ID: 1184740942

View in Genome Browser
Species Human (GRCh38)
Location 22:46428797-46428819
Sequence CTCACTCACGGGTCCCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184740931_1184740942 28 Left 1184740931 22:46428746-46428768 CCCAGCAGCTCTGGGCCTCCTGG 0: 1
1: 0
2: 4
3: 59
4: 874
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data
1184740937_1184740942 -2 Left 1184740937 22:46428776-46428798 CCTCACTGCCTCACTGCACAGCT 0: 1
1: 0
2: 2
3: 33
4: 359
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data
1184740938_1184740942 -10 Left 1184740938 22:46428784-46428806 CCTCACTGCACAGCTCACTCACG 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data
1184740934_1184740942 13 Left 1184740934 22:46428761-46428783 CCTCCTGGCGCTCCACCTCACTG 0: 1
1: 0
2: 1
3: 35
4: 298
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data
1184740933_1184740942 27 Left 1184740933 22:46428747-46428769 CCAGCAGCTCTGGGCCTCCTGGC 0: 1
1: 0
2: 5
3: 65
4: 584
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data
1184740936_1184740942 1 Left 1184740936 22:46428773-46428795 CCACCTCACTGCCTCACTGCACA 0: 1
1: 0
2: 5
3: 36
4: 465
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data
1184740935_1184740942 10 Left 1184740935 22:46428764-46428786 CCTGGCGCTCCACCTCACTGCCT 0: 1
1: 0
2: 2
3: 32
4: 307
Right 1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184740942 Original CRISPR CTCACTCACGGGTCCCCAGC GGG Intronic
No off target data available for this crispr