ID: 1184747381

View in Genome Browser
Species Human (GRCh38)
Location 22:46464292-46464314
Sequence CCTGCGTGTCACCATCATCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184747381_1184747385 1 Left 1184747381 22:46464292-46464314 CCGTGATGATGGTGACACGCAGG 0: 1
1: 0
2: 1
3: 17
4: 100
Right 1184747385 22:46464316-46464338 TGCAGAAGGCCGTGACGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 114
1184747381_1184747387 22 Left 1184747381 22:46464292-46464314 CCGTGATGATGGTGACACGCAGG 0: 1
1: 0
2: 1
3: 17
4: 100
Right 1184747387 22:46464337-46464359 GGATGCCATCTGCAGACACAAGG 0: 1
1: 0
2: 3
3: 14
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184747381 Original CRISPR CCTGCGTGTCACCATCATCA CGG (reversed) Exonic
900986594 1:6076735-6076757 CCTCCCTGTCACCCTCATCTGGG - Intronic
902533381 1:17104904-17104926 CCTGCGGGTCACCATGAGCCAGG - Exonic
903225082 1:21890140-21890162 CCTGCCTGTCTCCATCCCCAGGG - Exonic
904330644 1:29755901-29755923 CCTGCGTGCCACCAATATCCTGG - Intergenic
906663266 1:47597608-47597630 ACAGCGTGCCACCATCACCATGG - Intergenic
907242949 1:53090703-53090725 CGTGGGTGCCACCATCAACATGG - Exonic
909611860 1:77559282-77559304 CCTGGGTTTTACCATCATCTTGG - Exonic
910127062 1:83854548-83854570 GCTGTGTGTCACCTTCATAAGGG - Intergenic
911656896 1:100454322-100454344 CCTCCTTGTCTCCATCCTCAGGG - Intronic
913227056 1:116709661-116709683 CCTGAGTGTCATTAGCATCAGGG - Intergenic
916654107 1:166858205-166858227 CCTGCTGCTCAGCATCATCAGGG + Exonic
920699281 1:208205402-208205424 CCTGCCTGTCCTCATCATCCAGG + Intronic
921189469 1:212697041-212697063 CCTTCCTGTCATCATCCTCAGGG + Exonic
923626089 1:235615141-235615163 CCTCTGTGTGACCATTATCATGG + Intronic
1063529571 10:6818534-6818556 CCTGCATGTCAACATCACCAGGG - Intergenic
1070605853 10:77898197-77898219 CCTGCATGTCCCCATCAACCTGG + Intronic
1072544280 10:96422564-96422586 CCAACATGTCACCATCATCAGGG - Exonic
1072738227 10:97893723-97893745 GGTGGGTGTGACCATCATCAAGG - Intronic
1074114004 10:110442210-110442232 CCTGCCTGTCTCCACCATCCAGG - Intergenic
1074492705 10:113953549-113953571 CCTTAGTGGCACCATCAACAAGG - Intergenic
1076851704 10:133096506-133096528 CCTGCTTGTCAACATCTTCCGGG - Intronic
1082645790 11:55723069-55723091 CTTGTGTTTCGCCATCATCATGG - Intergenic
1089187951 11:116633732-116633754 TCAGGGTGTCACCATCCTCATGG + Intergenic
1089859037 11:121572555-121572577 CATGTGTGTCTCCCTCATCAAGG + Intronic
1091246702 11:134102359-134102381 TCTGTATGTCACCATCATCGAGG + Intronic
1097242461 12:57585029-57585051 CCTGCCTGTAACCATCTCCATGG - Exonic
1109216784 13:59598212-59598234 ACTGAGTGGCACCACCATCATGG + Intergenic
1109872899 13:68359246-68359268 CCTGAGTCTCAGCATCATTATGG + Intergenic
1111728749 13:92045543-92045565 CATGATTGTCACCATCACCATGG + Intronic
1113848515 13:113405231-113405253 CCTGTGTGTCACCAGCAGTAGGG + Intergenic
1202846558 14_GL000009v2_random:182979-183001 TCTGTATGTCACCATCATCAAGG - Intergenic
1202916021 14_GL000194v1_random:173581-173603 TCTGTATGTCACCATCTTCAAGG - Intergenic
1202876737 14_KI270722v1_random:9462-9484 TCTGTATGTCACCATCATCCAGG + Intergenic
1124610465 15:31204518-31204540 CCTGAGTGGCATCGTCATCAAGG - Intergenic
1125600300 15:40912052-40912074 CATGTGTGCCACCATCACCAGGG + Intergenic
1129028692 15:72603617-72603639 CCTCCCTGTCATCATCATCTGGG + Intergenic
1131027900 15:89160670-89160692 CCTCTGTGTCTCCATCATTATGG + Intronic
1132243018 15:100275542-100275564 CATGCCTGTCACCTTCAACAAGG + Intronic
1132869775 16:2110750-2110772 CGTGCTGGTCACCAGCATCAAGG - Exonic
1134717646 16:16364851-16364873 CGTGCTGGTCACCAGCATCAAGG + Intergenic
1134957106 16:18387308-18387330 CGTGCTGGTCACCAGCATCAAGG - Intergenic
1135149603 16:19993949-19993971 CCTGCGCGTGACTATCATCTGGG - Intergenic
1135752945 16:25071414-25071436 CCAGGTTGTCACCATCACCACGG - Intergenic
1139460788 16:67120746-67120768 CCTGTGTGTCACAAGCCTCAGGG + Intronic
1142367042 16:89656091-89656113 CCACCGTGTCATCATCATGAAGG - Intronic
1151812618 17:76453252-76453274 CCTGCGTGGCGCCGTCGTCAGGG + Intergenic
1151989572 17:77565604-77565626 GCTCCGTGTCACCATCCACACGG + Intergenic
1152121917 17:78424067-78424089 CATGCCTGTCATCTTCATCAAGG - Exonic
1152603242 17:81276002-81276024 CCTGCATGGCAGGATCATCATGG + Exonic
1202673928 1_KI270710v1_random:23357-23379 TCTGTATGTCACCATCATCCAGG - Intergenic
934579469 2:95426906-95426928 CCCGCCTGTCACCATCTACATGG + Intergenic
934599975 2:95649818-95649840 CCCGCCTGTCACCATCTACATGG - Intergenic
937159069 2:119742949-119742971 CCTATGTGTCACCATCATGATGG + Intergenic
939800245 2:146699115-146699137 CCTGGGTGCCAACATCATCTTGG + Intergenic
942000917 2:171646424-171646446 TCTGTACGTCACCATCATCAAGG - Intergenic
942254335 2:174079629-174079651 CCTGCCTCTAACCATCATGAAGG + Intronic
1170757797 20:19219902-19219924 ACTGCGGGGGACCATCATCAGGG + Intronic
1175863287 20:62161516-62161538 CCTGAGTGACGCCATCAGCACGG + Exonic
1176117587 20:63439817-63439839 CCCCCGTGTCACCATCCACACGG + Intronic
1176635374 21:9188227-9188249 TCTGTATGTCACCATCATCAAGG - Intergenic
1176638001 21:9266904-9266926 TCTGTATGTCACCATCATCAAGG + Intergenic
1178724272 21:35037240-35037262 CCAGCATGTCACCATCGTCTTGG + Intronic
1179910260 21:44443761-44443783 CCTGGGTGCCACCTTCAGCATGG - Intergenic
1180370964 22:12036505-12036527 TCTGTATGTCACCATCATCAAGG - Intergenic
1180414725 22:12698233-12698255 TCTATATGTCACCATCATCAAGG + Intergenic
1180422040 22:12874401-12874423 TCTGTATGTCACCATCATCAAGG + Intergenic
1180909976 22:19443014-19443036 CCAGCGTTCCCCCATCATCAGGG - Exonic
1181235332 22:21445027-21445049 CCTGTGTGACGTCATCATCATGG + Exonic
1183575491 22:38686030-38686052 CCTGCTTGTGACAATCAGCAAGG + Exonic
1184747381 22:46464292-46464314 CCTGCGTGTCACCATCATCACGG - Exonic
961661371 3:128470334-128470356 ACTGCATGTCAGCATCATAAGGG - Intergenic
962907531 3:139818385-139818407 TCTGTATGTCACCATCATCAAGG - Intergenic
963286421 3:143438542-143438564 CCTGAGATTCACCATCATCTGGG + Intronic
963912700 3:150828433-150828455 CCTGTGTCTCAACATCAACAGGG - Intergenic
964707298 3:159632787-159632809 CCTGAGTATCATCAACATCAGGG - Intronic
968082136 3:195853933-195853955 CCTGAGTGGCAGCAGCATCAAGG - Intergenic
1202748894 3_GL000221v1_random:138117-138139 TCTGTATGTCACCATCATCAAGG - Intergenic
968748298 4:2372487-2372509 CCTGGACGTCACCATCATCGAGG + Intronic
971000899 4:22321407-22321429 CCAGCTTGTCACCATCAGTAAGG - Intergenic
973239810 4:47945486-47945508 CCTAGGTGTCAACATCAACATGG - Intronic
985370077 4:189277412-189277434 TCTCAGAGTCACCATCATCACGG + Intergenic
1202752898 4_GL000008v2_random:25321-25343 TCTGTATGTCACCATCATCAAGG + Intergenic
985542843 5:494799-494821 CCAGGGGGTCACCATCACCACGG - Intronic
995834748 5:116388811-116388833 CCTGCGTTTTAAAATCATCAGGG + Intronic
997581670 5:135021145-135021167 CCTGCCAGCCACCATGATCATGG - Intergenic
998848712 5:146334820-146334842 CCTTCTTGTCACCATCATCATGG + Intronic
999046902 5:148479192-148479214 CCTGTCTGTCACCTTCATCAAGG - Intronic
1000745744 5:165031419-165031441 CCTGCCTTCCACCATCACCAGGG + Intergenic
1001866605 5:175111490-175111512 CCTGCGTGTCCCCATCTGCTTGG - Intergenic
1004252864 6:14036319-14036341 CTCCCCTGTCACCATCATCACGG + Intergenic
1004993106 6:21161090-21161112 GCTGGGTGTCACCAGCAACAGGG - Intronic
1013575865 6:111483201-111483223 CGTCCGTGACATCATCATCATGG - Exonic
1017391627 6:153946252-153946274 CATGAGTGTCACCAGCAGCAAGG - Intergenic
1018845097 6:167550542-167550564 TCTGCGTGTCATCACCCTCATGG - Intergenic
1023662910 7:42488864-42488886 AGTGTGTGTCACCATCATGATGG - Intergenic
1023958337 7:44905820-44905842 CCTGGCTGTCCCCACCATCAGGG + Intergenic
1024377707 7:48657865-48657887 CCTGGATGTAACCATCATGAGGG - Intergenic
1025108800 7:56195299-56195321 CCTCATTATCACCATCATCATGG + Intergenic
1029363457 7:100102663-100102685 CCTGTGTCTCAGCATCACCATGG + Exonic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037999412 8:23379080-23379102 TCTGTATGTCACCATCATCAAGG - Intronic
1044388729 8:91623045-91623067 CCTGCCTTTCACCATGACCACGG - Intergenic
1047969384 8:130071768-130071790 CCTGAGTGTCCTCATCATCCTGG + Intronic
1051317450 9:15856948-15856970 CCTCAATGTCACTATCATCAAGG - Intronic
1053282518 9:36830183-36830205 CCTGCCTGACACCTTCATCTTGG + Intergenic
1055346526 9:75345712-75345734 TCTGTACGTCACCATCATCAAGG - Intergenic
1056688522 9:88786277-88786299 CCTGAGACTCACCAGCATCAGGG - Intergenic
1057263942 9:93601818-93601840 ATTGCTTGTCACCCTCATCAGGG - Intronic
1058829810 9:108806227-108806249 ACTGTCTGTCCCCATCATCATGG + Intergenic
1062672271 9:137718110-137718132 CCTGTGTGTGAAAATCATCACGG - Intronic
1203758150 Un_GL000218v1:155533-155555 TCTGTATGTCACCATCATCAAGG - Intergenic
1203717535 Un_KI270742v1:168207-168229 TCTGTATGTCACCATCATCAAGG - Intergenic
1203533690 Un_KI270743v1:10026-10048 TCTGTATGTCACCATCATCAAGG + Intergenic
1203651751 Un_KI270751v1:131798-131820 TCTGTATGTCACCATCATCAAGG - Intergenic
1187996679 X:24934420-24934442 CCTGAGTGTCACCACCAATAGGG + Intronic
1193661764 X:84266999-84267021 TCTGTAGGTCACCATCATCAAGG - Intergenic
1193785601 X:85756858-85756880 TCTGCACATCACCATCATCAAGG - Intergenic
1201171693 Y:11273145-11273167 TCTGTATGTCACCATCATCCAGG - Intergenic
1201249358 Y:12040360-12040382 TCTGTAGGTCACCATCATCAAGG + Intergenic