ID: 1184746809

View in Genome Browser
Species Human (GRCh38)
Location 22:46460985-46461007
Sequence AGGGGCTTTCAGCAGCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184746799_1184746809 23 Left 1184746799 22:46460939-46460961 CCTTCATCCAGCTCCTGCTGTCT No data
Right 1184746809 22:46460985-46461007 AGGGGCTTTCAGCAGCCACTTGG 0: 1
1: 0
2: 1
3: 39
4: 296
1184746807_1184746809 -6 Left 1184746807 22:46460968-46460990 CCGCAACACAAGAAGCCAGGGGC No data
Right 1184746809 22:46460985-46461007 AGGGGCTTTCAGCAGCCACTTGG 0: 1
1: 0
2: 1
3: 39
4: 296
1184746800_1184746809 16 Left 1184746800 22:46460946-46460968 CCAGCTCCTGCTGTCTCCTGTCC 0: 1
1: 0
2: 8
3: 79
4: 1093
Right 1184746809 22:46460985-46461007 AGGGGCTTTCAGCAGCCACTTGG 0: 1
1: 0
2: 1
3: 39
4: 296
1184746805_1184746809 -5 Left 1184746805 22:46460967-46460989 CCCGCAACACAAGAAGCCAGGGG 0: 1
1: 0
2: 2
3: 19
4: 231
Right 1184746809 22:46460985-46461007 AGGGGCTTTCAGCAGCCACTTGG 0: 1
1: 0
2: 1
3: 39
4: 296
1184746801_1184746809 10 Left 1184746801 22:46460952-46460974 CCTGCTGTCTCCTGTCCCGCAAC 0: 1
1: 0
2: 0
3: 7
4: 158
Right 1184746809 22:46460985-46461007 AGGGGCTTTCAGCAGCCACTTGG 0: 1
1: 0
2: 1
3: 39
4: 296
1184746802_1184746809 0 Left 1184746802 22:46460962-46460984 CCTGTCCCGCAACACAAGAAGCC No data
Right 1184746809 22:46460985-46461007 AGGGGCTTTCAGCAGCCACTTGG 0: 1
1: 0
2: 1
3: 39
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184746809 Original CRISPR AGGGGCTTTCAGCAGCCACT TGG Intronic
900725442 1:4213624-4213646 AGTGGCATTCATCAGCAACTGGG - Intergenic
900791180 1:4681872-4681894 AGGGGATGACAGCAGCCTCTGGG + Intronic
900849699 1:5132823-5132845 GGGTCCTTTCAGCAGCCTCTGGG - Intergenic
901068581 1:6506246-6506268 AGGGGGTTTCAGGGACCACTGGG + Intronic
901081469 1:6586416-6586438 GAGGCCTGTCAGCAGCCACTAGG + Intronic
904593538 1:31628615-31628637 ATCGGGTTTCAGCAGACACTTGG + Intronic
904929106 1:34072452-34072474 CAGTGCTGTCAGCAGCCACTTGG + Intronic
905441331 1:37998054-37998076 AGTGGCTGTGAACAGCCACTGGG - Exonic
905651405 1:39659455-39659477 AAGGGCTTTCTGGAGGCACTGGG - Exonic
907352156 1:53841085-53841107 TGGTGCTTTCAGCAGCTACAGGG - Intergenic
907422520 1:54356889-54356911 AGGGACTTTCCTCAGCCTCTTGG + Intronic
907707439 1:56845056-56845078 AGCGGATTTCAGCAGCTCCTGGG - Intergenic
907723356 1:56995084-56995106 ATGGGGTTTCAGGAGACACTGGG + Exonic
909695610 1:78465291-78465313 AGGGGCTGTCAGTTGCCTCTGGG + Intronic
909873970 1:80779554-80779576 AGGGGCTTTCAGTTGCCTTTGGG - Intergenic
910902625 1:92138080-92138102 AGGTTGTTTCAGCAGCTACTAGG + Intronic
912247458 1:107975057-107975079 AGGGACTGCCAGAAGCCACTGGG + Intergenic
915262677 1:154689383-154689405 GGGGGCTGTGGGCAGCCACTAGG - Intergenic
915685469 1:157627750-157627772 AGGTGCCTTCAGGAACCACTGGG + Intergenic
916268657 1:162917857-162917879 AGGGGATTTCAGTTGCCTCTGGG + Intergenic
916532802 1:165674229-165674251 AGGGGCAACCAGCAGCCCCTGGG + Intronic
917173294 1:172201719-172201741 AGAGGCTTTCAGTTGCCCCTGGG + Intronic
920082169 1:203382746-203382768 TGGGGCTTTCAGGAACCACTTGG - Intergenic
920689141 1:208132337-208132359 AGGAGCCTTCTGCAGCCACAGGG + Intronic
920944857 1:210519023-210519045 AGGTCATTTCAGCAGCTACTAGG + Intronic
922422306 1:225468094-225468116 AGGGGCTCTCGGAGGCCACTGGG + Intergenic
922430888 1:225551930-225551952 AGATGATTTCAGCAGCCAATTGG + Intronic
923427115 1:233882096-233882118 AGGTACTTTCAGCAGCCAATGGG - Intergenic
923723489 1:236487030-236487052 AGGGGCTTTCTGGAGGCACTTGG - Intergenic
1063668848 10:8083513-8083535 GGGGGCTTGGAGCTGCCACTTGG + Intergenic
1066081268 10:31933004-31933026 AGGTCATTTCAGCAGCTACTAGG - Intergenic
1066212637 10:33254919-33254941 AGGGGCCTTCAGCAGGGACGTGG + Intronic
1068711749 10:60142402-60142424 AGGGGATCTCACCAGCCAATGGG - Intronic
1069720234 10:70545066-70545088 AGGGGCTTTCTGCCGGCACCTGG - Intronic
1070641966 10:78176796-78176818 AGGGGCGTTCAAAAGCCACTGGG + Intergenic
1071798224 10:89028697-89028719 ATAGGGTTTCAGCAGCAACTTGG + Intergenic
1071861637 10:89680002-89680024 AAGGGCTTTCAGCAGCAAATAGG + Intergenic
1072922967 10:99592094-99592116 AGGGGCTGGCAGCAGCCCCAAGG - Intergenic
1074891432 10:117739414-117739436 AGGGGATGTCAGCTGCCTCTGGG + Intergenic
1076218752 10:128716389-128716411 AGAGTCATTCAGCAACCACTGGG - Intergenic
1076445853 10:130513317-130513339 AGGGGCTCACAGCACCCACGAGG + Intergenic
1076828239 10:132981284-132981306 AGGGGCTGGCAGCAGCAGCTTGG - Intergenic
1076874253 10:133208162-133208184 CAGGGCTCTCAGCAGCCAGTGGG + Intronic
1077887607 11:6397222-6397244 AGTGGCTCTCAGCTCCCACTAGG + Intronic
1077909895 11:6564459-6564481 AGGGGCTTTCAGGAGGCTCTGGG + Exonic
1078428356 11:11269031-11269053 AGGGGCATTCAGGAGCAACTGGG + Intergenic
1080967038 11:37224949-37224971 AGCTGCCTTCAGCAGCCCCTTGG + Intergenic
1081670136 11:44938170-44938192 AGGGGCCTCCGGCACCCACTGGG - Intronic
1082083639 11:48031496-48031518 AGGTGCTTCCAGCAGGCACGTGG + Intronic
1082615758 11:55357228-55357250 AGAGGCTTTCAGTTGCCTCTGGG - Intergenic
1082974275 11:59056989-59057011 AGGGGATTTCAGGATGCACTGGG + Intergenic
1084548272 11:69825362-69825384 AGGGACCTTCTGCAGCCACCTGG + Intergenic
1084661462 11:70548921-70548943 AGGGGTTGCCAGCAGCCACCGGG + Intronic
1085427416 11:76416797-76416819 AGAGCATTTCAGCAGCCATTTGG - Intergenic
1085445750 11:76599522-76599544 AGGGGCTTACCCCAGCCACACGG - Intergenic
1088654207 11:111983847-111983869 AAGGGCTCACAGCATCCACTGGG + Intronic
1089082410 11:115787977-115787999 CGGGGCTGTCAGAAGCCAATGGG + Intergenic
1089504728 11:118955897-118955919 AGGCCCTTTCAGTAGCCCCTTGG + Intronic
1089920937 11:122208992-122209014 AGAGACTTTCAGCCCCCACTGGG + Intergenic
1090637953 11:128704313-128704335 AGGGGCTCTCAGCAGGTGCTTGG + Intronic
1091277495 11:134362440-134362462 AGAGGCTCTCGGCTGCCACTCGG + Intronic
1091575228 12:1727707-1727729 AGGCCCTTTCAGTAGCCCCTTGG + Intronic
1091741571 12:2963520-2963542 GGGGGCTGTCAGCAGCCAGGAGG + Intronic
1092637642 12:10468921-10468943 AGGGGCTCTCAGTTGCCTCTGGG + Intergenic
1093769990 12:23007127-23007149 AGGGCATTTCAGGAGCTACTTGG - Intergenic
1095201887 12:39394593-39394615 AGGGGATTTAAGCAGTCACTGGG - Intronic
1096150117 12:49304260-49304282 AATGGCTGTCAGCAGCTACTGGG + Intergenic
1096531860 12:52247608-52247630 GGTGGCTTTAAGCAGCCAGTGGG - Intronic
1096972919 12:55681942-55681964 AGGGGCTTACAGGAGCCTCCGGG + Exonic
1098632435 12:72740589-72740611 AGGGGCTATCAGTTGCCTCTGGG - Intergenic
1099246127 12:80195729-80195751 ATGGGCATTCAGGAGCCACCAGG - Intergenic
1101436892 12:104671812-104671834 AGAGGCTTTCAACAGCCAAATGG + Intronic
1103340848 12:120220436-120220458 AGGCGGGTTCAGCAGCCCCTGGG - Intronic
1104481202 12:129109931-129109953 AGGGGCCTTCAGAAGCCACCTGG + Intronic
1106208594 13:27621163-27621185 AGGAGGTTTGAGGAGCCACTGGG + Intronic
1107162569 13:37248806-37248828 AGGTTGTTTCAGCAGCTACTAGG - Intergenic
1107187904 13:37546233-37546255 TGGGGCTTTCAGTTGCCTCTGGG + Intergenic
1113819837 13:113204987-113205009 AGGGGCATGCAGCAACCACAAGG - Intronic
1114527901 14:23377872-23377894 AGGGGCTCCCAGAAACCACTGGG + Intronic
1115091654 14:29584007-29584029 TGGGACTTTCAGCAGCTATTAGG + Intronic
1115144649 14:30212361-30212383 ATGGGCAATCAGCAGCCCCTGGG + Intergenic
1116815232 14:49577567-49577589 AGGAACTTCCAGAAGCCACTGGG + Exonic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1118666419 14:68075362-68075384 AGGGGCTTTCAGTTGCCTCTGGG + Intronic
1119456064 14:74756537-74756559 AGGGTCTTTCAGCACCTAGTTGG - Intergenic
1119646666 14:76353329-76353351 AGGGCCTTTCAGCTGCCCATCGG - Intronic
1120905807 14:89620064-89620086 AAGGGCTTTCAGCAACCTCTTGG + Intergenic
1122309238 14:100784090-100784112 AGGGGCTGCCAGCAGACACCTGG + Intergenic
1123137714 14:106045119-106045141 TGGGGCTTTCAGTAACCACGAGG - Intergenic
1123474710 15:20581692-20581714 AGGGGCCCTCCGCAGCCACCGGG + Intergenic
1123474863 15:20582358-20582380 AGGGGCCCTCCGCAGCCACCGGG + Intergenic
1123643148 15:22417999-22418021 AGGGGCCCTCCGCAGCCACCGGG - Intergenic
1123643301 15:22418665-22418687 AGGGGCCCTCCGCAGCCACCGGG - Intergenic
1123803860 15:23851610-23851632 TGGGGCTCTCAGTAGCCAATTGG - Intergenic
1123877942 15:24642764-24642786 GGGGGCTGTCAGTTGCCACTGGG - Intergenic
1124707140 15:31975493-31975515 CGGGGCTGTCGCCAGCCACTGGG - Intergenic
1124927550 15:34086082-34086104 AGGAACTTCCAGAAGCCACTGGG + Intronic
1125274653 15:37978057-37978079 AGGTGCTTTCAGTTGCCTCTGGG + Intergenic
1125502034 15:40245855-40245877 AGGAGCAGGCAGCAGCCACTGGG + Intronic
1128148249 15:65344655-65344677 CAGGGCTCTCAGCAGCCTCTAGG + Intronic
1128923024 15:71629442-71629464 AGGGCCTTTCCGCAGCTGCTGGG + Intronic
1132712629 16:1276337-1276359 AGCGGCGGTCAGCACCCACTGGG + Intergenic
1133234972 16:4383603-4383625 AGGGCCCCTCAGCAGCCCCTGGG + Intronic
1136525200 16:30825221-30825243 AGGGGCTGTCAGCACCCCATAGG + Intergenic
1136662053 16:31771790-31771812 ACAGATTTTCAGCAGCCACTTGG + Intronic
1138069705 16:53980660-53980682 GGTGGCATTAAGCAGCCACTGGG + Intronic
1138811908 16:60160914-60160936 ATGAGCTTTCAGCAGCCAGGTGG + Intergenic
1139323781 16:66135774-66135796 AGTGGGTGTCAGCAGCCCCTGGG + Intergenic
1141443740 16:84045246-84045268 AGGGCCCTTCAGCAGCGGCTGGG + Intergenic
1148694867 17:49552664-49552686 GGAGGCTTCCAGCTGCCACTGGG - Intergenic
1150006102 17:61469967-61469989 AGGGACTTTCTCCAGCCACATGG + Intronic
1150700416 17:67442423-67442445 ATGGGCATTCTGCAGCCAGTGGG + Intronic
1150815683 17:68390290-68390312 AGGATCCTTCAGCAGCCCCTTGG + Intronic
1151384117 17:73744724-73744746 AGGGGATTTAATCAGCCTCTTGG + Intergenic
1151935705 17:77259605-77259627 AGGGGCCTTCTGCAGCCAGGTGG + Intergenic
1152126515 17:78450498-78450520 AAGGGCTCTCAGCAGCAGCTGGG + Intronic
1152808506 17:82370399-82370421 AGGTCGTTTCAGCAGCTACTCGG + Intergenic
1156894463 18:42229599-42229621 AGGGGCTTTCTGCAGTCCCAGGG + Intergenic
1156994339 18:43447903-43447925 AGGGGCTGTCAGTTGCCACAGGG - Intergenic
1158974999 18:62703277-62703299 AGGGGCTTTAAGCTACCACAGGG - Intergenic
1159994794 18:74953765-74953787 AGGGGCTGTCTGCAGCCAGCTGG - Intronic
1160040779 18:75343649-75343671 ATGGGCTAAGAGCAGCCACTTGG + Intergenic
1160207638 18:76848250-76848272 AGGGGCTTTCTTGAGCTACTTGG + Intronic
1161235160 19:3194003-3194025 CGGGGCTGTCATCAGCTACTGGG + Intronic
1161590241 19:5126233-5126255 AGGGGACACCAGCAGCCACTGGG - Intronic
1163514432 19:17754536-17754558 AGGGGCTGTGATCAGCCACATGG - Intronic
1168209784 19:54882019-54882041 AGGGGCTGTCAGTTGCCTCTGGG + Intronic
1202647031 1_KI270706v1_random:152535-152557 AGGGGCCATCTGCAGCCACAGGG + Intergenic
1202647111 1_KI270706v1_random:152826-152848 AGGGGCCCTCTGCAGCCACCGGG + Intergenic
925684598 2:6458463-6458485 AGGGCCTTTCAGTGGCCTCTGGG + Intergenic
925752220 2:7099027-7099049 AGGGGCTTGGCCCAGCCACTAGG + Intergenic
926195357 2:10760552-10760574 AGGGGCCTCCAGAAGCCTCTGGG - Intronic
926198817 2:10778985-10779007 AGCGCCTTCCAGGAGCCACTCGG - Intronic
928332692 2:30369814-30369836 AGGGGCTTTCAGCAGGAATGGGG - Intergenic
928385619 2:30865452-30865474 CTGGGCTGTCAGAAGCCACTGGG + Intergenic
929629805 2:43447750-43447772 AGGTCGTTTCAGCAGCTACTAGG - Intronic
930599103 2:53423630-53423652 AGGGACTTTCAGTAGCATCTGGG + Intergenic
930839145 2:55826116-55826138 AGGGGCTTTCAGTTGCCTCTGGG - Intergenic
932021682 2:68094147-68094169 AGAGGCTTTCAGGTGGCACTGGG - Intronic
934650079 2:96085644-96085666 AGGGCCTCTCAGCAGCCCCATGG - Intergenic
938084568 2:128390387-128390409 AGGGGGCTTCAGCAGCCCCTGGG - Intergenic
939275378 2:139991716-139991738 AGGGGCTTTCAGTTGCCTCTTGG + Intergenic
940446699 2:153785584-153785606 AGGGGCTTTCAATTGCCCCTGGG + Intergenic
940446916 2:153786739-153786761 AGGGGCTTTCAATTGCCACTGGG - Intergenic
941527845 2:166628540-166628562 AGGGGCTTTCAGTTGCCCCTTGG + Intergenic
942127740 2:172844336-172844358 GGTGGCTTTCAGGTGCCACTTGG + Intronic
943351849 2:186805778-186805800 AGGGGCTGTCAGTTGCCTCTGGG + Intergenic
944471299 2:200055912-200055934 AGGGGCTTTCAGTTGCCTCTGGG - Intergenic
945485596 2:210392043-210392065 ATGGGATTTCACCTGCCACTAGG + Intergenic
947006293 2:225514931-225514953 AGGGGCTTTCATGAGGGACTAGG - Intronic
948703360 2:239774593-239774615 AGGGAATATCAGCAGCCACCAGG - Intronic
1169551123 20:6702379-6702401 ATGGACTTTCAGCATCCACAGGG + Intergenic
1169561962 20:6811248-6811270 AGGGGCTTTCAGAGGTCACCTGG + Intergenic
1170020158 20:11828617-11828639 GGGGGCTGTCTGCACCCACTGGG - Intergenic
1170607443 20:17884350-17884372 AGGGGCTTCCAGGAGTTACTTGG - Intergenic
1171877085 20:30586360-30586382 AGGGGCCGTCTGCAGCCACCGGG - Intergenic
1171967359 20:31540478-31540500 AGTGGCTTTCAAAACCCACTGGG - Intronic
1172783305 20:37450108-37450130 GGGGGCCTTTAGCAGCCCCTCGG - Intergenic
1173444096 20:43102557-43102579 AGGAGCTTTCTGCAGGCGCTAGG - Intronic
1176204955 20:63883284-63883306 GGAGGCTTTCACCAGCCTCTGGG - Intronic
1176226833 20:64005151-64005173 AGGTGCTTTCGGAAGCCACATGG - Intronic
1176604759 21:8819948-8819970 AGGGGCCCTCTGCAGCCACCGGG - Intergenic
1176604838 21:8820239-8820261 AGGGGCCGTCTGCAGCCACCGGG - Intergenic
1178395274 21:32237294-32237316 AGGGGCTTGCAGCAGCATCAAGG - Intergenic
1179708010 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG + Intergenic
1179838043 21:44050454-44050476 AGAGGCTTCCAGCAGCTCCTTGG + Intronic
1180099108 21:45576103-45576125 AGGGGCCTCCAGGAGGCACTGGG - Intergenic
1180127915 21:45804694-45804716 AGTGACTTTCAGGAGTCACTTGG + Intronic
1180347049 22:11711553-11711575 AGGGGCCCTCTGCAGCCACCGGG - Intergenic
1180347128 22:11711844-11711866 AGGGGCCGTCTGCAGCCACCGGG - Intergenic
1180354797 22:11829643-11829665 AGGGGCCCTCTGCAGCCACAGGG - Intergenic
1180354876 22:11829934-11829956 AGGGGCCGTCTGCAGCCACCGGG - Intergenic
1180383375 22:12162397-12162419 AGGGGCCGTCTGCAGCCACCGGG + Intergenic
1180383454 22:12162688-12162710 AGGGGCCCTCTGCAGCCACAGGG + Intergenic
1180837358 22:18936493-18936515 AGAGGCTTTGAGAAGCCAGTGGG - Exonic
1183395385 22:37568400-37568422 AGGGGTTTGCAGCAGGCGCTGGG - Exonic
1184263226 22:43331823-43331845 TGGGCCTTTCAGAAGCCACCAGG - Intronic
1184746809 22:46460985-46461007 AGGGGCTTTCAGCAGCCACTTGG + Intronic
1203287451 22_KI270734v1_random:161792-161814 AGAGGCTTTGAGAAGCCAGTGGG - Intergenic
950504304 3:13384647-13384669 AGGTGCTGTCAGCAGTGACTAGG + Intronic
950523011 3:13507570-13507592 CAGGGCTGCCAGCAGCCACTGGG - Intergenic
953792147 3:45955878-45955900 AAGGGCTTGCAGCAGGCACTGGG + Intronic
954994001 3:54865448-54865470 AGGGGCTGACAGAGGCCACTGGG + Intronic
955864942 3:63372377-63372399 AGGGGCTTTCAGTTGCCTCTGGG - Intronic
956274211 3:67480578-67480600 ACAGGCTTTCACCAGCTACTAGG + Intronic
956762431 3:72455824-72455846 AGGGGCATTTAGCATCCACCTGG - Intergenic
959059042 3:101599412-101599434 AGGAACTTCCAGAAGCCACTGGG + Intergenic
959372366 3:105543634-105543656 AGTGACTTTCATCAGCAACTAGG - Intronic
961160120 3:124716854-124716876 TGGGGCTGTTTGCAGCCACTAGG + Intronic
961490279 3:127252515-127252537 AGGTGGTTTCAGCAGCTGCTGGG + Intergenic
961781933 3:129325505-129325527 AGGGGCCCTCAGCATCCACATGG + Intergenic
962323414 3:134410261-134410283 AGGTTGTTTCAGCAGCTACTAGG - Intergenic
962410614 3:135138864-135138886 AGGGCCTTTCTGAGGCCACTTGG - Intronic
962568251 3:136686069-136686091 AGGTGGTTTTAGCAGCTACTAGG + Intronic
962569340 3:136696216-136696238 AGGTGGTTTTAGCAGCTACTAGG + Intronic
962596544 3:136951843-136951865 AGGTCATTTCAGCAGCTACTAGG + Intronic
964062403 3:152539362-152539384 TGGGGCTTGCATCAACCACTAGG + Intergenic
964674162 3:159258853-159258875 AGAGGCTCTCAGAAGCCACCTGG - Intronic
965016741 3:163167996-163168018 AGGGGTTTACAGCAGGCTCTTGG - Intergenic
965113066 3:164451716-164451738 AGGGGCTTTCAGTTGCCTCTTGG + Intergenic
965295689 3:166942962-166942984 AGAGGCTATCAGTTGCCACTGGG - Intergenic
966152353 3:176878115-176878137 AGGGGCTTTCAGTTGCCCCTGGG - Intergenic
966871061 3:184290899-184290921 AAGGCCTTGCAGGAGCCACTGGG - Intronic
967869515 3:194218420-194218442 AGGGGCTCTCAGCCTCCCCTGGG + Intergenic
968291897 3:197545624-197545646 AAGGTCCATCAGCAGCCACTTGG + Intronic
968353388 3:198080926-198080948 AGGGGCCCTCCGCAGCCACCAGG + Intergenic
968353474 3:198081239-198081261 AGGGGCCCTCTGCAGCCACCGGG + Intergenic
969357662 4:6639975-6639997 AGGGGCTTTAAGCGTCCACCTGG + Intergenic
969465022 4:7351141-7351163 AGGGGCTTCCACCAGCCAATGGG - Intronic
971536234 4:27754931-27754953 AGAGGCTCACATCAGCCACTTGG - Intergenic
972496147 4:39636715-39636737 ATGGGCTTTAGGCATCCACTGGG - Intronic
973043496 4:45504722-45504744 TGGATCCTTCAGCAGCCACTGGG - Intergenic
973373365 4:49270989-49271011 AGGGGCCCTCTGCAGCCACCGGG + Intergenic
973387645 4:49524219-49524241 AGGGGCCCTCTGCAGCCACCGGG - Intergenic
973387722 4:49524510-49524532 AGGGGCCGTCTGCAGCCACCGGG - Intergenic
973820681 4:54659021-54659043 AGGGGCTTTCAGAACCCGCCAGG - Intronic
975404125 4:73969348-73969370 AGGGGTTTTCAGTAGCCTCTGGG - Intergenic
976441239 4:85077377-85077399 AGGTCGTTTCAGCAGCTACTAGG + Intergenic
977652345 4:99485044-99485066 AGAGGCTTTCAGTTGCCTCTGGG + Intergenic
977979488 4:103306005-103306027 AGGGACTTTCAGTTGCCTCTGGG + Intergenic
978608106 4:110504418-110504440 AGGGGCTTTCAGTTGCCTCTGGG + Intronic
979013100 4:115396217-115396239 AGAGGCTTTCAGTTGCCCCTGGG + Intergenic
980259515 4:130430336-130430358 AGAGACTTTGAGCAGCCACGTGG + Intergenic
981337277 4:143581551-143581573 AGGGGCTGTCAGTTGCCTCTGGG - Intronic
983456289 4:167968812-167968834 AGGGGCCCTCAGAGGCCACTTGG - Intergenic
983866723 4:172775869-172775891 AGGGACTTTTGGCAGCCTCTAGG + Intronic
985694853 5:1334251-1334273 GGGGGCTTGCCGCAGGCACTTGG - Intronic
985962367 5:3312223-3312245 ATGGGCTTCCAGCACCCACCTGG - Intergenic
986243645 5:5984736-5984758 AGGGGCTTTAGGCAGCCCCATGG + Intergenic
987220427 5:15785409-15785431 ACAGGCTTTCAGCAACAACTGGG + Intronic
990759663 5:59114544-59114566 AGGGGCTTTCAGCAAACAGGTGG + Intronic
991190220 5:63863086-63863108 AGTGGCCTTCAGCAGCAAATGGG - Intergenic
991632104 5:68666618-68666640 AGGGGATTTCAAAAGCCAGTTGG - Intergenic
992082377 5:73247189-73247211 CAGGGCTTTCACCAGGCACTAGG + Intergenic
992645191 5:78805147-78805169 GGGTGTTTTCAGCAGCCCCTGGG - Intronic
993450845 5:88070499-88070521 AGAGGCTTTCAGTTGCCCCTGGG - Intergenic
993634348 5:90326108-90326130 AGGGGCTTTCAGTTGCTTCTGGG + Intergenic
994073505 5:95626772-95626794 AGTGGCTGCCAGCAGCCATTAGG - Intergenic
994937272 5:106271360-106271382 AAGGACTGTCAGCAACCACTGGG - Intergenic
995215665 5:109591714-109591736 CGGGGCTTTCAGCAAAGACTTGG + Intergenic
995253464 5:110019429-110019451 AGGGGCTTTCAGTTGCCTCTAGG - Intergenic
997467339 5:134096943-134096965 AGGGGCTTGCAGCCCCCTCTGGG + Intergenic
998635844 5:143953949-143953971 AAGGGCTTTCTGAAGCCAGTAGG + Intergenic
999868701 5:155728612-155728634 GGAGGCTTTCCGCAGCCGCTTGG + Intergenic
1000168334 5:158677255-158677277 AAGGGCCTTCAACAGCCATTGGG - Intergenic
1000334472 5:160231910-160231932 AGGGACTTTCCCCAGCCACATGG + Intronic
1000698798 5:164422233-164422255 AGGGGCTTTCAGTTGCCCCAGGG + Intergenic
1000913340 5:167048957-167048979 AGGGGTTCTCAGCAGGTACTGGG + Intergenic
1001413561 5:171527638-171527660 AGGGGTTGCTAGCAGCCACTGGG - Intergenic
1001511461 5:172325732-172325754 AGGGCCTTTAAGCAGTGACTAGG - Intronic
1002387015 5:178875854-178875876 AGGGGCTATCAGTTGCCTCTGGG + Intronic
1002426995 5:179182329-179182351 CGGAGCTGTCAGCAGCCCCTGGG - Intronic
1002634492 5:180600387-180600409 TGTGGCTTTGAGCAGCCACCCGG + Intergenic
1004828899 6:19455743-19455765 TGGGGCATTCACCACCCACTAGG + Intergenic
1006928290 6:37671598-37671620 AGGGGCTTCCAGCACCCAGTAGG + Intronic
1007502008 6:42305540-42305562 AGGGGTTCTCTGCAGCCACAAGG + Intronic
1007589569 6:43013277-43013299 AGGGCCCTTCAGAAGGCACTGGG - Exonic
1008173240 6:48234662-48234684 AGAGGCTTTCAGTTGCCCCTGGG - Intergenic
1008211449 6:48729586-48729608 AGAGGCTTTCAGTTGCCCCTGGG - Intergenic
1008219942 6:48843263-48843285 AGGGGCTGTCAGTTGCCTCTGGG + Intergenic
1008613919 6:53208120-53208142 AGGGCATTTCAGCAGCTACTGGG - Intergenic
1010373540 6:75139781-75139803 AGGGGATTTCAGCAGTCATTTGG - Intronic
1015276554 6:131388425-131388447 AGGGGTTTCCAGCAGGGACTGGG + Intergenic
1018107913 6:160506750-160506772 ATGGGCTTTCAGTCGCCTCTGGG + Intergenic
1018434155 6:163746081-163746103 AGGAGCTGTCAGCAGCCACAGGG + Intergenic
1019435322 7:1019630-1019652 TGGAGCTTCCTGCAGCCACTAGG - Intronic
1019522903 7:1468595-1468617 TGGGGCATACAGCAGGCACTGGG + Intergenic
1020426267 7:8069436-8069458 AGGGGCTTTCGGTTGCCTCTGGG + Intronic
1021355768 7:19651720-19651742 AGGGGCTTTCAGTTGTCCCTGGG - Intergenic
1022411247 7:30140040-30140062 ATGGGGTGTCAGCAGCCACTTGG + Intronic
1023998923 7:45178376-45178398 AGGGTCTGGCAGCAGCCACCAGG - Intronic
1024510408 7:50199601-50199623 AGGGACTCTCAGAAGCCACTGGG + Intergenic
1024762196 7:52612182-52612204 AGGTGTTTGCAGCAGCCACATGG + Intergenic
1026963230 7:74423118-74423140 AGTGGCTCAGAGCAGCCACTCGG + Intergenic
1028793140 7:94876037-94876059 AGGTCGTTTCAGCAGCTACTAGG + Intergenic
1031980598 7:128122005-128122027 TGGGGCTTAGAGCACCCACTAGG + Intergenic
1032934163 7:136710111-136710133 AGGTGCTATCAGCATCTACTGGG - Intergenic
1033428420 7:141266257-141266279 AGGTGCCTTCAGAAGCCACCTGG + Intronic
1034115552 7:148580608-148580630 AGGAACTTCCAGAAGCCACTGGG - Intergenic
1038174858 8:25171569-25171591 CAGGGCTGTCAGCTGCCACTGGG + Intergenic
1039283979 8:36019584-36019606 AGGAGCTTAGAGGAGCCACTGGG - Intergenic
1039558581 8:38495077-38495099 ACGGGCTTTCAGGAGCAGCTTGG + Intergenic
1039594910 8:38783325-38783347 AGGGTCTTTCAGCAGACCCCAGG + Intronic
1039970294 8:42316295-42316317 AGGGCCTTGAAGCAGCCATTGGG - Exonic
1040883437 8:52233711-52233733 ATTGGCTTTCACCAGCCAATTGG + Intronic
1043126558 8:76403847-76403869 AGGGGATTCCAGCATACACTGGG + Intergenic
1046486404 8:114894281-114894303 AGGGGCTTTCAGTTGCCACTGGG + Intergenic
1047227995 8:122972882-122972904 AGGGCCTTTTAGGAGCCACTGGG + Intronic
1047423497 8:124726737-124726759 AGGGGCTGTCCACACCCACTCGG + Intronic
1048311529 8:133326207-133326229 AGGAACTTCCAGAAGCCACTGGG - Intergenic
1048425467 8:134319305-134319327 ATGGGATTTCTGGAGCCACTTGG + Intergenic
1048973110 8:139656190-139656212 AGGGCCTGACAGCTGCCACTTGG - Intronic
1048980086 8:139698549-139698571 AAGGGGTTGAAGCAGCCACTGGG + Intronic
1048989623 8:139753535-139753557 ATGAGCATTCAGCAGCCACTGGG - Intronic
1050693929 9:8259005-8259027 AGAGGCTTGCAGCAGGCATTAGG + Intergenic
1050923500 9:11234855-11234877 AAGGGTTTTGAGCACCCACTGGG + Intergenic
1050970413 9:11864258-11864280 AGGTTGTTTCAGCAGCTACTAGG - Intergenic
1052872660 9:33523719-33523741 AGGGGCCCTCTGCAGCCACCGGG - Intergenic
1053398969 9:37800943-37800965 AGGGGCAGGCAGCAGCCACCGGG + Exonic
1053503393 9:38620849-38620871 AGGGGCCCTCCGCAGCCACCGGG + Intergenic
1053752669 9:41273101-41273123 AGGGGCCGTCCGCAGCCACCGGG + Intergenic
1054258197 9:62837453-62837475 AGGGGCCGTCCGCAGCCACCGGG + Intergenic
1054351602 9:64021344-64021366 AGGGGCCCTCTGCAGCCACCGGG - Intergenic
1054858901 9:69929815-69929837 ATGGGCTGCCAGCGGCCACTGGG + Intergenic
1057684708 9:97221816-97221838 AGGGGCTCTCCGCAGCCACCGGG + Intergenic
1058700361 9:107595233-107595255 GTGGCCTTTCAGCAGCCTCTGGG - Intergenic
1060155463 9:121317118-121317140 AGGGGTTCTCATCAGCCACGAGG - Exonic
1060594669 9:124840899-124840921 AGGGGCCTTCAGCAGCAGCAAGG - Intergenic
1062194732 9:135266704-135266726 AGGGCCTTCAAGCAGCCCCTGGG + Intergenic
1062454605 9:136629637-136629659 AGGGGCCTTGGGCAGCCACCAGG - Intergenic
1202800579 9_KI270719v1_random:170923-170945 AGGGGCCGTCCGCAGCCACCGGG - Intergenic
1202800942 9_KI270719v1_random:174914-174936 AGGGGCCCTCTGCAGCCACTGGG - Intergenic
1203552136 Un_KI270743v1:172037-172059 AGGGGCCCTCTGCAGCCACCGGG - Intergenic
1203552218 Un_KI270743v1:172328-172350 AGGGGCCGTCTGCAGCCACCGGG - Intergenic
1187069831 X:15877530-15877552 AGAGGCGATCAGGAGCCACTTGG + Intergenic
1188715011 X:33449600-33449622 AGAGGCTTTCAGTTGCCCCTGGG - Intergenic
1189424533 X:40886023-40886045 AGGGGCTTCCAGAAGACACCTGG - Intergenic
1189817192 X:44835620-44835642 AGGGCCTTTAAGCAGGGACTTGG - Intergenic
1191019126 X:55841541-55841563 AAGGGCTTTCAGTTGCCCCTGGG + Intergenic
1191156859 X:57283537-57283559 AGGGGCTGTCAGTTGCCTCTGGG + Intergenic
1192428579 X:71097558-71097580 AAGGGCTGTGAGCTGCCACTTGG + Intronic
1192739270 X:73877146-73877168 AGGGCCTATCAGCGGCCTCTGGG - Intergenic
1192756316 X:74049819-74049841 AGGGGCTTTCAGTTGCCTCTGGG - Intergenic
1193067620 X:77276005-77276027 AGGGGCTTTCAGTTGTCTCTGGG - Intergenic
1193317044 X:80076724-80076746 AGAGGCTTTCAGCTGCCTCTGGG + Intergenic
1193496398 X:82219071-82219093 ATGGGCTTTCAGTTGCCACTGGG + Intergenic
1194235010 X:91372399-91372421 AGGGGCTTTCAGTTGCCTCTGGG - Intergenic
1194899936 X:99497711-99497733 AGGGGCTTTCAGTTGCCTCCGGG - Intergenic
1195148853 X:102044744-102044766 AGAGGCTTTCAGTTGCCCCTGGG - Intergenic
1195241754 X:102959732-102959754 AGGGGCTGTCTGTTGCCACTGGG + Intergenic
1195856507 X:109338217-109338239 AGGGGCTTTCTGTTGCCCCTGGG + Intergenic
1197975943 X:132166064-132166086 GGTGGCTGTCAGCAGCCCCTGGG + Intergenic
1198186105 X:134255546-134255568 AGTGGCGTGCAGCAGCAACTGGG - Intergenic
1199307008 X:146279072-146279094 AGAGGCTTTCAGTTGCCCCTAGG + Intergenic
1201153417 Y:11107610-11107632 AGGGGCCCTCTGCAGCCACCGGG - Intergenic
1201153499 Y:11107901-11107923 AGGGGCCGTCTGCAGCCACCGGG - Intergenic
1202068248 Y:20962656-20962678 AGGGGCTTCCTGGAGACACTGGG + Intergenic