ID: 1184742998

View in Genome Browser
Species Human (GRCh38)
Location 22:46439924-46439946
Sequence CTGTGTGAGGGGTGGGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184742998_1184743016 28 Left 1184742998 22:46439924-46439946 CCGCCCTCCCACCCCTCACACAG No data
Right 1184743016 22:46439975-46439997 ATTCCAACCCGGTTCTAATCTGG 0: 1
1: 0
2: 0
3: 2
4: 46
1184742998_1184743010 5 Left 1184742998 22:46439924-46439946 CCGCCCTCCCACCCCTCACACAG No data
Right 1184743010 22:46439952-46439974 TCGCACTGTCTGGCCACCCCTGG 0: 1
1: 0
2: 2
3: 4
4: 113
1184742998_1184743011 17 Left 1184742998 22:46439924-46439946 CCGCCCTCCCACCCCTCACACAG No data
Right 1184743011 22:46439964-46439986 GCCACCCCTGGATTCCAACCCGG 0: 1
1: 0
2: 1
3: 59
4: 1506
1184742998_1184743006 -5 Left 1184742998 22:46439924-46439946 CCGCCCTCCCACCCCTCACACAG No data
Right 1184743006 22:46439942-46439964 CACAGACCCCTCGCACTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184742998 Original CRISPR CTGTGTGAGGGGTGGGAGGG CGG (reversed) Intronic
No off target data available for this crispr