ID: 1184745058

View in Genome Browser
Species Human (GRCh38)
Location 22:46451261-46451283
Sequence CCTTCCCAGCTCCCTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 419}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184745058_1184745066 -10 Left 1184745058 22:46451261-46451283 CCACAAGGAGGGAGCTGGGAAGG 0: 1
1: 0
2: 6
3: 61
4: 419
Right 1184745066 22:46451274-46451296 GCTGGGAAGGGGGAGGCCAGGGG 0: 1
1: 2
2: 7
3: 139
4: 1300
1184745058_1184745072 22 Left 1184745058 22:46451261-46451283 CCACAAGGAGGGAGCTGGGAAGG 0: 1
1: 0
2: 6
3: 61
4: 419
Right 1184745072 22:46451306-46451328 CTGCAGAAGCCGCTTGTCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 217
1184745058_1184745067 -3 Left 1184745058 22:46451261-46451283 CCACAAGGAGGGAGCTGGGAAGG 0: 1
1: 0
2: 6
3: 61
4: 419
Right 1184745067 22:46451281-46451303 AGGGGGAGGCCAGGGGAGCCCGG 0: 1
1: 0
2: 15
3: 126
4: 1058
1184745058_1184745071 21 Left 1184745058 22:46451261-46451283 CCACAAGGAGGGAGCTGGGAAGG 0: 1
1: 0
2: 6
3: 61
4: 419
Right 1184745071 22:46451305-46451327 ACTGCAGAAGCCGCTTGTCCAGG No data
1184745058_1184745073 26 Left 1184745058 22:46451261-46451283 CCACAAGGAGGGAGCTGGGAAGG 0: 1
1: 0
2: 6
3: 61
4: 419
Right 1184745073 22:46451310-46451332 AGAAGCCGCTTGTCCAGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184745058 Original CRISPR CCTTCCCAGCTCCCTCCTTG TGG (reversed) Intronic
900093241 1:929701-929723 CATTCCCAGCTCCCTTCTTAGGG - Intronic
900299245 1:1968914-1968936 CCTCCCTAGCGCCCTCCTGGGGG + Intronic
900948581 1:5844941-5844963 TCTTGCCAGCTCTCTGCTTGTGG - Intergenic
901209207 1:7515039-7515061 CCTTCCCGGCTCCCTCCACCTGG + Intronic
901663737 1:10814926-10814948 CCCTCCCTCCACCCTCCTTGGGG - Intergenic
901884679 1:12214719-12214741 CCTCTCCAACTCCCTCGTTGTGG + Intergenic
902286412 1:15410855-15410877 CCTGCCCAGAACCCACCTTGAGG - Intronic
902986598 1:20158241-20158263 CCTGCACACCTCTCTCCTTGTGG - Intergenic
903006711 1:20303504-20303526 CCTTCCCAGCTCAGACCTGGAGG + Intronic
903016157 1:20363480-20363502 GGTTCCCAGCTGCCTCCTTGGGG - Intergenic
903548240 1:24140606-24140628 CCTCCCCAGCCCCTTCCTTGAGG - Intronic
903565022 1:24258773-24258795 CCTTTCCAGCTCCCTGCCTGTGG + Intergenic
903571493 1:24308846-24308868 CCTTCCCTGAGGCCTCCTTGTGG + Intergenic
904513234 1:31031944-31031966 CCTCCCCACCTCCCTCTTTCAGG + Intronic
905255302 1:36677888-36677910 ACTTTCCAGCTCCCTCCATCAGG - Intergenic
905290824 1:36920712-36920734 CCTCCACAGCTCCCTTCTGGAGG - Intronic
905542845 1:38773868-38773890 CCTGCCCAGCCCCCACCTTAGGG - Intergenic
906201676 1:43964551-43964573 CCAGCCCAGCTCCCTCCGTTTGG - Intronic
906344176 1:45004912-45004934 CATTCCCTGCTGCCTCCATGGGG - Intronic
906685942 1:47763418-47763440 CTTTCCCAGATCCCTCCTCTGGG - Exonic
907476405 1:54708836-54708858 CCTTCCCAGGACCCCTCTTGGGG + Intronic
910324879 1:85995574-85995596 CCTTCCCCCCTCCCTCCTCAGGG - Intronic
910984499 1:92992426-92992448 GATTCCCAGCTCTGTCCTTGGGG + Intergenic
911184141 1:94886574-94886596 CCTTCCCTGATCCCTCCTGCTGG + Intronic
911196405 1:94999605-94999627 CCTCTCCAGCTCCCTCCTGAGGG + Intronic
911597411 1:99813187-99813209 TTTTTCCAGCTCCCTCCCTGTGG + Intergenic
911992465 1:104718647-104718669 ACTTCCCAACTGACTCCTTGAGG + Intergenic
912466251 1:109877007-109877029 TCTTCCCAGCTTTCTGCTTGAGG - Intergenic
912550836 1:110484147-110484169 CCTTCCCAGCCTCCTAGTTGTGG + Intergenic
912560703 1:110549448-110549470 GCTCCCCACCTCCCACCTTGAGG - Intergenic
912563810 1:110570524-110570546 CCTCCCCTCCTCCCTCCCTGCGG + Intergenic
913608296 1:120486899-120486921 CCTTCTCAACTCCCTCTTTAAGG + Intergenic
913720524 1:121588122-121588144 GGCTCCCAGCTCCCTACTTGGGG - Intergenic
914370052 1:147016682-147016704 CCTTCTCAACTCCCTCTTTAAGG + Intergenic
914484643 1:148096733-148096755 CCTTCTCAACTCCCTCTTTAAGG - Intergenic
915030791 1:152879021-152879043 CCTTGCCAGAGCCCTCCTGGTGG + Intronic
915283810 1:154840406-154840428 CTTTCCCAGCTCCCTGCTTCGGG - Intronic
915561970 1:156692876-156692898 GCTTCCCACCTCTCTCCTTTGGG - Intergenic
915589692 1:156863510-156863532 CTTTCCTGGGTCCCTCCTTGGGG + Intronic
916229444 1:162525420-162525442 CCTTCCCAGTTACTTCTTTGGGG + Exonic
916787838 1:168099088-168099110 CCTTTCCCCCTTCCTCCTTGAGG + Intronic
917738917 1:177944847-177944869 CCTCTCCCTCTCCCTCCTTGAGG + Intronic
918067869 1:181113584-181113606 CCTGCCCTGCTCCTTCCTTTTGG + Intergenic
918523380 1:185439301-185439323 CACTCACATCTCCCTCCTTGTGG - Intergenic
918944927 1:191051465-191051487 ATTTCCCAGCTCCCTTCTTGAGG - Intergenic
920509637 1:206541391-206541413 CCTCCCCAGCTGCCTCCCTGTGG - Intronic
921406104 1:214781222-214781244 CATTTCCATCTCTCTCCTTGGGG + Intergenic
921586242 1:216949166-216949188 CATCTCCAGCTCCCTCCTTCTGG + Intronic
922452937 1:225751202-225751224 GCTTCCCACCTCCCTTCTTCGGG - Intergenic
922586166 1:226736577-226736599 GCTGCCTAGCTCCCTCATTGGGG - Exonic
922825383 1:228513881-228513903 CCCTCCTATGTCCCTCCTTGGGG + Intergenic
924512148 1:244736478-244736500 CCTCCCCAGATTCCTCCTGGAGG - Intergenic
924566058 1:245199315-245199337 CCCTCCCTCCTCCCTTCTTGAGG + Intronic
1062779664 10:190477-190499 CCTTCCCAGACTCCTCCTTCAGG + Intronic
1064423687 10:15211905-15211927 CCTTCCCTGCTCCATCCCTGTGG - Exonic
1065192142 10:23222500-23222522 CCTTCCTCTCTCCCTCCTTTTGG - Intronic
1065390125 10:25174756-25174778 CTCTCCCTGCTCCCTCCTCGGGG - Intergenic
1066037589 10:31508796-31508818 ATTTCCCAGCTCCCTCCCTATGG - Intronic
1067095292 10:43295555-43295577 CCTTCCCTGCTCTCCTCTTGAGG - Intergenic
1068935561 10:62632534-62632556 CCTGCCCTGCTCCCGACTTGGGG + Intronic
1070162898 10:73876407-73876429 CCTCCCAAGCTGCCTCCCTGAGG + Intergenic
1071888514 10:89977253-89977275 CCTTCCCCATTCCCTCCTAGTGG - Intergenic
1072766983 10:98102959-98102981 CCTTCTCGGCTACCTTCTTGTGG - Intergenic
1074415599 10:113264469-113264491 CCTTCCTTCCTCCCTGCTTGGGG - Intergenic
1074717504 10:116233570-116233592 CCTCCCCAACACTCTCCTTGTGG + Intronic
1074982473 10:118630783-118630805 CCTCCCCTCCTCCCTACTTGGGG - Intergenic
1075050299 10:119178553-119178575 CCTTCCCCACTCCATCCTCGCGG - Intronic
1075096867 10:119477734-119477756 CCTGCCCAGCTCCCTCTCTGGGG - Intergenic
1075395974 10:122127310-122127332 CCATCCCAGTGCCCGCCTTGGGG + Intronic
1075404156 10:122183465-122183487 CCTTCCCATGTCACTCCCTGCGG + Intronic
1075911755 10:126131170-126131192 CCTTCCCTGCTCCCTGCCTCGGG + Intronic
1075944847 10:126423989-126424011 CTTCCCCAGCCCCCTCCCTGAGG + Intergenic
1075957287 10:126534937-126534959 ACTTCCCACCTCACTCCTTCAGG + Intronic
1076461212 10:130648880-130648902 TCTTCCCAGCTCCCTCCTCCTGG + Intergenic
1076481346 10:130786941-130786963 CCTGCCCACCTCCCTCCTGAAGG - Intergenic
1076743412 10:132499570-132499592 CCCTCACAGCACCTTCCTTGTGG + Intergenic
1076760819 10:132605148-132605170 CCTTCCCCACTCCCTCCTGGGGG - Intronic
1076760840 10:132605196-132605218 CCTCCCCCACTCCCTCCTGGGGG - Intronic
1076760861 10:132605244-132605266 CCTCCCCCACTCCCTCCTGGGGG - Intronic
1077054570 11:584650-584672 CCTTCCCATCCCCTTCCTTCGGG - Intronic
1077090294 11:775321-775343 CCTTCCCAGCTTCCTTCTCCTGG - Intronic
1077112614 11:868655-868677 CCTCCCCAGCTCCCGTCCTGTGG + Exonic
1077381152 11:2238512-2238534 TATTCCCAGCTCCCTCAGTGAGG - Intergenic
1077556280 11:3227673-3227695 CCTTTCCAGCTGCCTCCCAGGGG + Intergenic
1078087371 11:8242389-8242411 CCTCCCCAGCTCCCTGCCTGAGG + Intronic
1078528468 11:12118555-12118577 CTTTGCCAGCTCTCTCCTTTAGG + Intronic
1079032846 11:16998376-16998398 CCTTTCCAGGTTGCTCCTTGGGG - Intronic
1079824650 11:25175456-25175478 CCTTACAAGCTCCCTCCCTGGGG + Intergenic
1080441271 11:32297001-32297023 ACTTTCCAGCTCCCTCTATGTGG + Intergenic
1081627468 11:44663982-44664004 CCCCCCCACCTCCCTCCTGGAGG - Intergenic
1081629858 11:44681705-44681727 CCCTCCAAGCTCCCTCCCAGGGG + Intergenic
1081631733 11:44694107-44694129 CCTCCCCAGCTCCCAACTCGGGG - Intergenic
1082044730 11:47715437-47715459 GGGTCCCCGCTCCCTCCTTGGGG - Intergenic
1083627293 11:64078230-64078252 CCTGCCCACCTCCCTTCTGGAGG - Intronic
1083862007 11:65425352-65425374 CTTTACCAGCTTCCTCCTGGTGG + Intergenic
1084320978 11:68373281-68373303 CCCTCTCAGCCCCTTCCTTGGGG - Intronic
1084472658 11:69372242-69372264 CCTGCCCAGCCTCCTCCTTGGGG + Intergenic
1085040360 11:73323205-73323227 CCTTCCATGCTCCCTCCATTAGG - Intronic
1085450633 11:76630049-76630071 CCCTCCCAGCACCCTCCTCCTGG + Intergenic
1085845321 11:80058540-80058562 CCTTCCCACATCCCTCCATAAGG - Intergenic
1086350284 11:85937160-85937182 CATTCCCATATCCCTCGTTGCGG - Intergenic
1086373114 11:86174524-86174546 CATTCCCAGCTTCCTCCCTATGG - Intergenic
1087102643 11:94380275-94380297 CCTCCCCAGTTCCTTCCTTCAGG - Exonic
1089086797 11:115826656-115826678 CATTCCCTGCTCCCTACCTGGGG + Intergenic
1089108360 11:116034333-116034355 GCTTCCCACCTCCAACCTTGAGG - Intergenic
1089326373 11:117660261-117660283 CCTTCCCAGTTCCTCCCTTTTGG + Intronic
1089499228 11:118922869-118922891 ACTTCCCAGGCACCTCCTTGTGG + Intronic
1089705089 11:120272023-120272045 ACTTCCCAGGCCCCTGCTTGAGG + Intronic
1089784003 11:120895054-120895076 CCTTCCCACCTCCCTCCTCTGGG - Intronic
1092060663 12:5547838-5547860 CCATCCCAGCTCCTCCCTGGAGG - Intronic
1092872998 12:12823545-12823567 CCTTCCCATCCCCATCCTTGAGG + Intronic
1094829610 12:34294072-34294094 CCTTCCCAGCTGCCCCTGTGTGG - Intergenic
1094837477 12:34328919-34328941 CCTTCCCAGCAGCCCCTTTGTGG - Intergenic
1096755575 12:53796636-53796658 CCTTCCCACCTCCATTATTGAGG - Intergenic
1097337507 12:58399458-58399480 CCTTCCCAACTCATTCTTTGAGG - Intergenic
1098202341 12:68069144-68069166 TTTTCCCCTCTCCCTCCTTGGGG + Intergenic
1099497882 12:83375224-83375246 CCTCCCCAGCTCATTCCATGAGG - Intergenic
1100330039 12:93573080-93573102 GCTTCCTAGCTGCTTCCTTGGGG - Intronic
1101589051 12:106110366-106110388 CCACCCCACCTCCCACCTTGAGG - Intronic
1101629623 12:106480415-106480437 CATTCCCAGCTCCAACCTTCAGG - Intronic
1102289506 12:111687481-111687503 CCTTTCCAGATGTCTCCTTGGGG + Intronic
1102503418 12:113368582-113368604 CCTTCCCTGCTCCTTCATTTGGG - Intronic
1102601833 12:114037247-114037269 CCTTCCCAGCCGCCTGCTCGGGG + Intergenic
1102954918 12:117053037-117053059 CCTGCCTAGCTCCCTCCTCAGGG + Intronic
1103703754 12:122860673-122860695 CCTTGTCAGCTGCCTCCCTGCGG - Exonic
1103960451 12:124606071-124606093 CTTCCCTCGCTCCCTCCTTGCGG - Intergenic
1105302945 13:19151817-19151839 CCTTCCCCACTACCTCCCTGGGG + Intergenic
1106542915 13:30705863-30705885 CCTTCCCAGCCCTCTCCTCCAGG - Intergenic
1106987509 13:35372632-35372654 ACTCCCCAGCTCCCTGCTTATGG - Intronic
1108206064 13:48091963-48091985 CCTCCTCAGCTCCATCTTTGGGG - Intronic
1109201412 13:59435469-59435491 TCTTCACAGCTCTTTCCTTGAGG - Intergenic
1110392216 13:74986967-74986989 GCTTCCCCCCTCCCTCCCTGAGG - Intergenic
1110700266 13:78539150-78539172 CCCTCCCACCTCTCTCCTTTTGG - Intergenic
1110792672 13:79602351-79602373 CCTCCCCAGCAACCTCCATGTGG + Intergenic
1110852748 13:80263299-80263321 CTTTCCCAGTTCCATACTTGGGG + Intergenic
1112261816 13:97884328-97884350 CCTGCCCAACTCACTCCTTCTGG - Intergenic
1113483583 13:110638940-110638962 CCTGCCCAGCTCCCTGCCGGAGG - Exonic
1113662331 13:112116313-112116335 CCTCTCCAGCTCACTCCTGGAGG + Intergenic
1113766718 13:112886080-112886102 CCTTCCCAGCTGGCTCGTGGCGG - Exonic
1113770115 13:112902852-112902874 CCTGCCCAGCTCTCACCTCGGGG - Intronic
1113852021 13:113423302-113423324 GCTTCCCTTCTCCCTCCCTGGGG + Intronic
1114665983 14:24377431-24377453 CTTGCCCAACTCCCTCCATGTGG - Exonic
1115444990 14:33479767-33479789 CTTTGCCAGCTCCCTCTTTCTGG + Intronic
1115711820 14:36059243-36059265 CCTTCCCAACTCCAACCATGTGG - Intergenic
1118991932 14:70804937-70804959 CCTTCCCTGCTCAGTCCCTGTGG + Intronic
1119415804 14:74468449-74468471 CCTTCCTACCTCCCTTCTCGGGG + Intergenic
1119924979 14:78484963-78484985 CCTTGCCAGCACACTCCTTTGGG + Intronic
1120282219 14:82454074-82454096 CCTTCGTACCTCCCTCCCTGTGG - Intergenic
1120769367 14:88361561-88361583 GTTTCCCAGCTCCTTCCTGGTGG + Intergenic
1121200007 14:92108866-92108888 CCTTCCCCAATCCCTCATTGTGG - Intergenic
1121505715 14:94474993-94475015 CCTCCCCAGCTGCATCTTTGAGG + Intronic
1121714386 14:96062606-96062628 CCTGCCCAGCTCCCTGCTCACGG + Intronic
1122932587 14:104941578-104941600 CTTTCCCAGCTACATCCTCGTGG + Exonic
1123121255 14:105918085-105918107 CCCTCCCTCCTCCCTCCTTCAGG - Intronic
1123403982 15:20009749-20009771 CCTTCCCTCCTCCCTCCTTCAGG - Intergenic
1123513322 15:21016395-21016417 CCTTCCCTCCTCCCTCCTTCAGG - Intergenic
1124347266 15:28931090-28931112 CCTCCCCAGCCCCCTCCATGAGG + Intronic
1125539161 15:40459743-40459765 CCTTTCCAGCACCCTCCCTGGGG + Exonic
1125728565 15:41880490-41880512 CCTTGCCATCTCCCTCCAGGTGG - Intronic
1126418926 15:48450568-48450590 TCTTCCCAGCTACTTCCTTGTGG - Intronic
1127983430 15:64050595-64050617 CCTTCCCTGCCCCATCCCTGTGG - Intronic
1128325401 15:66720777-66720799 ACTGCCCAGCTCCCACCCTGAGG - Intronic
1129136227 15:73554600-73554622 CTTTCCCATCCCCCTCCCTGGGG - Intronic
1130422746 15:83764533-83764555 CTTCCCCAGCTCTCTCTTTGTGG + Intronic
1130634064 15:85599579-85599601 GCTTCCCACCTCCCCCCTTCTGG - Intronic
1130754860 15:86752531-86752553 CCTTCCCAGATCCATGCTTTAGG + Intronic
1132092663 15:98958422-98958444 CCTTCCCATCTGTGTCCTTGGGG - Exonic
1132989635 16:2786121-2786143 CCTTCCCTGCTTCCTCCTCCAGG - Exonic
1133264708 16:4576094-4576116 CCTTGCCAACTCTATCCTTGGGG - Exonic
1133385312 16:5365051-5365073 TCTTCCCCACTCCCTCCCTGAGG - Intergenic
1133466852 16:6035636-6035658 CCCTCCCAGCTCCCTGCACGTGG + Intronic
1133968481 16:10549063-10549085 CATCCCCAGCTACCTCCTTAGGG - Intronic
1136067905 16:27771054-27771076 CCTTCCCAGAGCACTCCCTGAGG + Intronic
1136297025 16:29309480-29309502 CCTTCCCGCTTCCCTGCTTGGGG + Intergenic
1137569384 16:49555250-49555272 CCTTCCCAGCTTCTTCCTTGTGG - Intronic
1137585128 16:49659756-49659778 CCTTCCCAGACCCCTCTATGAGG - Intronic
1139660311 16:68416332-68416354 CCTTCCCATCTCCCTCTCTCTGG + Intronic
1139909867 16:70391142-70391164 CCTTCCCAGTCCCGTCCCTGAGG - Intronic
1140096005 16:71876165-71876187 CCTTTCCAGATGCCTTCTTGGGG + Intronic
1140550582 16:75861544-75861566 CCCTCCCAGCTGCCTCCTTGTGG - Intergenic
1140834376 16:78779818-78779840 CCTTCCCCTTTCCTTCCTTGGGG - Intronic
1141161894 16:81634786-81634808 CCTTCCCAGCTGCATCCTCTGGG - Intronic
1141631584 16:85290934-85290956 ACTTCCCTGCTCCCTGCTTGGGG - Intergenic
1141803858 16:86329741-86329763 TCTTCCCAGCCCCCTCCCTGTGG + Intergenic
1141930874 16:87201940-87201962 CCCTCCCAGCTCCAGCCTTGGGG + Intronic
1143127662 17:4654575-4654597 CCTTTGCAACTCTCTCCTTGGGG + Intergenic
1143681258 17:8477634-8477656 CCTTCCCACCCCCACCCTTGGGG - Intronic
1143765779 17:9136876-9136898 CCTGCCCAGCTCCTTCCTCGTGG + Intronic
1143841001 17:9731638-9731660 TCTTCACAGCACCCTCCTCGGGG - Intergenic
1143869017 17:9944602-9944624 CCTTCCCAGTTCCCCCGGTGTGG + Intronic
1146370168 17:32261120-32261142 CCTTTCCTGCCACCTCCTTGGGG - Intergenic
1147314576 17:39613475-39613497 CCTTCCCAGGTCCATGCCTGGGG + Intergenic
1147316312 17:39622067-39622089 ACTTCCCAGCTCCCACCTGGGGG + Intergenic
1147609781 17:41794632-41794654 CCTTCCCAGCCTCCTCCTCCAGG + Intergenic
1147907629 17:43833176-43833198 CCTTCCCGGACCCCTCCCTGCGG + Intergenic
1148385051 17:47228294-47228316 CTTTCCCACCTCCCTCCTGAAGG - Intergenic
1148547588 17:48529606-48529628 CATCTCCAGCTGCCTCCTTGGGG + Exonic
1148567726 17:48643423-48643445 CCTTCCCATCTCTCCTCTTGGGG - Intergenic
1151077560 17:71291031-71291053 CCTTTCCTCCTCCCTCATTGTGG - Intergenic
1151338201 17:73452817-73452839 CCATCCCAGCTCCCTTTCTGAGG - Intronic
1151380892 17:73725054-73725076 CCTTGCCAGGTCCCTCTTTCTGG - Intergenic
1151780097 17:76240107-76240129 CCTGCCCCTCTCCCTCCTCGCGG + Intronic
1152241397 17:79163198-79163220 CTTGGCCAGCTCCCTCCTTGGGG + Intronic
1152726405 17:81948888-81948910 CCTCCCGAGCTCTGTCCTTGTGG + Intergenic
1154037351 18:10816044-10816066 TCTTCCCAGCTCCTGCCTAGTGG - Intronic
1154393216 18:13962008-13962030 TCTTCCCAGCTGTCTCTTTGAGG + Intergenic
1156259148 18:35428525-35428547 CCCTCCCACCTCCCTTCTTTAGG - Intergenic
1157424894 18:47576612-47576634 CCTTCCCTCCTCACTCCATGGGG + Intergenic
1158341405 18:56470575-56470597 TATTCCCAGCTCCCAGCTTGGGG - Intergenic
1158404259 18:57147188-57147210 CCTCCGCCGCTGCCTCCTTGGGG + Exonic
1159070813 18:63622065-63622087 CCTTTCCAGCTCACTCTCTGGGG + Intergenic
1160571882 18:79822999-79823021 CCTTCCCACCTCCCTCCATGGGG + Intergenic
1160717580 19:583382-583404 CCTCCCCAGCTCACCCCTGGAGG + Exonic
1160920973 19:1520397-1520419 CCTCCCCAGCACCCTCCTTCCGG - Intergenic
1161026584 19:2039952-2039974 CCCTCCCAGCCCCCACCCTGGGG + Intronic
1161092841 19:2371288-2371310 CCTTGCCTAGTCCCTCCTTGGGG + Intergenic
1161287177 19:3474678-3474700 CCACCCCACCTCCCTCATTGGGG - Exonic
1161805329 19:6440201-6440223 CCTTTCCAAGTCCCTCCATGGGG + Exonic
1162313275 19:9920308-9920330 ACTTGCAAGCTCCCTCTTTGAGG + Intronic
1162811116 19:13164724-13164746 ACCTCCCAGGTCCCGCCTTGTGG + Intergenic
1162930009 19:13952896-13952918 CCCTCCGAGCCCCCTCCCTGGGG - Intronic
1163567874 19:18062325-18062347 CCCTCCTAGCTCCTTCCCTGAGG - Intronic
1163632651 19:18425192-18425214 CCTTCGCAGCCCCCTCCTTCAGG + Intronic
1163767664 19:19172348-19172370 ACTCCCCAGCCCCCTCCTTCTGG + Intronic
1163916764 19:20246897-20246919 CCTGCACACCTCTCTCCTTGTGG - Intergenic
1164454989 19:28399498-28399520 CCTTCCCAGATCTCCACTTGTGG + Intergenic
1164563299 19:29308825-29308847 CATTCTCAGCCCCCTCCCTGGGG - Intergenic
1164618106 19:29678553-29678575 CCTTCCGTGCTTGCTCCTTGAGG - Intergenic
1164763158 19:30743354-30743376 TCTTCCCAGAACCCTCCTTTGGG - Intergenic
1164827045 19:31291401-31291423 CCTTCCCAGCACTCTTCATGAGG + Intronic
1164949724 19:32327042-32327064 TCTCCCCAGCCCCCTCCATGAGG + Intergenic
1165430384 19:35768490-35768512 CCTTCTTAGCAGCCTCCTTGGGG - Exonic
1166670639 19:44707741-44707763 CCTTCCCAGCACCCTACATGGGG + Intronic
1166977252 19:46611963-46611985 CAATCCCAGGGCCCTCCTTGTGG + Intergenic
1167590883 19:50403591-50403613 CCTGCCCAGCCCTCACCTTGAGG - Exonic
1167609963 19:50502221-50502243 CCCTCCCAGCTCCCACCCTGTGG - Intergenic
1167667783 19:50832778-50832800 CCAGCCCCGCTTCCTCCTTGAGG + Intronic
1167903250 19:52637844-52637866 CCCCCCCACCTCCCTCCTCGTGG - Intronic
1167942578 19:52959480-52959502 CCTGCACATCTCTCTCCTTGTGG - Intronic
1168071789 19:53957514-53957536 CCTTTACTGCTCCCTCCTGGGGG - Intergenic
1168246754 19:55116457-55116479 CCTTCCCTGCCGCCTCCTTCAGG - Intronic
1168719213 19:58545557-58545579 CCTCCCCAGAAACCTCCTTGTGG - Intronic
926152234 2:10431824-10431846 CCTTGCCAGCGGCCTCCTTCAGG + Intergenic
926503784 2:13685628-13685650 CCTTACTATCTCCCTCCTTTTGG + Intergenic
927075592 2:19573918-19573940 CCTTCCCAGATTCTTCCTAGGGG - Intergenic
927522458 2:23707649-23707671 CCGGCCCAGCTCCCTCCATGAGG + Exonic
927959955 2:27234971-27234993 CCTTCCCAGATCACCCCTTTTGG - Intronic
928914530 2:36457049-36457071 TCTTCCTAGCTTCCTCCTCGAGG - Intronic
931738205 2:65217497-65217519 ACTTCTTAGCTCTCTCCTTGAGG - Intergenic
931798774 2:65737799-65737821 CCTTCTCAGCTGCCTCCTATTGG - Intergenic
932353413 2:71049524-71049546 CCTGCACATCTCTCTCCTTGTGG - Intergenic
932462569 2:71892537-71892559 CTCTCCCAGGCCCCTCCTTGGGG - Intergenic
933968575 2:87451434-87451456 CCTTCCCAGCACCCCTCTTGGGG + Intergenic
934517311 2:94996816-94996838 CTCTCCCAGCACCCTCCTTTTGG - Intergenic
935060279 2:99601301-99601323 CCTTCCCAGCACCTGGCTTGGGG + Intronic
936325219 2:111499071-111499093 CCTTCCCAGCACCCCTCTTGGGG - Intergenic
937580954 2:123487460-123487482 CCTTCCAAGCTCCGTCCTTGTGG + Intergenic
938021109 2:127906406-127906428 GCTTCCCAGCCCTCTCCCTGTGG - Intergenic
938289007 2:130139821-130139843 CCTTCCCCACTCCCTCCCTGGGG + Intronic
938467522 2:131533117-131533139 CCTTCCCCACTCCCTCCCTGGGG - Intronic
940874380 2:158885170-158885192 CCTGCGCATCTCTCTCCTTGTGG - Intergenic
941660875 2:168193947-168193969 CCTTTCCAGTTCCTTCCATGGGG - Intronic
942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG + Intergenic
943324872 2:186486126-186486148 CCGTCCCTGCCCCCTCCTAGTGG + Intergenic
943994159 2:194737665-194737687 ACTTCCTAACTCCCTCCCTGAGG + Intergenic
944684436 2:202105660-202105682 CCTTCCCTGCTCACACCATGTGG - Intronic
944919251 2:204394252-204394274 CCTTGCTCCCTCCCTCCTTGTGG + Intergenic
946381972 2:219354990-219355012 CCCTCCCAGGTCTCACCTTGAGG + Intergenic
946409233 2:219508183-219508205 CTCTCCCAGCCCCTTCCTTGGGG - Intergenic
947624819 2:231612905-231612927 CCTTCCCTTCTCCCTCCCAGTGG - Intergenic
948196917 2:236103356-236103378 CCAGCCCAGCTGCCCCCTTGGGG - Intronic
948236593 2:236395292-236395314 GCTTCCCAGCTGCCTCCTGTAGG - Intronic
948863450 2:240763863-240763885 CCGTCCCTGCTTCCTTCTTGTGG - Intronic
1169324406 20:4663599-4663621 CCTTCCACCCTCCCACCTTGTGG + Intergenic
1169405383 20:5317188-5317210 CATCCCCAGCTTCCTCCTGGGGG - Intergenic
1169716855 20:8629088-8629110 CATTTCCAGCTCTCTCCTAGGGG + Intronic
1171043413 20:21788256-21788278 CCTTCCCAGCTCCTCCTTTCAGG + Intergenic
1171045722 20:21808292-21808314 CCATGCCAGCTCCCTCCTGGAGG - Intergenic
1171408519 20:24930033-24930055 CCTGCACATCTCTCTCCTTGTGG - Intergenic
1171861397 20:30405391-30405413 CCCCCCCACCTCCCTCCTGGAGG - Intergenic
1172024283 20:31937387-31937409 CCTTCCCAGGTGGCTCCTGGAGG + Exonic
1172851430 20:37969085-37969107 CTTTCCCTGCCCCCTCCTGGTGG - Intergenic
1172941339 20:38656685-38656707 GCTTCTCACCTCCCTCCTTGGGG - Intergenic
1173063071 20:39680645-39680667 CGTACCCAGCTTCCTCCTTATGG + Intergenic
1173931247 20:46821181-46821203 CCTCCCCAGCTCCTTCCCTGGGG - Intergenic
1174066235 20:47867833-47867855 CCTTCCCGTCTCCCTCCCCGCGG - Intergenic
1174505895 20:51017404-51017426 CCTTCCAGGCACCCTCCATGTGG - Intronic
1175108416 20:56630011-56630033 CCTGCCCCGCTACCTCCTCGGGG + Intronic
1175337552 20:58206077-58206099 ACTTCCCACGTCCCTGCTTGTGG + Intergenic
1175405504 20:58723396-58723418 CCAGCCCAGCTCCCTGCCTGGGG + Intergenic
1175801689 20:61804615-61804637 CCTGCCCAGCTCTCGCCTGGTGG + Intronic
1175898470 20:62350637-62350659 CCCTGCCAGCTCCCTGCTGGGGG + Intronic
1175909008 20:62395747-62395769 CCTGCCGGGCACCCTCCTTGTGG - Intronic
1176086191 20:63296619-63296641 CTTCCCCAGCTCCCTGCTGGAGG - Intronic
1176130260 20:63493810-63493832 CCTCCCCTGCTCCCTGTTTGTGG - Intronic
1176154645 20:63612462-63612484 CCTTCCCAGCTCACCCCTTGTGG - Intronic
1176407411 21:6428718-6428740 CAATCCCAGCTTCCTCATTGCGG - Intergenic
1176408868 21:6437036-6437058 CCCCCACAGCTCCCTGCTTGGGG + Intergenic
1177912913 21:27054130-27054152 CATTTCCAGCTCACTCCTAGTGG - Intergenic
1178303393 21:31470932-31470954 CCATCCCAGCTGCCCCCTCGGGG - Intronic
1178321771 21:31611319-31611341 GCTTCCCAGCTCCAACCTTCTGG - Intergenic
1178513909 21:33230195-33230217 CCTTTGCAGCTCTCGCCTTGCGG - Exonic
1179572765 21:42287549-42287571 CCTTCCCAGCTCCACCTTGGAGG + Intronic
1179682918 21:43037121-43037143 CAATCCCAGCTTCCTCATTGCGG - Intergenic
1179684362 21:43045358-43045380 CCCTCACAGCTCCCTGCTTGGGG + Intergenic
1180199795 21:46217479-46217501 CCTTCCCTGCTCCCTGACTGTGG + Intronic
1180983045 22:19888320-19888342 CCTTCTCTGGTCCCTCCTTGGGG - Intronic
1181345728 22:22219429-22219451 CCCTCCCAGGTCCTTCCGTGGGG + Intergenic
1181620691 22:24089265-24089287 ACTTCCCTGCTCCCTTCCTGGGG - Intronic
1183037284 22:35149958-35149980 GCTACCCAGCTCTCTCCTTTAGG + Intergenic
1183120021 22:35723057-35723079 CCCTCCCTCCTCCCTCCTGGAGG - Intronic
1183236711 22:36624265-36624287 CCTTCCCAGCCTGCTCCTGGTGG + Intronic
1183404822 22:37625210-37625232 CACCCCCAGCTCCCTCCCTGGGG - Intronic
1183597577 22:38821934-38821956 CTTTCCCAGCTCCAGCCTGGAGG - Exonic
1184021716 22:41825851-41825873 CCTCCCGACCTGCCTCCTTGTGG - Exonic
1184393841 22:44221036-44221058 CCTTCCCAGTGCCCTCCTCCCGG - Intergenic
1184592358 22:45493556-45493578 CCCTCCCAGCTCCCTGCTGGAGG - Intergenic
1184745058 22:46451261-46451283 CCTTCCCAGCTCCCTCCTTGTGG - Intronic
1184819013 22:46894659-46894681 TCTACCCCGCTCTCTCCTTGAGG - Intronic
1184831582 22:46992234-46992256 GCTTCCAAGCCCCCTCCTGGCGG + Intronic
1184849510 22:47112263-47112285 ACTTCCCAGCCCGCACCTTGGGG - Intronic
1185178610 22:49346576-49346598 CCTTCCCAGCTCGGTCCTCAGGG - Intergenic
1185382555 22:50516838-50516860 CCTTCCCCGTCCCCTACTTGTGG + Intronic
950141776 3:10620697-10620719 GCCTCCCAGCTCCCTCCCTCAGG - Intronic
950198440 3:11026133-11026155 CATTCCCAGCCCCCTCCTCCGGG + Intronic
950700901 3:14745265-14745287 CCTCCCTAGTTCCCTCCCTGTGG - Intronic
953064307 3:39455419-39455441 CCTTTCCTGCCACCTCCTTGGGG - Intergenic
953414430 3:42707493-42707515 TCTTCTCAGCCCCTTCCTTGGGG - Intronic
953491483 3:43356020-43356042 CCTTCCTAGCTCATTCTTTGAGG + Intronic
953851498 3:46468628-46468650 CCTTCCCAACACTCTTCTTGGGG - Intronic
953896622 3:46808211-46808233 CCTTCCCACCCTCCTCCCTGTGG + Intronic
954420315 3:50415539-50415561 CCTGCCCAGACCCCTCCTTGGGG + Intronic
955091968 3:55761657-55761679 CCTCACCAGGTCCCTCCCTGGGG - Intronic
955337532 3:58099174-58099196 CAGTCCCACCTCCCTCCATGAGG - Intronic
955349121 3:58180939-58180961 CCCTCCCAGCTCCCAGCCTGGGG + Intergenic
956604790 3:71063917-71063939 CCTTCCCAACACCGTACTTGGGG + Intronic
956873290 3:73439048-73439070 CTTTCCCAGGTGCCTCCTTATGG + Intronic
959339002 3:105103850-105103872 CAGTCCCAGCTGCCACCTTGGGG - Intergenic
960497570 3:118394335-118394357 CCTTTCCAAGTCCCTCCATGGGG + Intergenic
960547594 3:118934231-118934253 GCTTCCCAGATACCTCCTTGTGG + Intronic
963616075 3:147539717-147539739 CCTTCCCAACTCACTCTATGAGG - Intergenic
964743486 3:159990159-159990181 CCTTCCAGGCCTCCTCCTTGTGG + Exonic
965289772 3:166864793-166864815 CCTTCCCACTTCCTTCCTTCAGG - Intergenic
965506144 3:169517492-169517514 CCTTCCCTGCTCCCTCTTATAGG - Intronic
966278800 3:178206810-178206832 GCTCCCCAGCTGCCTACTTGTGG - Intergenic
967769688 3:193321146-193321168 CCTTCCCAGATGCCTCACTGTGG + Intronic
968064038 3:195748225-195748247 GCTTCCCTGCTGTCTCCTTGTGG - Intronic
968643303 4:1725887-1725909 GCTGCCCAGCTGCCACCTTGGGG - Intronic
968684377 4:1947164-1947186 CCTCCCCAGCACACTCCCTGTGG + Intronic
968808428 4:2789359-2789381 CCTACCTAGCCCCTTCCTTGGGG + Intergenic
969646964 4:8436301-8436323 CCTGCACATCTCTCTCCTTGTGG - Intronic
973062160 4:45740910-45740932 CCTTCCCAGCTCATTCTATGAGG - Intergenic
973752440 4:54035247-54035269 CCTTCCCAGCTCACTTTATGAGG - Intronic
975738353 4:77404159-77404181 AATTCCCAGCTCCCCACTTGTGG + Intronic
977163159 4:93661969-93661991 CCTTGCCAGCTCTTTCCCTGTGG + Intronic
977222697 4:94356597-94356619 CATTCCCAGCTTCCTCCTCATGG + Intergenic
977705905 4:100069507-100069529 CTTTTCCATCTCCCTCTTTGTGG - Intergenic
978240650 4:106512232-106512254 CCTTTCTAGCTCCCTGCTTTTGG + Intergenic
978391687 4:108233461-108233483 CCTTCCCAGCTCATTCTATGAGG - Intergenic
981522752 4:145680822-145680844 CCTTCCCTACTCCCTACCTGTGG + Intronic
982515756 4:156347272-156347294 GTTTTCCAGTTCCCTCCTTGAGG + Intergenic
985062432 4:186092544-186092566 CCTTCCCAACTCCCTTCACGTGG + Intergenic
985405884 4:189637954-189637976 CCACCCCAACACCCTCCTTGCGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
985837163 5:2280044-2280066 CCCTCCCAGCTCACCCCTTGAGG - Intergenic
986315048 5:6581645-6581667 CCTTCCGAGTTACCTGCTTGGGG - Intergenic
986666198 5:10107052-10107074 CCTTTCCAGCTCTCTCTTTGAGG - Intergenic
986852007 5:11824433-11824455 CCTCCCCATCTCCCTCCTGAAGG - Intronic
987076412 5:14386257-14386279 CCAGGCCAGCACCCTCCTTGGGG - Intronic
990006121 5:50945838-50945860 CCTTGGCAGCTCCATCCCTGTGG - Intergenic
993670244 5:90751467-90751489 TCTGCCCAGATCCCTTCTTGGGG - Intronic
996388481 5:122934182-122934204 CTTTCCCAGCGCCGTCCTGGAGG + Intronic
997443037 5:133922024-133922046 CCTTCCCTGCTCCATCCTCCCGG + Intergenic
998168869 5:139860343-139860365 CTTGCCCAGCTCCCTCATTGGGG + Intronic
998443159 5:142178903-142178925 CTTTCCCAGCTCCTTCCCTGCGG - Intergenic
998559706 5:143159841-143159863 CCATCCCATCTGCCTCCTTCAGG - Intronic
998650964 5:144121027-144121049 CCTTCCCAGCTCATTCTATGAGG - Intergenic
999461056 5:151758146-151758168 CCTCCCCACCGCCCTCCTTCAGG + Intronic
1000342939 5:160291498-160291520 CCTGCCCTCCTCCCTCTTTGGGG + Intronic
1001221517 5:169904509-169904531 CCTTCCCACCTCACTCCCTCAGG - Intronic
1002594347 5:180312286-180312308 CTTCCCCAACTCCCTCCTGGAGG - Intronic
1003022575 6:2523800-2523822 CTTGCCCAGCTCCCTGCTTCTGG - Intergenic
1003034754 6:2632957-2632979 CCCTCCCAGCTCCTTCCTCCCGG + Intronic
1003110924 6:3251617-3251639 CCTTCCCACCTGCCACCTAGTGG + Intronic
1003168234 6:3699976-3699998 CCTTCCCTGATCCCTCCATCTGG - Intergenic
1006149027 6:31976266-31976288 CCCCCCCACCTCCCTCCTGGAGG + Intronic
1006211937 6:32403172-32403194 TCTCCCCAGGTCCCTCCATGTGG + Exonic
1006331965 6:33398089-33398111 CCTTCCCAGCTGCCTCTCTCAGG + Exonic
1007066027 6:38991156-38991178 CCCTCCTAGCTCCCTGCATGAGG + Intronic
1007249759 6:40487798-40487820 CCTTCCCAGCTGTCTGCTGGAGG + Intronic
1007251745 6:40500038-40500060 CCTCTCCAGCTCCCTGCCTGTGG + Intronic
1007269396 6:40624633-40624655 CCTTCCCCACTCCCTGCTAGCGG - Intergenic
1007287926 6:40761569-40761591 ACTTCCCAGATCTCTGCTTGTGG - Intergenic
1007288910 6:40769415-40769437 CTCTCCCAGCTCCTCCCTTGGGG + Intergenic
1007360637 6:41353009-41353031 CCCTCCCAGCACCCTCTCTGAGG + Intergenic
1012089787 6:94876387-94876409 CCTTCCCAGTTCACTCTTAGAGG + Intergenic
1012390266 6:98730137-98730159 CCAGCCCAGCTCCCTCACTGAGG + Intergenic
1012480680 6:99663691-99663713 CCTTCCCAGCTGCCTACATGAGG + Intergenic
1012562362 6:100598634-100598656 CCTACCCAGCTCCCTGTGTGTGG + Intronic
1012987508 6:105890671-105890693 CCTTTCCTCCTCCCTGCTTGGGG + Intergenic
1014802433 6:125791286-125791308 CCTTCCCCGCCCACCCCTTGGGG + Intronic
1015885449 6:137913003-137913025 CCTTCCAATCTCCCTGCTTTTGG + Intergenic
1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG + Intergenic
1017062007 6:150492847-150492869 CCTTCCATCCTCCCTCCTTGTGG + Intergenic
1017067931 6:150547538-150547560 CCCTCCCAGCTCCCTCCCAAGGG - Intergenic
1018253550 6:161895915-161895937 CCTTTCCAGCTCCCTTCGTCTGG - Intronic
1018427690 6:163698378-163698400 CCTTGCCAGCTGCCTCCATTAGG - Intergenic
1019298121 7:289817-289839 CCTACCCGGCTCCCTTCCTGGGG - Intergenic
1019421545 7:953474-953496 CTTCCCCCGCTCCCTCCCTGGGG + Intronic
1019499967 7:1359931-1359953 TCTCCCCACCTCCCTCCTGGTGG - Intergenic
1019804973 7:3117024-3117046 CCTCCCCAACTCCATCCCTGTGG - Intergenic
1020005849 7:4783499-4783521 CCTTCCCAGGTCCTTCCCTGAGG + Intronic
1020008197 7:4793210-4793232 TTTTCCCAGCTGCCTCCTGGAGG - Intronic
1020076598 7:5262767-5262789 CCACCACAGCTCCCTGCTTGGGG + Intergenic
1020078444 7:5273970-5273992 CCTGCCCAGCACCGGCCTTGGGG - Intergenic
1020423760 7:8040196-8040218 CCATCACACCTCCCTCATTGTGG - Intronic
1022120947 7:27307451-27307473 CCTGCCCACCTCCTTCCTGGAGG - Intergenic
1022801507 7:33781146-33781168 CATCCCCAGCTCCCTCTATGGGG - Intergenic
1023127092 7:36965234-36965256 CCTCCCCCGCTGCCTCCCTGAGG + Intronic
1023969695 7:44981696-44981718 CATTCCCCGCTCCATCCTTCTGG + Intergenic
1024301786 7:47892546-47892568 CCTCCCAACCTCCCTCCTTTTGG - Intronic
1026072857 7:67138056-67138078 GCTGGCCAGCTACCTCCTTGTGG + Intronic
1026704024 7:72674153-72674175 GCTGGCCAGCTACCTCCTTGTGG - Intronic
1029902376 7:104055380-104055402 GCTTCCAAGCTCCCTCATTCAGG + Intergenic
1032267531 7:130379803-130379825 ACTTCCCAGCCCCCTCCTGCTGG - Intergenic
1032441929 7:131948600-131948622 CTTTCCCCGCTCCCTCCCTGGGG + Intergenic
1033347178 7:140534587-140534609 ACCTCCCATCCCCCTCCTTGAGG - Intronic
1033531756 7:142271198-142271220 CCTTCCCAGAACCCTGCGTGGGG - Intergenic
1034473732 7:151270635-151270657 CCTTCCCAGCTCCCTTCACCTGG - Intronic
1034521176 7:151621212-151621234 ACTTCCCAGCTCCTTCCGTAAGG - Intronic
1034992280 7:155555390-155555412 CCTGCCCAGCACCCTCCTGCCGG - Intergenic
1035406778 7:158604039-158604061 CCTGCCCAGCCTCCTCCTGGTGG + Intergenic
1036694779 8:10967435-10967457 CCTTTCCAGCTCCCACCTCCTGG - Intronic
1036910862 8:12755664-12755686 CCTTCCGAGCCCCCTCCGGGTGG + Intronic
1037396950 8:18453317-18453339 CCTTCCCAGATTGCTCCTTGGGG + Intergenic
1037754995 8:21704897-21704919 CATTCCCATCTCCTTCCGTGGGG - Intronic
1037875295 8:22543292-22543314 CCTTCACAGGACCTTCCTTGTGG + Intergenic
1039550033 8:38436711-38436733 CCTTTCTAGCTGCTTCCTTGAGG - Intronic
1039557699 8:38488504-38488526 CCTTCCCAGCTTCCTCTCTCTGG + Intergenic
1040018932 8:42722858-42722880 CTTGCCCAGCTCCCTCTTGGGGG + Intronic
1040549165 8:48425227-48425249 CCAACCCAGCTTCCTCCTTGTGG + Intergenic
1043139418 8:76570027-76570049 CCTTACCAGCTCTGTCCCTGAGG + Intergenic
1043698984 8:83259657-83259679 CCTTACCAGCAACATCCTTGAGG + Intergenic
1045253401 8:100499780-100499802 CCTTCCCACCTTCCTCCACGTGG + Intergenic
1046744273 8:117860346-117860368 CCTTCCACCCTCCCACCTTGAGG - Intronic
1047361738 8:124175426-124175448 CCTTCCCAGCTGCCTCTTTCAGG + Intergenic
1047495442 8:125405505-125405527 TGTTCTGAGCTCCCTCCTTGTGG - Intergenic
1048273492 8:133047920-133047942 CCTTCCCAGCTGGCTGTTTGAGG - Exonic
1048369371 8:133764240-133764262 TTTTCCAAGCTCCCTCCTTTGGG + Intergenic
1048957398 8:139548339-139548361 CCTGCACATCTCTCTCCTTGTGG + Intergenic
1049747924 8:144270819-144270841 CCGTCCCAGCTGCCTCTGTGGGG - Intronic
1050578305 9:7023150-7023172 ACTTCCAAGCTCACTCCGTGAGG - Intronic
1053124595 9:35569844-35569866 CCTCCCCAGCTGCCTGGTTGAGG - Intergenic
1053410973 9:37916037-37916059 CCTTTCCACCTCCCTCCTTGGGG - Intronic
1054861035 9:69953601-69953623 CCTTCCTAGGTCCCTTCATGTGG + Intergenic
1055055985 9:72024509-72024531 CTTCCCCAGCTCCCTGCTTTAGG - Intergenic
1055091158 9:72365429-72365451 TCTTCCCAGCTCCACCCTAGGGG - Intergenic
1055648173 9:78380417-78380439 CTTTCCCAGCAGCCTCCTTTTGG + Intergenic
1056826380 9:89879052-89879074 CCTTCCCAGCTGGCTCCTAAAGG - Intergenic
1057047853 9:91899623-91899645 CCTCCCCATCTTTCTCCTTGGGG - Intronic
1057122917 9:92593239-92593261 CCTTCTCATCTCCCTTCTTCTGG - Intronic
1057423382 9:94929425-94929447 CCCAGCCAGCTCCCTCCCTGGGG - Intronic
1057890740 9:98867908-98867930 CCTCTGCAGCTCCCTCCGTGGGG - Intergenic
1058816800 9:108691830-108691852 CCTGCCCACCTGCTTCCTTGTGG - Intergenic
1058869949 9:109192907-109192929 CCTGGCCATCTCTCTCCTTGGGG - Intronic
1059586347 9:115611530-115611552 CCTCCTCAGCTACCCCCTTGGGG + Intergenic
1060885845 9:127151476-127151498 CCTTCCCACCTGCTTCCCTGTGG - Intronic
1061478503 9:130884783-130884805 CCTTTCCAGCTTCTTCCTTGTGG - Exonic
1061595489 9:131626266-131626288 CCTTTCCAGCTGCCTCTTGGCGG - Exonic
1062224115 9:135439427-135439449 CCTGCACATCTCTCTCCTTGTGG + Intergenic
1186414214 X:9369477-9369499 TCTTCCTTGCTCCCTCCTTGAGG + Intergenic
1189947543 X:46194558-46194580 CCTTCCTATCTCCCTCTTAGAGG - Intergenic
1190324332 X:49197607-49197629 CCTGCCCAGCTCCCACCTCGAGG - Intronic
1190335890 X:49261430-49261452 CTTTTCCAGCTCCCCCCATGAGG - Intronic
1191980099 X:66916165-66916187 CTCTCCCAGCTCCCTCCCTGTGG + Intergenic
1192139103 X:68632456-68632478 CTTTACCAGCTCCCTACATGAGG + Intergenic
1192152843 X:68722717-68722739 CCTCCCCGGCTCCTTCCTTTGGG - Intronic
1192912907 X:75624136-75624158 CCTTCCCACCTCCATCATTGGGG + Intergenic
1193312641 X:80025799-80025821 CCTTGGCACCTCCCTCCTCGGGG - Intronic
1194336269 X:92650317-92650339 TCTTTACAGCACCCTCCTTGGGG + Intergenic
1194400529 X:93434256-93434278 CCTGCACATCTCTCTCCTTGTGG - Intergenic
1198428521 X:136543193-136543215 CTTTCACAGCTGCCTCCCTGGGG - Intronic
1198439179 X:136645516-136645538 CCTTTCCAGCTTCCTCATTTGGG - Intergenic
1198970046 X:142269738-142269760 CCTGCGCAGCTTTCTCCTTGTGG - Intergenic
1199637473 X:149826922-149826944 CCCTCCCCCCACCCTCCTTGTGG - Intergenic
1200644700 Y:5767062-5767084 TCTTTACAGCACCCTCCTTGGGG + Intergenic
1200948267 Y:8867212-8867234 CCTGCACATCTCTCTCCTTGCGG - Intergenic