ID: 1184745443

View in Genome Browser
Species Human (GRCh38)
Location 22:46453078-46453100
Sequence CCCTGCCATGCCTCGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184745429_1184745443 19 Left 1184745429 22:46453036-46453058 CCCCACTGAGCACTTGGCTCCTG 0: 1
1: 0
2: 0
3: 36
4: 242
Right 1184745443 22:46453078-46453100 CCCTGCCATGCCTCGGAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 212
1184745437_1184745443 0 Left 1184745437 22:46453055-46453077 CCTGATGGTAGGGAGAGGGCTGG 0: 1
1: 0
2: 1
3: 31
4: 271
Right 1184745443 22:46453078-46453100 CCCTGCCATGCCTCGGAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 212
1184745430_1184745443 18 Left 1184745430 22:46453037-46453059 CCCACTGAGCACTTGGCTCCTGA No data
Right 1184745443 22:46453078-46453100 CCCTGCCATGCCTCGGAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 212
1184745427_1184745443 26 Left 1184745427 22:46453029-46453051 CCTGGCGCCCCACTGAGCACTTG 0: 1
1: 0
2: 5
3: 21
4: 172
Right 1184745443 22:46453078-46453100 CCCTGCCATGCCTCGGAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 212
1184745431_1184745443 17 Left 1184745431 22:46453038-46453060 CCACTGAGCACTTGGCTCCTGAT 0: 1
1: 0
2: 1
3: 11
4: 178
Right 1184745443 22:46453078-46453100 CCCTGCCATGCCTCGGAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184745443 Original CRISPR CCCTGCCATGCCTCGGAGGG AGG Intronic
900180106 1:1307594-1307616 CCCCGCCATGCCCCGGGGGTTGG - Intronic
901228794 1:7630612-7630634 CCCTTCCCTGCTTTGGAGGGAGG - Intronic
901599179 1:10409246-10409268 CACTGGCAGGCCTAGGAGGGAGG - Intronic
904143282 1:28370071-28370093 CCCAGCCAAGTCTCGGGGGGCGG - Intronic
904744610 1:32703029-32703051 CCCTGTCCAGCCTGGGAGGGTGG + Exonic
905489726 1:38334041-38334063 CCCTGCCATACCTTGGAGGAAGG + Intergenic
905489907 1:38335216-38335238 CCTTGCCAGTCCTGGGAGGGGGG - Intergenic
906206609 1:43990730-43990752 CCCTGCACTGCCTCGCAGAGTGG + Exonic
908735963 1:67277410-67277432 CCCTGACAGGCCTCGGTGTGTGG - Intergenic
908939239 1:69411108-69411130 CCATGCCATGCCTGGGTGGGTGG + Intergenic
910915105 1:92279801-92279823 CCCTGCCATGCCTGGCTTGGTGG + Intronic
914805420 1:150987860-150987882 CGCTGCAGTGCCTAGGAGGGAGG - Exonic
915311198 1:155006651-155006673 CCCTGACAGGCCTCAGAGTGGGG + Intronic
918093859 1:181318583-181318605 CCCTTCCATGCCTCCGGGCGCGG + Intergenic
922702686 1:227771059-227771081 GCCTGGCTAGCCTCGGAGGGTGG - Intronic
1063264641 10:4434390-4434412 CCCTGTCCTGCCTCTGAGAGAGG - Intergenic
1069115275 10:64497470-64497492 CCCTGCTCTGCCTCGCCGGGTGG - Intergenic
1069932322 10:71891173-71891195 CCAAGCCATGGCACGGAGGGAGG - Intergenic
1069952198 10:72026790-72026812 CTCTGCCAGGCCTCGGCTGGAGG - Intergenic
1073148092 10:101293256-101293278 CCCTGCCTTGGCTCGGTGGCTGG + Intergenic
1073510902 10:104041715-104041737 TCCTGCCCTGCCTCTGAGTGAGG - Intronic
1076459769 10:130633918-130633940 CCGTGCCATGACAGGGAGGGAGG - Intergenic
1076737323 10:132464680-132464702 CCCTGCCCTGCCTGGCCGGGAGG - Intergenic
1077226976 11:1442820-1442842 CCCTGGCCTGCCTGGGAGAGAGG + Intronic
1077844824 11:6013146-6013168 TGCAGCCATGCCTGGGAGGGTGG + Intergenic
1079408124 11:20162903-20162925 CCCTGCCATTTTTTGGAGGGTGG + Intergenic
1083252322 11:61476479-61476501 CCCTGGCTTCCCTCTGAGGGCGG + Intronic
1083668167 11:64286296-64286318 CCCTTCCATGCCCCTGAGTGAGG + Intronic
1084553933 11:69864825-69864847 CCCAGCCATGCCCGGGAGTGGGG + Intergenic
1084564459 11:69921277-69921299 CCCTGCCACCCCTAGGAAGGTGG + Intergenic
1085284668 11:75351879-75351901 CGCTGCCCTGCCTCGCTGGGCGG - Intergenic
1087401034 11:97667312-97667334 CCGAGCCCTGCCTCGCAGGGAGG - Intergenic
1090210852 11:124920397-124920419 GCATGGCATGCCTCCGAGGGAGG + Exonic
1094526121 12:31232399-31232421 CACTGCCAGCCCTCGGAGGAGGG - Intergenic
1096257740 12:50073361-50073383 GCCTGCCCTGCCAGGGAGGGCGG - Intronic
1096707866 12:53433941-53433963 CCCTGCCAGGCCTAGGAAGAAGG - Intergenic
1096786159 12:54018333-54018355 ACCTGCCTCGCCTCGGGGGGAGG + Intronic
1096871310 12:54594118-54594140 CTCTGCCAAGCCTGGGAGGACGG - Intergenic
1100431314 12:94534107-94534129 TCCTGCCACGCCTCTGAGGCAGG - Intergenic
1102414258 12:112746931-112746953 ACCTGCAATGGCTGGGAGGGTGG - Intronic
1105661171 13:22497017-22497039 CCCTGCCAGGCCGCGCTGGGTGG - Intergenic
1106921959 13:34573801-34573823 CCCTTCCAAGCCCAGGAGGGAGG + Intergenic
1118757484 14:68855478-68855500 CTCTGCCATGCCTGGTAGGATGG - Intergenic
1119021711 14:71121771-71121793 CCCTGCCTTGTCTCGTGGGGCGG - Intergenic
1119421524 14:74510365-74510387 CCCTGCCCTGCCTAGGTGGGAGG - Intronic
1122461970 14:101903468-101903490 GCCTGCCATGCCTCTGATGAGGG + Intronic
1122951384 14:105047074-105047096 CCCTGCCATGCCAGGCAGAGTGG + Intergenic
1122976761 14:105174059-105174081 CTCTGCCATGCTACGGGGGGTGG - Intronic
1128254589 15:66187429-66187451 CCCAGGCCTGCCTCTGAGGGTGG + Intronic
1128517495 15:68351764-68351786 CACTGACATCTCTCGGAGGGAGG + Intronic
1129123632 15:73419359-73419381 CCCTGCCATGGGGCAGAGGGTGG - Intergenic
1130227849 15:82073334-82073356 GCCTGCTATGCCTGGGAGGGCGG + Intergenic
1131429528 15:92375639-92375661 CCCCGCCATGCCTCTGAAAGTGG - Intergenic
1131697329 15:94892159-94892181 CTCTGCCCTACCTCAGAGGGAGG - Intergenic
1132544814 16:528155-528177 CCCTGCCCTGGCTCGGAGCCCGG - Intronic
1132591860 16:729566-729588 ATCTGCCCAGCCTCGGAGGGTGG + Exonic
1132973919 16:2702151-2702173 CCATGCCATGCCACGGCGTGGGG + Intronic
1133944714 16:10338642-10338664 CCCAGCCAGGTCTGGGAGGGAGG + Intronic
1135757256 16:25108354-25108376 CCTTGTCATGCTTCAGAGGGTGG - Intergenic
1137408629 16:48209376-48209398 CCCTGCCATCCCTCAGTTGGTGG - Intronic
1141784928 16:86193201-86193223 GCCTGCCCTGCCACGGAGGCTGG - Intergenic
1142127641 16:88418123-88418145 CCCTGCCAGGCCCAGGATGGGGG + Intergenic
1142127869 16:88419209-88419231 CCGTGCCAAGCCACGGAAGGGGG + Intergenic
1142338756 16:89507607-89507629 CCCTGCCCGGGCCCGGAGGGCGG + Intronic
1142580043 17:936341-936363 CGCTGCAGTGCCTCAGAGGGAGG - Intronic
1143256693 17:5562771-5562793 CCCTGCCATGCCACTGTGGCTGG + Intronic
1144950210 17:18989867-18989889 CCCTGACCTGACTCGGAGGTAGG - Intronic
1146103168 17:30005655-30005677 CCCTGCCATGACAAGAAGGGAGG + Intronic
1147511218 17:41070249-41070271 ACCTGCCATTCCTCTGTGGGAGG + Intergenic
1148000003 17:44382134-44382156 CCCTGTGATGCCTCAGGGGGTGG - Intronic
1148701291 17:49588551-49588573 TCCTGCCAAGCCTGGGTGGGAGG + Intergenic
1148760371 17:49996797-49996819 CCCGGCCAAGCCTCGGGGAGGGG + Intergenic
1151797813 17:76358136-76358158 CCCTGCAATGCTTCTGTGGGAGG - Intronic
1152278699 17:79372665-79372687 CCCTGCCCTGCCCCTGTGGGTGG - Intronic
1157742498 18:50106070-50106092 CCCTTCCCTGCCTCAGAGAGTGG + Intronic
1158387515 18:57012310-57012332 CCCTGCCATCCCTGTGAGGACGG - Intronic
1159456362 18:68664145-68664167 CCCAGCCATGCCTCCCAGTGAGG - Intergenic
1160236139 18:77087992-77088014 CCTTGCCTGGGCTCGGAGGGTGG - Intronic
1160484144 18:79272925-79272947 GCCTTCCATGCTTCGTAGGGAGG - Intronic
1160522281 18:79514617-79514639 CCCTGGCATGCCTCCGAAGCAGG + Intronic
1160696851 19:489064-489086 TCCCGCCATGCCGCGGAGCGCGG - Intergenic
1161354849 19:3813341-3813363 ACCTGCCAGGCCTGGGAGGGTGG - Intronic
1161978358 19:7618318-7618340 CCCCGGCCAGCCTCGGAGGGGGG - Intergenic
1162581519 19:11534054-11534076 CCCTGCCATGTCTCCCAGGCTGG + Intergenic
1162757171 19:12867356-12867378 CGGAGCCAGGCCTCGGAGGGTGG + Intronic
1163644377 19:18480134-18480156 CCCTGCCAAGCCACGGCGTGTGG + Intronic
1164483223 19:28632483-28632505 AGCTGCCATGCCAAGGAGGGAGG + Intergenic
1164744413 19:30600585-30600607 ACCTGCCATGCATTTGAGGGAGG + Intronic
1165350004 19:35270011-35270033 CCCTGCCACCCCTGGGTGGGGGG + Intronic
1165579547 19:36850341-36850363 CCCCGCCCAGCCTCAGAGGGCGG - Intronic
1166855455 19:45780854-45780876 CCCTGCCAGGCCTGGGGCGGGGG - Intronic
1166944272 19:46387520-46387542 CCCAGCCCTGCCTCGGAGGATGG + Intronic
1167105767 19:47429319-47429341 CCCAGCCACGCCTTGGAGGGAGG - Exonic
1167522140 19:49961275-49961297 CCCTGGCCAGCCTCGGAGGTGGG + Intergenic
1167523241 19:49969450-49969472 CCCTGGCCAGCCTCGGAGGTGGG - Intergenic
1168327188 19:55544464-55544486 CCCTGCTCTGCCTCGGACTGCGG + Intronic
925013256 2:501974-501996 CCCTGAGATGCCTCTGAGGCAGG - Intergenic
926129441 2:10292456-10292478 CCCAGCCATGCCAGGGATGGAGG - Intergenic
926592048 2:14750558-14750580 CCCTGCCAAGCCTGGGTGGAGGG - Intergenic
927724470 2:25410682-25410704 CCCTGCCATGACGAGGCGGGGGG + Intronic
927883390 2:26704427-26704449 CCATGCCAAGCCTCGGAGCCCGG - Intronic
928180187 2:29063170-29063192 CCCTGCCCTGCCTGGGTGGCTGG + Exonic
929218081 2:39437010-39437032 CCCTCCCCTGCCCGGGAGGGAGG - Exonic
929777292 2:44937325-44937347 CACTGCCAGGCCCAGGAGGGTGG - Intergenic
935789995 2:106582200-106582222 CCCTGCCATGCGTGGGGTGGAGG - Intergenic
935872819 2:107469555-107469577 CCCAGCCCTGCCTCGCGGGGAGG + Intergenic
936041747 2:109155072-109155094 CCTTGCCCTGGCCCGGAGGGAGG - Intronic
937036637 2:118787625-118787647 CCATCCCATCCCTGGGAGGGCGG - Intergenic
938092850 2:128444589-128444611 CTCTGCCAGGGCTCAGAGGGAGG + Intergenic
938569018 2:132545169-132545191 CCCTGCCATGGCACAGAGGAGGG - Intronic
942947259 2:181684090-181684112 CCCCGCCCTGCCTAGGAGTGGGG + Intergenic
944542596 2:200767735-200767757 CCCTGCCTTGCCTCTGAGTCTGG - Intergenic
945515217 2:210755364-210755386 CCCTGTGAGGCCTTGGAGGGAGG - Intergenic
946331964 2:219014537-219014559 CCCTGACATGCCTAGGACTGCGG + Intronic
947584256 2:231342893-231342915 CCCTGCCCTGACTAGGAGGTGGG - Intronic
948415251 2:237798414-237798436 CCCTGTCCCGCCTCTGAGGGCGG + Intronic
948708945 2:239813406-239813428 CCCTGCCATTCCCAGGAGGAGGG + Intergenic
948802003 2:240437239-240437261 CCATGCCTTGCCGCGGGGGGCGG + Intronic
1171094195 20:22315870-22315892 TCGTGCCATGCCTTGCAGGGAGG - Intergenic
1175935944 20:62514114-62514136 CTCTGCCAGGCCTCGGAGCTGGG + Intergenic
1175958985 20:62625602-62625624 CCATGCCAAGCCGCGGAGAGAGG + Intergenic
1176064280 20:63186787-63186809 ACCTGCCTGGCCTGGGAGGGTGG - Intergenic
1178327016 21:31654416-31654438 CCGAGCCATGCCCCGCAGGGAGG - Intergenic
1181838264 22:25629155-25629177 CTCTGCCTTGCCTCGGGGAGCGG + Intronic
1181876410 22:25944133-25944155 CTCTGCCATGGCTAGGAGGTGGG - Intronic
1182736236 22:32533614-32533636 CCTTTCGATGCCTCTGAGGGTGG + Intronic
1183543822 22:38444930-38444952 CAGTGCCTTGCCTTGGAGGGCGG + Intronic
1184089008 22:42282773-42282795 GGCTGCCATGCCTGGGAGGAGGG + Intronic
1184745443 22:46453078-46453100 CCCTGCCATGCCTCGGAGGGAGG + Intronic
1184757738 22:46526423-46526445 CCCTGCCTTCCCTCTGAGGCTGG + Intronic
1184836151 22:47022315-47022337 CCGGGCCATCCCTGGGAGGGAGG + Intronic
1185208883 22:49555560-49555582 CCCTCACAGCCCTCGGAGGGCGG + Intronic
949779688 3:7672068-7672090 CCCTCCCCTGCCCCGGGGGGAGG + Intronic
950681248 3:14586501-14586523 CCCTGCCCTCCCCCGGAGGCTGG + Intergenic
954116606 3:48470067-48470089 TCCTCCCATGCCTCTGAGGGTGG - Intronic
954388173 3:50255241-50255263 CCCTGCCATGCCCTGGAGGCTGG - Intronic
954812712 3:53257778-53257800 ACCTGCCAGGCATCTGAGGGTGG - Intergenic
956166571 3:66402119-66402141 CCATGGCATTCCTCGGAGGGAGG - Intronic
961932295 3:130547191-130547213 CCGAGCCATGCCCCGCAGGGAGG + Intergenic
964375068 3:156041505-156041527 CCCAGCCCTGCCCCGCAGGGAGG - Intronic
966427873 3:179799752-179799774 CCCTGCCATGGCTTGGAGGCTGG + Exonic
968090513 3:195895806-195895828 CCCCGGGATGCCTCGGAGGAGGG - Intronic
968469694 4:773752-773774 CCCTGCCCTGCCCTGCAGGGAGG - Intergenic
968598158 4:1495932-1495954 CCCTGCCCTGCCAGGGAGGATGG + Intergenic
968707259 4:2085560-2085582 CCCTGCCAACCCTCTGTGGGAGG - Intronic
969105561 4:4804787-4804809 CCCTGCCCTGCCTCCAATGGAGG - Intergenic
973884149 4:55303813-55303835 CCCTGGCAGGACTTGGAGGGTGG - Intergenic
975376591 4:73652952-73652974 CCCTGCCATGGCTGAGAGTGAGG + Intergenic
984875015 4:184359869-184359891 TCCTCAGATGCCTCGGAGGGAGG - Intergenic
989516800 5:42353485-42353507 CCCTCCCATGCCTCGCTTGGTGG + Intergenic
990528369 5:56650632-56650654 CCCTGCCGTGCTGCAGAGGGTGG - Intergenic
994239892 5:97407391-97407413 CCCAGCCCTGCCCCGCAGGGAGG - Intergenic
994620368 5:102155168-102155190 CCCAGCCCTGCCTCGCGGGGAGG - Intergenic
997946854 5:138210280-138210302 CCCTGGGATGCCTCGGTGGGTGG + Intronic
998031064 5:138868436-138868458 CCATGCCACTCCTAGGAGGGAGG - Intronic
998129274 5:139643195-139643217 GCCTGCCAGGCCTGGGAGGAGGG - Intergenic
1001602792 5:172939891-172939913 CCCTGGGAGCCCTCGGAGGGCGG + Intronic
1001948183 5:175797340-175797362 CACGGCCAGGCCTCGGCGGGCGG - Intronic
1002435311 5:179227757-179227779 CCCTGCTGTGCCAAGGAGGGAGG + Intronic
1004862548 6:19819778-19819800 TCCTGCCATGCCTCCCAGGCAGG + Intergenic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1006438697 6:34040304-34040326 CCCTGCGATGCCTGTAAGGGTGG + Exonic
1006780297 6:36627856-36627878 CCCTGCCTTGGCCCGGAGGGAGG - Intergenic
1007519426 6:42440049-42440071 CCCTGCCAGGCCACGGTGGGTGG - Intronic
1007740457 6:44006488-44006510 CTCTCACATGCCTCGGAGGAGGG + Intergenic
1008844860 6:55950540-55950562 CCGTGCCCTGCCCCGCAGGGAGG - Intergenic
1010624727 6:78123511-78123533 CTCTGCCATGACTCGATGGGAGG - Intergenic
1012432908 6:99185139-99185161 CCCAACCATGCCTTGAAGGGTGG - Intergenic
1013260054 6:108432798-108432820 CCCTGAAATGCCTGGGAGTGGGG + Intronic
1019297988 7:289363-289385 CCCCGCCAGGGCCCGGAGGGAGG - Intergenic
1019557601 7:1640533-1640555 TCCTGCCGTGTCTCGGAAGGGGG + Intergenic
1019712187 7:2522786-2522808 CCCTGACAGCCCTCGGAGGTGGG - Intronic
1021925428 7:25529552-25529574 CCCTGCTCTGCCTCGCCGGGTGG + Intergenic
1022828002 7:34036437-34036459 TCCTGCCATGCCTCTGAGCCTGG - Intronic
1022989596 7:35694830-35694852 CCCTGCCTGGGCGCGGAGGGCGG - Exonic
1023349985 7:39310813-39310835 CCCTGCCTTGCCTCAGAGCAGGG + Intronic
1023638404 7:42236446-42236468 CCGGGCTATGCTTCGGAGGGCGG - Intronic
1023830988 7:44038975-44038997 CTCTGCCAGGCCAGGGAGGGAGG + Intergenic
1024053427 7:45644585-45644607 CCCTTTCAAGCCTGGGAGGGAGG + Intronic
1024623886 7:51188031-51188053 CCCTCACAAGCCTCAGAGGGGGG + Intronic
1025850014 7:65237620-65237642 CCCTCCCAGGCCTCCCAGGGTGG + Intergenic
1026852660 7:73734947-73734969 CCCTGCCAGGCCAAGGAGGAAGG - Intergenic
1027673353 7:81129499-81129521 CCCTGCTCAGCCACGGAGGGGGG + Intergenic
1029452194 7:100647385-100647407 CCCTGCCATGAATCGGGGGCGGG - Intronic
1029535364 7:101154634-101154656 GCCTCCCTTGCCTCGGCGGGTGG + Intronic
1029741322 7:102493284-102493306 CTCTGCCAGGCCAGGGAGGGAGG + Exonic
1029759312 7:102592453-102592475 CTCTGCCAGGCCAGGGAGGGAGG + Exonic
1029776681 7:102688363-102688385 CTCTGCCAGGCCAGGGAGGGAGG + Intergenic
1029991630 7:104967664-104967686 CCCTGCCAGGCCTAGCAGGCTGG - Intergenic
1032159975 7:129502642-129502664 CCCCGCCACGCCTCGCTGGGAGG - Exonic
1034431451 7:151043294-151043316 ACTTGCCCTGCCTCTGAGGGTGG - Intronic
1035274630 7:157740419-157740441 CCCTGCCTTGCCGTGGATGGAGG - Intronic
1035455751 7:159007531-159007553 CCCAGCTATGCCAGGGAGGGCGG + Intergenic
1035455770 7:159007609-159007631 CCCAGCTATGCCAGGGAGGGCGG + Intergenic
1035767579 8:2119540-2119562 CCCTGCCTTGCCAGGGAGTGGGG - Intronic
1037749792 8:21673836-21673858 ACCTGCCATCCCTCAGTGGGTGG - Intergenic
1039474840 8:37834155-37834177 CCCTGGCATGCAGAGGAGGGAGG + Intronic
1042710563 8:71712777-71712799 CCAGGCCATGCCTCGGGGGAGGG + Intergenic
1046521372 8:115330699-115330721 CCAAGCCCTGCCTCGCAGGGAGG + Intergenic
1048676940 8:136793931-136793953 CCCAGCCCTGCCCCGCAGGGAGG + Intergenic
1049472715 8:142783486-142783508 CCCTGCAGTGGCTGGGAGGGGGG + Intergenic
1049602590 8:143514821-143514843 TCCTGTCCTGCCTCGGAGAGTGG - Intronic
1050547025 9:6717619-6717641 CCCTGCCCTGTCTCATAGGGAGG - Intergenic
1051665362 9:19463427-19463449 CCCCTCCCCGCCTCGGAGGGAGG - Intergenic
1052950175 9:34202420-34202442 CCCTGCCCTGCCTGTGAGAGGGG + Intronic
1056541580 9:87575952-87575974 CCCAGCTATGCCTGGGAGGAAGG + Intronic
1057186196 9:93058759-93058781 CCTCGCCTTGCCACGGAGGGTGG - Exonic
1058653144 9:107195703-107195725 CCCTGCCAACCCTCGGGGGTGGG + Intergenic
1060906870 9:127314569-127314591 CCCTCTCCTGCCTTGGAGGGAGG - Intronic
1060934789 9:127508629-127508651 CCCTGGCAGGCCTCGGGGTGGGG - Intronic
1061280828 9:129597039-129597061 CCCTCCCATCCCCCGCAGGGAGG + Intergenic
1061615093 9:131774216-131774238 CCCTCCCCTCACTCGGAGGGTGG + Intergenic
1062482142 9:136757467-136757489 CCCTGCCTGACCTCGGAGGCAGG + Intronic
1062556415 9:137115055-137115077 CCCGGCCCTGCCTTGGAGTGGGG - Intronic
1062627299 9:137449118-137449140 ACCTGCCATGCCTCGCCTGGAGG - Exonic
1062722167 9:138050240-138050262 TCCTGCCATGCCTCTGGGAGCGG + Intronic
1190225239 X:48539943-48539965 CCCTGGGATGCCTCGGCGGCTGG - Intronic
1190290853 X:48991160-48991182 CCTTGCCATGCCTCGAATAGAGG + Intronic
1190318369 X:49165318-49165340 CCCTGGCAAGCCTCGAGGGGTGG + Exonic
1190620823 X:52285132-52285154 CCCGGCCATGCCTCTGAGATCGG + Intergenic
1197819402 X:130529876-130529898 CACTGCCAGGCCTGAGAGGGCGG - Intergenic
1198269946 X:135047305-135047327 CCCTTTCATGCCTTGGTGGGAGG + Intergenic
1198438057 X:136636338-136636360 CCTTCCCCTGCCTGGGAGGGTGG - Intergenic
1198806528 X:140500569-140500591 CCCTCCCAGGCCTGGGAGTGTGG + Intergenic
1200058025 X:153471656-153471678 CCCTGCCATCTCCTGGAGGGTGG + Intronic
1200065499 X:153502530-153502552 CCCTGCCCTGCCCTGGAGGAAGG + Intronic
1200164970 X:154029700-154029722 CTCTGGCATGGCTAGGAGGGGGG - Intronic