ID: 1184743053

View in Genome Browser
Species Human (GRCh38)
Location 22:46440173-46440195
Sequence TAAGAACCTCATCTGCTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184743047_1184743053 2 Left 1184743047 22:46440148-46440170 CCATCCGCCCTCAGACCAGGAGT No data
Right 1184743053 22:46440173-46440195 TAAGAACCTCATCTGCTCGGAGG No data
1184743044_1184743053 22 Left 1184743044 22:46440128-46440150 CCACAGCACACTGCCTCTCTCCA No data
Right 1184743053 22:46440173-46440195 TAAGAACCTCATCTGCTCGGAGG No data
1184743049_1184743053 -5 Left 1184743049 22:46440155-46440177 CCCTCAGACCAGGAGTGCTAAGA No data
Right 1184743053 22:46440173-46440195 TAAGAACCTCATCTGCTCGGAGG No data
1184743045_1184743053 9 Left 1184743045 22:46440141-46440163 CCTCTCTCCATCCGCCCTCAGAC No data
Right 1184743053 22:46440173-46440195 TAAGAACCTCATCTGCTCGGAGG No data
1184743050_1184743053 -6 Left 1184743050 22:46440156-46440178 CCTCAGACCAGGAGTGCTAAGAA No data
Right 1184743053 22:46440173-46440195 TAAGAACCTCATCTGCTCGGAGG No data
1184743043_1184743053 23 Left 1184743043 22:46440127-46440149 CCCACAGCACACTGCCTCTCTCC No data
Right 1184743053 22:46440173-46440195 TAAGAACCTCATCTGCTCGGAGG No data
1184743048_1184743053 -2 Left 1184743048 22:46440152-46440174 CCGCCCTCAGACCAGGAGTGCTA No data
Right 1184743053 22:46440173-46440195 TAAGAACCTCATCTGCTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184743053 Original CRISPR TAAGAACCTCATCTGCTCGG AGG Intronic