCTTTGCAGCCAGGCACTGTGG - Intergenic
1045184080 8:99818260-99818282 AAATGTGCAGTGAGTCAGCGGGG - Intronic
1045971653 8:108085112-108085134 AGCTTTGCAAGGAGGCAGGGGGG - Intergenic
1048129270 8:131675810-131675832 AACTGCAAAGTGAGGCAGTGAGG - Intergenic
1048996289 8:139795546-139795568 AGCTGGGCAGGGAGGGGGTGGGG + Intronic
1049023164 8:139971298-139971320 AGCTGTTCAGGGTGGGAGTGAGG - Intronic
1049239130 8:141528037-141528059 ATCTGTGCAGCCAGACAGTGGGG + Intergenic
1050740081 9:8809987-8810009 AGCTGTGTAGTAAGACAATGTGG + Intronic
1051743014 9:20269383-20269405 AGCTGAGGAATGAGGCACTGGGG - Intergenic
1052404460 9:28041898-28041920 ATCTTTGCAGTGAGTCAATGAGG + Intronic
1053133587 9:35634757-35634779 AACTGTGGAGTCAGGCGGTGGGG - Intronic
1054793064 9:69273841-69273863 AGCTGCAGAGTGAGGCAGTGAGG - Intergenic
1057704449 9:97387385-97387407 AGCTGGGCAGCGAGGCAGCTGGG + Intergenic
1057767116 9:97931299-97931321 ACTTGTGCAATGAGGCAGTGGGG - Intronic
1058893501 9:109381141-109381163 AGCGGGGCAGTGAAGCGGTGTGG - Intronic
1059350108 9:113658458-113658480 CGCTGGGCAGTGGGGCACTGGGG - Intergenic
1060512331 9:124243047-124243069 GGCTGTGCAGAGAAGCAGTCTGG - Intergenic
1061188552 9:129069160-129069182 AGCTGGGCTCTGAGGCAGCGTGG + Intronic
1061272147 9:129549809-129549831 AGCAGGGGAGTGACGCAGTGCGG + Intergenic
1061316793 9:129801485-129801507 AGCTGGGCACTGAGGGAGTTAGG - Intergenic
1061514111 9:131078784-131078806 CACTTTGCAGTGGGGCAGTGTGG + Intronic
1061743537 9:132723991-132724013 AGCAGGGCAGGGAGGCAGTGTGG + Intergenic
1062246261 9:135568108-135568130 AGCTGGGCAATGAGACAGTAAGG - Intergenic
1062463711 9:136672204-136672226 AGCTGGGCGGGGAGGCTGTGGGG + Intronic
1186439003 X:9568538-9568560 ATCTGTGCAGTGTGTCTGTGTGG + Intronic
1187397780 X:18933251-18933273 CGGTGTGCAGAGAGGCAGAGGGG - Intronic
1190426762 X:50340581-50340603 AGCTGTGCATTCTGGCTGTGGGG + Intronic
1193437795 X:81499776-81499798 ATGTGTGCAATGAGGCAGAGAGG + Intergenic
1193611329 X:83634910-83634932 AGCAGTGCAGTCAGGCATTCGGG - Intergenic
1196887868 X:120264500-120264522 AGCTGTCCAGTGAGGAAGCTTGG - Intronic
1198226514 X:134650467-134650489 TGCTGGGCTGTGATGCAGTGAGG - Intronic