ID: 1184747255

View in Genome Browser
Species Human (GRCh38)
Location 22:46463594-46463616
Sequence CGGGGAAAACAGCTGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 289}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184747255_1184747265 15 Left 1184747255 22:46463594-46463616 CCATCCTCCAGCTGTTTTCCCCG 0: 1
1: 0
2: 0
3: 21
4: 289
Right 1184747265 22:46463632-46463654 AGGAAACCACCTGAGACCCTCGG 0: 1
1: 0
2: 3
3: 17
4: 178
1184747255_1184747268 28 Left 1184747255 22:46463594-46463616 CCATCCTCCAGCTGTTTTCCCCG 0: 1
1: 0
2: 0
3: 21
4: 289
Right 1184747268 22:46463645-46463667 AGACCCTCGGCCATGTGACCTGG 0: 1
1: 0
2: 0
3: 7
4: 83
1184747255_1184747262 -5 Left 1184747255 22:46463594-46463616 CCATCCTCCAGCTGTTTTCCCCG 0: 1
1: 0
2: 0
3: 21
4: 289
Right 1184747262 22:46463612-46463634 CCCCGGAGGGAAGTAAACAGAGG 0: 1
1: 0
2: 2
3: 9
4: 96
1184747255_1184747269 29 Left 1184747255 22:46463594-46463616 CCATCCTCCAGCTGTTTTCCCCG 0: 1
1: 0
2: 0
3: 21
4: 289
Right 1184747269 22:46463646-46463668 GACCCTCGGCCATGTGACCTGGG 0: 1
1: 0
2: 1
3: 12
4: 145
1184747255_1184747270 30 Left 1184747255 22:46463594-46463616 CCATCCTCCAGCTGTTTTCCCCG 0: 1
1: 0
2: 0
3: 21
4: 289
Right 1184747270 22:46463647-46463669 ACCCTCGGCCATGTGACCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184747255 Original CRISPR CGGGGAAAACAGCTGGAGGA TGG (reversed) Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902617598 1:17632310-17632332 TGAGGTCAACAGCTGGAGGAGGG - Exonic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902752538 1:18527278-18527300 AGGGGAAATCAGCTGGGAGAGGG - Intergenic
903907439 1:26696608-26696630 CTGGGAAAGGAGCTGCAGGACGG + Exonic
904557988 1:31377882-31377904 CGGGGAAAAGAACTGGAAGGAGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915641445 1:157230244-157230266 TGAGGAGAACAGCAGGAGGAAGG + Intergenic
915667236 1:157456250-157456272 TGAGGAGAACAGCAGGAGGAAGG - Intergenic
916058373 1:161083249-161083271 GGGGGTATGCAGCTGGAGGAGGG - Intronic
916215606 1:162390533-162390555 CCGGGAAGCCACCTGGAGGAAGG - Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919921000 1:202166329-202166351 CGGGGAAAAGAAGTGGGGGAAGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922725461 1:227920964-227920986 CGGGGCGTACAGCTGGAGCAGGG - Exonic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
924452162 1:244188020-244188042 TGGGCAAAACATCTTGAGGAGGG + Intergenic
1062914233 10:1235213-1235235 GGAGGAAAAGAGCTGTAGGAAGG + Intronic
1062914402 10:1235972-1235994 GGAGGAAAAGAGCTGTAGGAAGG + Intronic
1063842282 10:10085981-10086003 CGGGGAAAAGGGCAGGAGGGAGG - Intergenic
1067834194 10:49628049-49628071 CGGGGGAGTTAGCTGGAGGAAGG + Intronic
1069808110 10:71138560-71138582 CGGGGACCACAGCAGGAGGGCGG - Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070645856 10:78202022-78202044 CAGAGAAAAGAGCTGAAGGACGG + Intergenic
1070825516 10:79388264-79388286 GGGGGACACCAGCTGGTGGAGGG + Intronic
1071265056 10:83957644-83957666 CTGGGAAAGGAGCTGGAGGGAGG + Intergenic
1072463260 10:95639771-95639793 GGGGGAAAACTGATGGAGAAGGG - Intronic
1073709718 10:106022576-106022598 CGGAGCAAAGAGCGGGAGGACGG + Intergenic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076217105 10:128703861-128703883 CGGGGAATAGTGCTGGAAGATGG + Intergenic
1076700320 10:132269600-132269622 CGGGGCTAACAGCTAGTGGATGG + Intronic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1077474645 11:2780555-2780577 CTGAGAAAACAGTTGGAGGCTGG - Intronic
1077512376 11:2975065-2975087 TGGGGAAACCAGCTGGAAGGTGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1081698490 11:45136480-45136502 GGTGGAAGACAGCTGGAGGAAGG + Intronic
1081763181 11:45591380-45591402 CGTGGAAAAAGGCTGGAGGATGG - Intergenic
1083423599 11:62570849-62570871 CTTGGAAAACAGCTAGAGGTGGG - Intronic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1083658911 11:64243125-64243147 TGGGGAAAGCAGCTGAGGGAGGG + Intronic
1084899608 11:72299818-72299840 GGGCGACAACAGCTGCAGGAAGG + Intronic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1089579889 11:119475036-119475058 AGGTAAAAACAGCTGGAGGCAGG - Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1096933234 12:55239357-55239379 AGGGGAAAAGAGATGGAGAATGG + Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1097607577 12:61774663-61774685 CGGGGGAAAGAGTGGGAGGATGG + Intronic
1097727631 12:63093146-63093168 TGGGGTAAGCAGCTGGAGGTGGG - Intergenic
1098462064 12:70742779-70742801 CGGGGGAAACAGTTGGGAGAAGG + Intronic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1104008494 12:124912702-124912724 GCCGGAAAACAGCTGGAAGATGG - Exonic
1104008555 12:124913158-124913180 GCCGGAAAACAGCTGGAAGATGG - Exonic
1104008621 12:124913614-124913636 GCTGGAAAACAGCTGGAAGATGG - Exonic
1105826467 13:24127491-24127513 TGGGGACAGCAGCTGGAGAAGGG + Intronic
1106124019 13:26885384-26885406 AGGGGAAAGTAGCAGGAGGAAGG + Intergenic
1108716435 13:53083456-53083478 CGAGGAAAACAGTTGGGAGATGG + Intergenic
1111736476 13:92146657-92146679 TGGGGGAAACAGTGGGAGGAGGG - Intronic
1113660273 13:112103018-112103040 GGGGTGAAACAGCAGGAGGAAGG + Intergenic
1113782347 13:112983841-112983863 CAAGGAAAACAGCTGCAGCACGG - Intronic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118361587 14:65061844-65061866 AAGGGAAAAGAGCTGGAGGTGGG + Exonic
1118619481 14:67601330-67601352 TGGGGAAAACAGTTGGAAGCTGG + Intergenic
1118717948 14:68573620-68573642 CGGGGAATAAAGCTTCAGGAGGG + Intronic
1119652316 14:76392603-76392625 TGGGGAAAACATCAGGAGGGTGG - Intronic
1120645705 14:87071521-87071543 TGGGGAACACAGATGGAGTAGGG + Intergenic
1122046946 14:99030542-99030564 TGGGGATGACAGCTGGAGGCTGG - Intergenic
1122765870 14:104069471-104069493 CAGAGAAAACAGCTGAGGGAGGG - Intergenic
1123680897 15:22762792-22762814 CAGGGAGAACAGCTGGAATACGG - Intergenic
1124887037 15:33696754-33696776 CCATGAAAACATCTGGAGGAAGG + Intronic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1125769235 15:42154050-42154072 CGGAGAGCCCAGCTGGAGGAGGG - Intronic
1126398252 15:48242320-48242342 CAGGGAAAACAGCTCCAGGCTGG + Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127964982 15:63916565-63916587 CTGGGAAAACAGGTGGGTGAAGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128379853 15:67104579-67104601 ATGGGAAAACAGCTGGAAAAAGG - Intronic
1129239245 15:74241923-74241945 TGGGGCAGACAGCAGGAGGAGGG + Intronic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129351566 15:74958560-74958582 GGGCGAGAACAGCGGGAGGAGGG - Intronic
1132386769 15:101406271-101406293 GGGGGATAACGGCTGGAGGAAGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1134013382 16:10871607-10871629 TGGGGAAGGAAGCTGGAGGAAGG - Intergenic
1134659374 16:15972218-15972240 GGGGCAAAACAGCTGGGGAAAGG - Intronic
1135352521 16:21740992-21741014 ATGGGAAAACTGCTCGAGGAGGG - Intronic
1135451009 16:22557114-22557136 ATGGGAAAACTGCTCGAGGAGGG - Intergenic
1135544781 16:23358261-23358283 CAGGGAAAATAGCTGGCTGATGG + Intronic
1135954076 16:26940998-26941020 CGAGGGGCACAGCTGGAGGAGGG + Intergenic
1136091080 16:27920514-27920536 CGGGGAAAACACTTGCAGCAGGG - Intronic
1137421092 16:48334697-48334719 GAGGGCAAACAGCTGAAGGATGG - Intronic
1138247553 16:55479028-55479050 CGGGGAAAAGAGGTGGAGAAAGG + Exonic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138346883 16:56325636-56325658 GGGGGAAGGCGGCTGGAGGAAGG + Intronic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1142930836 17:3282853-3282875 TGGGGAAAACAGCATGAGCAAGG - Intergenic
1144020113 17:11233520-11233542 TGGGGAAAACAGCTTTAGGAAGG - Intergenic
1144921700 17:18769413-18769435 CGGGGAAAGTAGCTGCAGAATGG + Intronic
1148973468 17:51505539-51505561 CCAGGAAAACAGCTGGAAGTGGG - Intergenic
1149615459 17:57993866-57993888 ACGAGGAAACAGCTGGAGGAGGG - Intronic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1151680015 17:75618115-75618137 TGGGTAGAACACCTGGAGGAGGG - Intergenic
1152929336 17:83101889-83101911 GGGGCAAAGCAGCTGGAGGCCGG - Intergenic
1153140313 18:1964645-1964667 TGGGAAAAACAGCTGGAAAAAGG + Intergenic
1153997167 18:10453522-10453544 GGGGGAAAACTGCTGGAAGAGGG + Intergenic
1157916508 18:51668802-51668824 AGAGGAAAACAGCTGGTGGCAGG + Intergenic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1160406134 18:78647433-78647455 CGGGGACCACAGATGGAGCAGGG - Intergenic
1160786337 19:901659-901681 TGGGGAAGACAGTTGGAGCATGG - Intronic
1161362112 19:3856204-3856226 CGGGGAAGCCAGCAGGATGAAGG + Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162439220 19:10682434-10682456 CCGGGAAGCCATCTGGAGGAGGG - Intronic
1163246723 19:16100179-16100201 CGGGGAAAACAGACCTAGGAAGG + Intronic
1163660409 19:18573694-18573716 GCCGGCAAACAGCTGGAGGATGG + Exonic
1163729188 19:18940046-18940068 GGGGGAAGACAGGTGGGGGAGGG + Intronic
1163743723 19:19032923-19032945 CCGGGAAAAGGGCTGAAGGATGG - Intronic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1164748206 19:30631308-30631330 CGGGGAGAACAGTTTGGGGATGG + Intronic
1165480336 19:36059818-36059840 CAGCGTAAACACCTGGAGGAGGG + Intronic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165938603 19:39403840-39403862 CGGGGAAAAAGGGGGGAGGAGGG - Intergenic
1166065503 19:40356128-40356150 CAGGGAAAGCAGCTGTGGGAGGG + Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166695418 19:44848917-44848939 CAGGGAAGAAAGCTGGGGGAGGG - Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167504376 19:49863320-49863342 CGTGTAAAACAGCAGGAGGGAGG - Intronic
1168102892 19:54150305-54150327 GGGGGCTAACAGCTGCAGGAAGG + Intronic
925287695 2:2726691-2726713 TGGGGAAAAAAGCAAGAGGAGGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926611706 2:14954208-14954230 CTGGGAAAACACCTGGAACATGG - Intergenic
927601829 2:24449673-24449695 TGGAGAAAACAGCTTGAGGCTGG + Intergenic
927981601 2:27378194-27378216 TGTGGACAAGAGCTGGAGGAGGG - Exonic
929611914 2:43277055-43277077 CAGGGAAATCAGCTGGGGGCTGG - Intronic
929873433 2:45776760-45776782 TGGAGAAAACTGCTGGAGGAAGG + Intronic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
932600004 2:73117160-73117182 CCTGGAAAATAGCTGCAGGAAGG - Intronic
933897351 2:86823951-86823973 AGGGGCACAGAGCTGGAGGACGG + Intronic
934655856 2:96116578-96116600 CGGGGAGAGCGGCTGGAGGAAGG + Intergenic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
939966008 2:148610889-148610911 GGTGGAGAACAGATGGAGGAAGG + Intergenic
939998549 2:148943490-148943512 AGGGAAAAAAATCTGGAGGAGGG + Intronic
940775015 2:157876091-157876113 CGGGGGAAAGAGCCGGGGGAGGG + Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
943820368 2:192314454-192314476 CGGGAAGAACAGCTGGAGAGAGG - Intergenic
946421213 2:219565970-219565992 TGAGGAGAACAGCTGGAGGTGGG - Intronic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
948181966 2:235989400-235989422 AGGTGAAAACATCAGGAGGAGGG + Intronic
948556304 2:238813760-238813782 GGAGGAGAACAGCAGGAGGAAGG - Intergenic
1168753499 20:299757-299779 CTGAGAAATCACCTGGAGGAGGG + Exonic
1168966640 20:1902634-1902656 TGGGGAGAAAAGCAGGAGGAGGG + Intronic
1169014444 20:2280191-2280213 CGTGGGAAATAGGTGGAGGAGGG - Intergenic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170943203 20:20866315-20866337 CTGGGAAAACACTTGGAGGGAGG - Intergenic
1173177286 20:40773836-40773858 TGGGGAAAACAACAGGAGGAAGG + Intergenic
1173603273 20:44311020-44311042 CGGGGACAACTCCTTGAGGAGGG + Exonic
1178750139 21:35294958-35294980 AGGGGAAAACAGCTTCAGAAAGG + Intronic
1180049919 21:45326392-45326414 CGAGGGCCACAGCTGGAGGAGGG - Intergenic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1182648738 22:31832982-31833004 CTGAGAAGAAAGCTGGAGGAAGG - Intronic
1183316335 22:37139022-37139044 CGGGGAGAAAGGCTGGAGCAGGG + Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184204172 22:42990527-42990549 GGGGCAAAACACCTGGAGGGAGG + Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951881758 3:27486381-27486403 GCTGGCAAACAGCTGGAGGATGG + Intergenic
952597466 3:35035458-35035480 AGGGGAAAACAGCAAGGGGAAGG + Intergenic
954793718 3:53150722-53150744 AGGGGAGAAGATCTGGAGGAAGG - Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955794174 3:62618236-62618258 AGAGGAAAACAGCTGAGGGAAGG + Intronic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960325168 3:116286578-116286600 AGGGATAAAAAGCTGGAGGAGGG - Intronic
961184381 3:124901862-124901884 CGGGGAAAATGGCTTGAGGCCGG + Intergenic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
965995420 3:174876371-174876393 AGGGGAAAAGAGCTAGAGGATGG - Intronic
966094361 3:176180864-176180886 TGGGGAAAAGAGTGGGAGGAGGG - Intergenic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
966974083 3:185069891-185069913 CTGGGAAAGCAGCTGCAAGAGGG - Intergenic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
969670262 4:8586236-8586258 GGGGGAAAGCAGCAGGGGGATGG - Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
970450151 4:16158299-16158321 TGGGGAAACGAGATGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
971252676 4:24986338-24986360 CCGGGCTAACAGCTGGAGGGAGG - Intergenic
971669926 4:29543178-29543200 TGGGGAAACCAGCTGCAGCAGGG - Intergenic
971699781 4:29956164-29956186 CAAGGAAAACAGCTGAAGGAGGG - Intergenic
972568719 4:40291766-40291788 CGGGGAAGACACATGCAGGATGG - Intergenic
972852599 4:43069368-43069390 TGGGGGAAACAACTGTAGGATGG - Intergenic
973114759 4:46441773-46441795 GGGGAAAAGGAGCTGGAGGAGGG - Intronic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
975371967 4:73599508-73599530 CTGGGAAAACAGCTGTGGTAAGG + Intronic
976652991 4:87456162-87456184 AGGGGAAGACAGCTGAAAGAAGG - Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979972894 4:127159601-127159623 GGGGGAAAGGAGATGGAGGAAGG + Intergenic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
981964933 4:150588830-150588852 GGGAGTAAACAGCTGGAGGGTGG + Intronic
983286306 4:165743652-165743674 CTAGGAAAAGATCTGGAGGAAGG - Intergenic
983897056 4:173092433-173092455 GTGGGAAAAGAGCTGGAGAATGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986041871 5:4001376-4001398 CAGGGAGTACAGCTGGGGGAAGG + Intergenic
986271272 5:6233004-6233026 AGGGAGAAATAGCTGGAGGAGGG + Intergenic
986335599 5:6752961-6752983 CGGGGAAGACATGTGGTGGACGG - Exonic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
990354287 5:54950605-54950627 AGGGGAAGACAGCCGGAGGCTGG + Intergenic
990426213 5:55691780-55691802 GGGGGAAAACTGGTGGGGGAGGG + Intronic
991050211 5:62264826-62264848 GGGAGAGAACAGATGGAGGATGG + Intergenic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
998501919 5:142640591-142640613 CTTGGATAACAGCTGGAAGAAGG - Intronic
1000618940 5:163460746-163460768 AGGGGGAAAGAGCTGGGGGACGG + Intronic
1003449673 6:6219123-6219145 CGGGGAAGACAGGTTGAGGTGGG + Intronic
1003523874 6:6882501-6882523 GGAGGAAAAGAGCAGGAGGATGG - Intergenic
1005168923 6:22958691-22958713 TGGGGGAAACAAATGGAGGAAGG - Intergenic
1005941071 6:30560424-30560446 GGGGGAAGGAAGCTGGAGGAAGG + Intronic
1005980603 6:30833708-30833730 CCTGGCAATCAGCTGGAGGAAGG + Intergenic
1006320869 6:33318688-33318710 CTGGGATAACATTTGGAGGAAGG - Exonic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006979014 6:38131644-38131666 AGGGGACAACAGTGGGAGGAAGG - Intronic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007882859 6:45186702-45186724 AGGGGAGAAGAGCTGGAGGAAGG - Intronic
1008614646 6:53214721-53214743 AGGGGAGAACAGTGGGAGGAGGG - Intergenic
1010034038 6:71301335-71301357 GGGGGAAATCAGGTGTAGGAAGG - Intronic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012247282 6:96939677-96939699 GGGGGAAATGTGCTGGAGGACGG + Intronic
1013673753 6:112434348-112434370 CGGGGGAAACATATTGAGGAAGG - Intergenic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014068089 6:117150445-117150467 CCATGAAAACAGCTGGAGGGAGG - Intergenic
1014727264 6:124986461-124986483 GGCTGAAGACAGCTGGAGGAAGG - Intronic
1014884637 6:126764791-126764813 AGGGGAGAACAGATGGAAGAGGG + Intergenic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018638346 6:165884404-165884426 CCTGGACAGCAGCTGGAGGAAGG + Intronic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022652766 7:32292734-32292756 CTTGGAACACAGCAGGAGGAGGG - Intronic
1024353751 7:48394003-48394025 TGGGGAGAACAGCTGGGGGTTGG - Intronic
1024675250 7:51632277-51632299 CCAGGAACACAGCTGGAGCAGGG + Intergenic
1024875718 7:54020714-54020736 CGGGGGAAAGAGTGGGAGGAGGG - Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029546770 7:101214476-101214498 TGAGGAAAACAGCTTGTGGAGGG - Intronic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1032222573 7:130005884-130005906 AGGGGAAAGCAGCTGGAGATTGG - Intergenic
1032441225 7:131944584-131944606 AGGGGAATACTGCTCGAGGAAGG - Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035371813 7:158384404-158384426 CGGGAAAAACCTCTGGAGGTTGG - Intronic
1036631566 8:10519451-10519473 CTGGGAAGACACCTGAAGGAAGG - Intergenic
1036942569 8:13065612-13065634 CGGGGAAGAGAAATGGAGGATGG + Intergenic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1038283977 8:26190471-26190493 CGGGTAGAGCAGCGGGAGGAGGG - Intergenic
1040416848 8:47203016-47203038 GGGTGAAAACTGCTGCAGGAAGG - Intergenic
1041039925 8:53836601-53836623 CGGGGAAATCCACTGGTGGAAGG - Intronic
1041102960 8:54415146-54415168 CAGACAACACAGCTGGAGGAGGG - Intergenic
1043161930 8:76856230-76856252 CGGGGAGAAGGACTGGAGGAAGG - Exonic
1043371359 8:79597444-79597466 AGGGGAAGACAGGTGGGGGAAGG - Intergenic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045086087 8:98687466-98687488 CGGGTCACACAGCTGGAGGTGGG - Intronic
1045135517 8:99212523-99212545 TGAGGAAGACAGGTGGAGGAAGG + Intronic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045659246 8:104419499-104419521 TGGGGAAAACAGCTGTATGGTGG + Intronic
1045685766 8:104710012-104710034 CACTGAAAACAGCTGAAGGATGG - Intronic
1047258722 8:123236969-123236991 GCGGGCAAACAGCTGGAGGATGG + Intronic
1048874768 8:138828051-138828073 CGAGGAAAACATGGGGAGGATGG - Intronic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1052273899 9:26656745-26656767 TGGAGAAAACAGCTGGTGGAGGG - Intergenic
1052409702 9:28107082-28107104 CAAGGAAACCATCTGGAGGAGGG - Intronic
1052799943 9:32957634-32957656 GAAGAAAAACAGCTGGAGGAGGG + Intergenic
1053004395 9:34594350-34594372 CCAGGAAAACAACTTGAGGAAGG - Intergenic
1053010217 9:34628752-34628774 CGGGAAAAACAGCCGGAGAGAGG + Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055854615 9:80670550-80670572 TGGGAGAAACAGCTGGATGAGGG - Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056522096 9:87411198-87411220 CGGAGCAAAAAGCAGGAGGACGG - Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1058117123 9:101097074-101097096 CAGGGAGAACAGCTGAATGAGGG + Intronic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1060401120 9:123350116-123350138 CTGGCAAAACAGCTTGGGGAGGG - Intergenic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061312165 9:129770908-129770930 CTGGGAAAATAGCCGCAGGATGG + Intergenic
1061996198 9:134187343-134187365 CGGGGAAAACAGCGAGATGCAGG + Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186394002 X:9189551-9189573 CGGGAACAATAGCTAGAGGAGGG - Intergenic
1187847611 X:23556984-23557006 AGGGGAAAGTAGCTGGAGAAAGG - Intergenic
1188869843 X:35359858-35359880 GGGGCAAAACACCTAGAGGAAGG - Intergenic
1189446618 X:41086146-41086168 CGGGGCCAACAGCTGGATGTGGG + Intronic
1192430754 X:71109998-71110020 GGGGGAAAGGAGTTGGAGGAGGG + Intronic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1198844178 X:140892064-140892086 TGTGGAGAACAGCTGGAAGATGG + Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1201725971 Y:17152539-17152561 AGAGGAAAACAACTGCAGGATGG - Intergenic
1202109623 Y:21406342-21406364 CTGGGAAAATCCCTGGAGGAAGG + Intergenic