ID: 1184740938

View in Genome Browser
Species Human (GRCh38)
Location 22:46428784-46428806
Sequence CGTGAGTGAGCTGTGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184740938_1184740948 16 Left 1184740938 22:46428784-46428806 CCTCACTGCACAGCTCACTCACG 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1184740948 22:46428823-46428845 CACTGCCTGGTGTCCATGTCAGG 0: 1
1: 0
2: 3
3: 11
4: 185
1184740938_1184740942 -10 Left 1184740938 22:46428784-46428806 CCTCACTGCACAGCTCACTCACG 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data
1184740938_1184740944 3 Left 1184740938 22:46428784-46428806 CCTCACTGCACAGCTCACTCACG 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1184740944 22:46428810-46428832 CCCCAGCGGGCCACACTGCCTGG 0: 1
1: 1
2: 1
3: 17
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184740938 Original CRISPR CGTGAGTGAGCTGTGCAGTG AGG (reversed) Intronic
900115988 1:1028127-1028149 CGGGAAGGAGCTGTGCATTGAGG + Intronic
900658444 1:3771716-3771738 TGTGAGTGAGCTTTGGAATGGGG - Intergenic
900792350 1:4688944-4688966 TGTGAGTGAGCAGGGCAGGGTGG - Intronic
904395469 1:30218351-30218373 TGGGAGTGAGCACTGCAGTGTGG - Intergenic
904438144 1:30512648-30512670 GGTCAGTGGGCAGTGCAGTGAGG - Intergenic
907351812 1:53838183-53838205 CGTGAGTGCGGCGTGCACTGTGG - Exonic
910231202 1:84988873-84988895 GGTGAGTGAAATGTGCAGAGCGG - Intronic
911573371 1:99544616-99544638 GGTGAGTGTGCTGTGCAGATGGG - Intergenic
912755651 1:112322690-112322712 TGTGACTGAGCTCTGCACTGTGG - Intergenic
912933806 1:113985885-113985907 CATGAGTGATCTGTGCATTAAGG - Intergenic
915586177 1:156845186-156845208 CGTGAGCGAGCGGTGCTGAGCGG - Exonic
915741989 1:158125753-158125775 GGTGACTGAGCTGTGGAGGGGGG - Intergenic
916354474 1:163889358-163889380 CTTGTGCAAGCTGTGCAGTGAGG - Intergenic
917771881 1:178288473-178288495 TGTGATTGAGCTGTCCACTGTGG + Intronic
918907085 1:190510677-190510699 GGTGAGTGAGCTGGGCATGGTGG + Intergenic
919258720 1:195160917-195160939 GGTGGGAGAGCTTTGCAGTGAGG + Intergenic
920356019 1:205373379-205373401 CATGATTGAGCTGTGCACCGAGG + Intergenic
920439920 1:205973125-205973147 TGTGTGTGTGGTGTGCAGTGTGG - Intergenic
920439949 1:205973475-205973497 AGTGTGTGTGGTGTGCAGTGAGG - Intergenic
921741283 1:218687858-218687880 CATCAGAGAGCTCTGCAGTGAGG + Intergenic
922916369 1:229260882-229260904 GGTGGGTGGTCTGTGCAGTGGGG + Intergenic
1064353246 10:14596045-14596067 AGGAAGAGAGCTGTGCAGTGGGG - Intronic
1067063969 10:43093369-43093391 GGTGTGTGACCTGAGCAGTGAGG + Intronic
1067211251 10:44261778-44261800 GGTGAGTGAGGTGTGCAAGGTGG - Intergenic
1067282433 10:44882436-44882458 TGCTAGAGAGCTGTGCAGTGTGG - Intergenic
1071566862 10:86675561-86675583 CGTGAGAGAGCCTTGCTGTGGGG + Intronic
1072405129 10:95144365-95144387 ACTCAGTGATCTGTGCAGTGTGG - Intergenic
1073185336 10:101612315-101612337 GGTGAGTGTGCTGGGCAGGGAGG - Exonic
1076807941 10:132868444-132868466 CGTGAGTTATCTGTGCAGCCCGG - Intronic
1076847236 10:133075330-133075352 CCTGACTGGGCTGTGCTGTGTGG - Intronic
1077998656 11:7475471-7475493 CTTGTGTGAGCCATGCAGTGTGG - Intergenic
1078625059 11:12947894-12947916 AGTGAGTGGGCTGTGCTGTTGGG - Intergenic
1083095193 11:60243053-60243075 ACTGAGTGAGGTGTGGAGTGGGG - Intronic
1083098655 11:60280599-60280621 ACTGAGTGAGGTGTGGAGTGGGG + Exonic
1083991994 11:66252035-66252057 CAAGCGTGAGCTGTGTAGTGTGG - Intergenic
1084488947 11:69467753-69467775 CGTGAGTAGGCGGTGCGGTGGGG + Intergenic
1084760591 11:71268229-71268251 GCTGAGGGAGCTGTGCAGGGGGG - Intergenic
1084772806 11:71354963-71354985 CGTGAGTGAACTGGGCAGTTTGG - Intergenic
1084946229 11:72640146-72640168 TGTGAGTGTGGTGTGAAGTGAGG - Intronic
1088969363 11:114759036-114759058 TGTGTGTGTGCTGTGGAGTGTGG - Intergenic
1089638355 11:119831144-119831166 GTTGAGGGAGCTGTGCAGGGCGG + Intergenic
1090061686 11:123469159-123469181 CGTGAGGGAGCTGGGTAGAGAGG + Intergenic
1097145763 12:56938427-56938449 CGTGAGTGAGCTGTGGACAGTGG - Intergenic
1097151324 12:56981965-56981987 CGTGAGTGAGCTGTGGACAGTGG - Intergenic
1097901354 12:64876621-64876643 GGTGAGTGAGCTGTGTGGTGGGG - Intronic
1101838327 12:108310628-108310650 CTTGAGTGAGCGGAGGAGTGAGG + Intronic
1103557492 12:121775266-121775288 CGTGTGTGTGGTGTGCTGTGGGG + Intronic
1103982684 12:124746709-124746731 TGTGAGTGGGCAGTGCAGTGAGG - Intergenic
1104637564 12:130447652-130447674 AGTGGGTGAACTGTGCAGTGAGG + Intronic
1104691882 12:130832734-130832756 CGTGAGTGAGCTGAGGAGGTTGG - Intronic
1106132295 13:26950651-26950673 CGTGTGTGTGCTGTGGGGTGGGG - Intergenic
1107614261 13:42148488-42148510 CATGAGTTAGGGGTGCAGTGAGG - Intronic
1108865733 13:54920150-54920172 CATGAGTGATCTGTGCCTTGAGG - Intergenic
1112128916 13:96499706-96499728 CGTGTGTGACCTGTGCAATGAGG + Intronic
1112134019 13:96555512-96555534 CCTTAGTGAGCTCTGCAGTAAGG - Intronic
1112312107 13:98328089-98328111 CCTGTGGGGGCTGTGCAGTGAGG - Intronic
1113801179 13:113087134-113087156 CGTGGGTGGGCTTTGCAGAGTGG + Intronic
1114566332 14:23635821-23635843 GGTGAGTGCCCTGTACAGTGTGG - Intronic
1122369431 14:101221179-101221201 CCAGTGTGAGCTGTGCAGTTCGG - Intergenic
1124860651 15:33436966-33436988 GGTGTGTGAGTTGTGAAGTGGGG + Intronic
1124941134 15:34219268-34219290 GGTGATTCTGCTGTGCAGTGAGG - Intergenic
1126556262 15:49991093-49991115 CATGAGTCAGCTGTGCTGTTGGG + Intronic
1128398751 15:67255105-67255127 CGGGAGTGTGCTGGGCCGTGGGG - Intronic
1128717066 15:69916538-69916560 CCTGGGTCAGCTGTGTAGTGTGG - Intergenic
1129156659 15:73722405-73722427 CATCAATGAGCTGAGCAGTGGGG + Intergenic
1129323851 15:74789333-74789355 CCTGAGACACCTGTGCAGTGGGG + Intronic
1129680697 15:77656926-77656948 GGTCTCTGAGCTGTGCAGTGAGG + Intronic
1132619199 16:856381-856403 CGTGAGGGCGCTGGGCTGTGCGG + Intronic
1133221676 16:4321625-4321647 CCAGAGTGAACTGGGCAGTGAGG - Intronic
1133840674 16:9406531-9406553 CCTCACTGAGCTGAGCAGTGGGG + Intergenic
1136022848 16:27450923-27450945 CGTGACTCATCTGTGAAGTGGGG + Exonic
1136179040 16:28538400-28538422 GGTGAGTGGGCTGGGCAGGGTGG + Intronic
1138926804 16:61601910-61601932 TGTGAGTGAACTGGGCAGTTGGG + Intergenic
1140548479 16:75836063-75836085 CGTGAGTGAGCACAGCATTGCGG + Intergenic
1142420060 16:89964486-89964508 CGTGTGTGAGCTCTGCAGAGAGG + Exonic
1143880022 17:10022904-10022926 GGTGAGAGGGCTGGGCAGTGAGG + Intronic
1144384054 17:14732384-14732406 AGTGAGTGGGCTGTGCTTTGTGG + Intergenic
1145165971 17:20613816-20613838 CGTGTGTGAGCTCTGCAGAGAGG + Intergenic
1146599975 17:34205687-34205709 CTTGAGTTAGCTTTGCAGTAGGG - Intergenic
1147583297 17:41638665-41638687 GGTGAGTGAGGGGTGCAGAGGGG - Intergenic
1148620614 17:49031973-49031995 AGTGAGTGGGCTGGGAAGTGGGG + Exonic
1150951923 17:69812606-69812628 GGAGAGTGAGTTGTGCAATGAGG - Intergenic
1151522442 17:74640063-74640085 AGTGAGTCAGCTGTGCAGGGTGG - Intergenic
1153139526 18:1955149-1955171 GGTGAGGGAGCAGTGCAGTTGGG - Intergenic
1153329097 18:3854711-3854733 CCTGAGTGTGCAGTACAGTGTGG + Intronic
1154339689 18:13492712-13492734 CCTGAGTCACCTGGGCAGTGGGG + Intronic
1155327779 18:24682665-24682687 GTGGAGTGAGCAGTGCAGTGAGG + Intergenic
1156148781 18:34219801-34219823 CGTGAGTGTGCAGTGCAGGCGGG + Intronic
1159232447 18:65627055-65627077 CTTCAGGGAGCTGTGCACTGAGG + Intergenic
1159964804 18:74584760-74584782 CTTGAGGAAGGTGTGCAGTGGGG - Exonic
1160167702 18:76528819-76528841 TGTTTGTGAGCTGTGCAGAGTGG + Intergenic
1160171263 18:76557390-76557412 CATGAGTAGGCTGAGCAGTGAGG - Intergenic
1160877914 19:1305962-1305984 CGTGAGTGAGAGGTGCCCTGGGG - Intergenic
1161108610 19:2456380-2456402 CCTGAGTGAGCGGTGCAGTTCGG - Intronic
1161473653 19:4473185-4473207 CCTGAGGGAGCTGCGCCGTGGGG + Intronic
1162458740 19:10801977-10801999 CGTTACTGAGCTGTGGAATGGGG - Intronic
1164896540 19:31882074-31882096 TGGGAGGGAGCAGTGCAGTGGGG + Intergenic
1165221951 19:34323703-34323725 CGTGTGTGAGCTGAACAGTCAGG - Intronic
1165306084 19:35003773-35003795 TGTGAGTGAGGTGGCCAGTGGGG - Intronic
1165805766 19:38579884-38579906 CGAGAGTCAGCTGTGCCCTGGGG - Intronic
1165938030 19:39401363-39401385 GGTGGGTTAGCTCTGCAGTGGGG - Intergenic
1166304750 19:41931364-41931386 CGCGGGCGTGCTGTGCAGTGAGG - Intergenic
1167053847 19:47096422-47096444 TGTGGGTGAGGTGTCCAGTGAGG - Intronic
928407288 2:31024335-31024357 CGTGAGTGAGTTGTGCAGCCAGG - Intronic
933170696 2:79121680-79121702 TGTGAGTGAGGAGAGCAGTGTGG + Exonic
933172244 2:79137202-79137224 TGTGAGTGAGGAGAGCAGTGTGG - Intergenic
935598795 2:104901215-104901237 TGTCAGTGAGCTGTGAACTGTGG - Intergenic
938499162 2:131821537-131821559 CCTGAGGGAGCTGGGCACTGTGG + Intergenic
940545859 2:155084320-155084342 CGTGAGTAAACTGTACATTGTGG + Intergenic
940573837 2:155474468-155474490 CGTGAGTAAACTGTACATTGTGG + Intergenic
940765365 2:157784504-157784526 TGTGGGTGAGCTCTGCAGAGAGG - Intronic
947800517 2:232926703-232926725 CGCGGCTGAGCTGTGCAGCGGGG - Intronic
1170420560 20:16188897-16188919 AGTGTGTGTGCTGTGCAGTATGG + Intergenic
1170669311 20:18416080-18416102 CGTGAGGGTGCAGGGCAGTGTGG - Intronic
1172519396 20:35557265-35557287 CGTCTGTGAGCTGTGGGGTGGGG + Intronic
1175652104 20:60734301-60734323 CCTGGGTGAACAGTGCAGTGCGG + Intergenic
1176511297 21:7750570-7750592 AGTGAGTGAGCTGTGAAGGGTGG + Intronic
1178645411 21:34381099-34381121 AGTGAGTGAGCTGTGAAGGGTGG + Intronic
1179825009 21:43959430-43959452 CGTGTGTGTGGTTTGCAGTGTGG + Intronic
1180972977 22:19825162-19825184 CTTGTGTGAGATATGCAGTGGGG - Intronic
1181666822 22:24404319-24404341 CGTGAGTCAGGAGAGCAGTGCGG - Intronic
1181899883 22:26145023-26145045 CTAGATTGAGCTGTCCAGTGTGG + Intergenic
1181974781 22:26721089-26721111 CGTGAGTGTGTTGTGCGGTGGGG - Intergenic
1182662712 22:31936315-31936337 GGTGAGTGGGCGGTGCAGTGGGG - Intronic
1182761069 22:32722696-32722718 CTTGAGTCAGCTGTCCAGAGTGG - Intronic
1182785155 22:32901498-32901520 TGACTGTGAGCTGTGCAGTGAGG - Intronic
1183316372 22:37139168-37139190 CCTGAGGGTGCTGTGCCGTGAGG - Exonic
1183601975 22:38844889-38844911 TGGGAGTGGGCTGTGCTGTGGGG + Intergenic
1184740938 22:46428784-46428806 CGTGAGTGAGCTGTGCAGTGAGG - Intronic
1185146162 22:49137764-49137786 CAGGAGTGAGCTGAGCAGGGTGG - Intergenic
950783757 3:15415146-15415168 CGTGATTGAGCTATACATTGTGG - Intronic
950850508 3:16057787-16057809 CTTGAGTGAGATGTGTAGTAAGG + Intergenic
952497359 3:33927732-33927754 AGTGAGTGAGCTGAGCATTTGGG + Intergenic
952866884 3:37861052-37861074 CGGGAGTGATCTGTGCAGAGAGG - Intergenic
953879380 3:46683754-46683776 TGTGGGTGAGCTGTGAACTGCGG - Intronic
954297897 3:49684343-49684365 GGAGAGTGAGATGTGCACTGAGG - Exonic
956157872 3:66317640-66317662 AGTGGGTGTGCTGTGCTGTGGGG + Intronic
956446351 3:69329965-69329987 CATCAGTGAGCTATGCACTGTGG - Intronic
957434201 3:80152457-80152479 AGTGAGTGTGCTATCCAGTGAGG - Intergenic
957501467 3:81063768-81063790 CCTTAGTGAGCTCTGCACTGCGG + Intergenic
959892399 3:111570944-111570966 CTTGAGTGGGCTGTGCTCTGAGG + Intronic
960051164 3:113240890-113240912 CGGGAGTGGGCTGTCCAGTAGGG - Intronic
961522636 3:127475925-127475947 ATTCAGTGAGCTGTGCACTGAGG - Intergenic
962042136 3:131718443-131718465 CGTGGGTGAGCGGTCAAGTGAGG - Intronic
962685285 3:137841900-137841922 CGTGATGCTGCTGTGCAGTGAGG - Intergenic
966396593 3:179510231-179510253 AATGAGTGAGCTGGGCAGGGCGG - Intergenic
969066445 4:4485658-4485680 CGTGTGTGAGCTCTGGGGTGAGG - Intronic
969386050 4:6849128-6849150 GGTGAGTGAGCTGTGCTGGAGGG + Intronic
969628190 4:8319080-8319102 GGGCAGTGAGCTGTGTAGTGTGG - Intergenic
969728479 4:8939601-8939623 CGCGAGGAAGCTGGGCAGTGTGG - Intergenic
972716283 4:41649638-41649660 TGAGAGGGAGCTGTGCAGTTAGG - Intronic
973331326 4:48912870-48912892 GGAGAGAGTGCTGTGCAGTGTGG + Intergenic
974095606 4:57360543-57360565 CGTGAGTGATCTGTGCCTTAAGG + Intergenic
981027589 4:140092564-140092586 AGTGAGTGAGCAGTGCGGCGGGG - Intronic
982675480 4:158370537-158370559 GGGGAGAGAGATGTGCAGTGAGG - Intronic
985021191 4:185692258-185692280 TGTGAGTGTGTTGTGCTGTGCGG - Intronic
985650976 5:1107437-1107459 AGTGAGTGGGCCGTGGAGTGAGG - Intronic
986984668 5:13487046-13487068 CATGAGTTAGCTTAGCAGTGAGG - Intergenic
988929102 5:36018363-36018385 CGTGATTGGGCTGTTGAGTGAGG - Intergenic
990109904 5:52309920-52309942 CGTGAGTGATCTGTGCCTTAAGG + Intergenic
992254536 5:74908434-74908456 CATGAGTGAGCTGTGCTTTAAGG - Intergenic
996729888 5:126706727-126706749 CTTGAGTGAGCTGGGCTGGGTGG + Intergenic
996817666 5:127591694-127591716 CATGATTGAGAGGTGCAGTGGGG + Intergenic
1001083442 5:168683673-168683695 CGGGAGTGCGCGCTGCAGTGGGG - Intronic
1006470071 6:34223767-34223789 GGTGGGAGAGCTGAGCAGTGAGG - Intergenic
1010433672 6:75806692-75806714 CATGAGTGAGCTGTGCCTTAAGG + Intronic
1011755302 6:90492904-90492926 TGTGAGGGAGCTGTGCTCTGCGG + Intergenic
1012806636 6:103903131-103903153 CATGAGTGAGCTTGGAAGTGGGG - Intergenic
1016070504 6:139732986-139733008 TGTGAGTGAGAAGTGCAGTGTGG + Intergenic
1017835812 6:158176907-158176929 CGTGAGTGATCTGTGCCTTAAGG - Intronic
1017995729 6:159530235-159530257 CGTGTGAGCGCTGTGCTGTGAGG + Intergenic
1018130850 6:160731416-160731438 CGTGAGTGGGCTGTGCCTTTAGG + Intronic
1018717408 6:166544129-166544151 TGTGAGTGAGCTGGGGAGTAAGG - Intronic
1024461300 7:49662207-49662229 GGAAAGTGAGCTGTGCAGTCAGG - Intergenic
1025132948 7:56387184-56387206 CTGGAGTGAGCTGTGCAGGCAGG - Intergenic
1025173970 7:56787543-56787565 CGCGAGGGGGCTGTGGAGTGTGG - Intergenic
1029211569 7:98912970-98912992 TTTGATTGAGCTCTGCAGTGAGG + Intronic
1031450026 7:121904382-121904404 TATCAGGGAGCTGTGCAGTGGGG + Intronic
1034720888 7:153291436-153291458 CGTGTGTGGGCGTTGCAGTGTGG + Intergenic
1035876995 8:3201625-3201647 CGAGAGTGAGCTGAGAAGTCTGG + Exonic
1037904388 8:22706948-22706970 CGTAAGTCAGCTGGGCAGAGAGG - Intergenic
1038616842 8:29103325-29103347 CTGGAGTCAGCTGTGCATTGAGG - Intronic
1040761614 8:50852340-50852362 AGTGATAGAGCTGGGCAGTGTGG + Intergenic
1041761574 8:61373010-61373032 CATAAGTGAGCTGAGCATTGTGG - Intronic
1043300780 8:78728791-78728813 GGTGACTGTGCTGTGCATTGTGG - Intronic
1049741785 8:144244530-144244552 CATGATTGAGGTGTGCAGGGGGG + Exonic
1050292312 9:4167701-4167723 CGTGAGTGAGCTGTGGTATCAGG - Intronic
1052977965 9:34425674-34425696 AGTGAGTGGGCAGTGCACTGAGG + Intronic
1061922939 9:133792004-133792026 TGTGAATGAGCTGTGCTGGGTGG + Intronic
1061922978 9:133792282-133792304 TGTGAGCGAGCTGTGCTGGGTGG + Intronic
1061922983 9:133792331-133792353 TGTGAGTGAGCTGTGCTGGGTGG + Intronic
1189201586 X:39200847-39200869 CTAGAGAGAGCTGTGCACTGAGG + Intergenic
1189306213 X:39988635-39988657 CCTGAATGAGCTTGGCAGTGGGG - Intergenic
1189325124 X:40107164-40107186 CGGGAGGGGGCTGTGCAGTTGGG - Intronic
1193685368 X:84571409-84571431 TGTGAGGGAACTGTGCTGTGAGG + Intergenic
1199600296 X:149537738-149537760 CCTGGGTGTGCTGGGCAGTGGGG - Intergenic
1199650288 X:149942202-149942224 CCTGGGTGTGCTGGGCAGTGGGG + Intergenic
1200017656 X:153179049-153179071 CGGGAGTGAGCATTGGAGTGGGG - Intergenic
1200789548 Y:7287298-7287320 AGAGAATGAGCTGTGCATTGTGG - Intergenic