ID: 1184749063

View in Genome Browser
Species Human (GRCh38)
Location 22:46473736-46473758
Sequence GCCACCAGGAGCCACCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184749063_1184749065 -6 Left 1184749063 22:46473736-46473758 CCTGCTTGGTGGCTCCTGGTGGC 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1184749065 22:46473753-46473775 GGTGGCTCCCATTCAAAGCCAGG 0: 1
1: 0
2: 2
3: 7
4: 129
1184749063_1184749066 -5 Left 1184749063 22:46473736-46473758 CCTGCTTGGTGGCTCCTGGTGGC 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1184749066 22:46473754-46473776 GTGGCTCCCATTCAAAGCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 174
1184749063_1184749069 8 Left 1184749063 22:46473736-46473758 CCTGCTTGGTGGCTCCTGGTGGC 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1184749069 22:46473767-46473789 AAAGCCAGGGAACTTTGAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184749063 Original CRISPR GCCACCAGGAGCCACCAAGC AGG (reversed) Intronic
900014721 1:140077-140099 GCCGCAAGGAGCCACACAGCAGG - Intergenic
900044588 1:495279-495301 GCCGCAAGGAGCCACACAGCAGG - Intergenic
900044987 1:498686-498708 GCCGCAAGGAGCCACACAGCAGG - Intergenic
900065991 1:730185-730207 GCCGCAAGGAGCCACACAGCAGG - Intergenic
900066390 1:733594-733616 GCCGCAAGGAGCCACACAGCAGG - Intergenic
900066786 1:737000-737022 GCCGCAAGGAGCCACACAGCAGG - Intergenic
900067184 1:740416-740438 GCCGCAAGGAGCCACACAGCAGG - Intergenic
900384097 1:2401435-2401457 GCCAAAAGGAGCCACAAGGCTGG - Intronic
900753427 1:4415879-4415901 GCCACCAGGAGTCTACAACCAGG + Intergenic
900981421 1:6048242-6048264 ACCACCAGGGGCCAGCAGGCAGG - Intronic
903016454 1:20365230-20365252 GCCTCCAGTAACCACCAACCAGG + Intergenic
903174877 1:21574903-21574925 GCGCCCAGGACCCTCCAAGCTGG + Intronic
903856701 1:26342136-26342158 CCCCCCAGGAGCCAGCATGCAGG - Intronic
905276983 1:36824747-36824769 GGCCCCAGCAGCCACCAACCCGG + Intronic
910525722 1:88175776-88175798 ACTACCAGAAGCCACCAGGCAGG + Intergenic
912954260 1:114142724-114142746 GCCACCAGCAACCACCAAACTGG + Intronic
913465619 1:119140036-119140058 GCCACCAGGAGCAACCAGAATGG + Intronic
916526800 1:165618061-165618083 GCCAGCAGCAGCCCCCGAGCTGG + Intergenic
916717430 1:167457040-167457062 GGCATCAGCACCCACCAAGCCGG - Intronic
920746721 1:208635840-208635862 GCCACAAGGAGCCATCCACCTGG + Intergenic
922262215 1:223952670-223952692 GCCGCAAGGAGCCACACAGCAGG - Intergenic
924344040 1:243057651-243057673 GCCGCAAGGAGCCACACAGCAGG - Intergenic
1067607628 10:47680356-47680378 ACCAGCATGAGCCACCACGCCGG - Intergenic
1069751978 10:70750589-70750611 TCCTCCAGGAGCCCCCCAGCTGG - Intronic
1072680058 10:97499495-97499517 CCCACCAGGAGCTACCCAGTTGG - Intronic
1073079945 10:100853388-100853410 TCCACCCAGAGCCACCAGGCAGG + Intergenic
1073119353 10:101112116-101112138 CCCTCCAGGAGCCCCCAAGTTGG - Intronic
1074186471 10:111103046-111103068 CCCACAAGGACCCAGCAAGCAGG - Intergenic
1076811055 10:132886560-132886582 CCCACCAGGATCCACCCTGCTGG - Intronic
1076970919 11:131754-131776 GCCGCAAGGAGCCACACAGCAGG - Intergenic
1076971315 11:135177-135199 GCCGCAAGGAGCCACACAGCAGG - Intergenic
1077182731 11:1223856-1223878 GCCACCGGGAGACACCCAGCCGG + Intronic
1077416016 11:2424650-2424672 GACACCTGGAGCCCCGAAGCTGG + Intergenic
1077525289 11:3060561-3060583 GCCACCAGTGGCCACCGTGCAGG + Intergenic
1077608963 11:3632254-3632276 GTCACCAGGAGCCACAAAGCAGG - Intergenic
1078662330 11:13297523-13297545 CCCACCAGCAGCCCTCAAGCTGG - Intronic
1079535644 11:21512025-21512047 GCCACCAGGTGGCACCAAATAGG - Intronic
1083571133 11:63762921-63762943 GCAGCCAGCAGCCCCCAAGCCGG + Exonic
1083961098 11:66015526-66015548 GCTCCCATGTGCCACCAAGCAGG + Intergenic
1084503000 11:69545888-69545910 GCCTCCAGGAGGAACCAACCTGG + Intergenic
1084730722 11:71071814-71071836 GCCACCATGAGCCAACAGGATGG + Intronic
1084872681 11:72108751-72108773 GCCAGCAGGTGCCACCGTGCTGG + Exonic
1085339041 11:75719427-75719449 GCCTCCAGGAGCCCCAGAGCTGG - Intronic
1086584048 11:88431828-88431850 GACAGCAGGAGCCACAGAGCCGG - Intergenic
1090398495 11:126434258-126434280 GGCACCAGGAGCCACCGAGGGGG + Intronic
1090402462 11:126457989-126458011 GCCACCAGGAGCCCAGCAGCAGG - Intronic
1092523319 12:9294566-9294588 GCACCCATGAGCCTCCAAGCAGG - Intergenic
1092543975 12:9437333-9437355 GCACCCATGAGCCTCCAAGCAGG + Intergenic
1097410696 12:59248979-59249001 GCCACCAGGTGCCATGAAGAGGG + Intergenic
1098973544 12:76879175-76879197 GCCACCAGGAGACAAAAGGCAGG + Intergenic
1102196441 12:111028827-111028849 GCCACCAGGTGCCAGCAACAGGG + Intergenic
1102253989 12:111405828-111405850 GCCACCAGGAGCCACGCCTCAGG - Intergenic
1102255310 12:111411597-111411619 GCACCCTGGAGCCACCAAGTCGG - Intronic
1102549671 12:113682651-113682673 GACCTCAGGGGCCACCAAGCTGG - Intergenic
1108359069 13:49652689-49652711 GGCCCCAGAAGCCTCCAAGCAGG - Intergenic
1109388533 13:61665169-61665191 GGCAGCAGGAGCCACAGAGCTGG - Intergenic
1111878389 13:93924254-93924276 GGCACCAGCAGCCACAGAGCTGG - Intronic
1112435480 13:99388755-99388777 GCACTCAGGAGCCACGAAGCGGG + Intergenic
1115199783 14:30840602-30840624 GGCACCAGGAGCCTCAGAGCTGG + Intergenic
1116084120 14:40213511-40213533 GCAACCTGCAGCCACCAAACCGG - Intergenic
1116186835 14:41608482-41608504 GCCACCTGGAGCCACCTTGCCGG + Exonic
1119167986 14:72512006-72512028 GCCACCTGGGTCCATCAAGCTGG - Intronic
1119435943 14:74597861-74597883 CCCACCAGGAGCCAGGAACCAGG - Intronic
1121312480 14:92942739-92942761 GCCCTCGGGAGCCACCAAGCAGG + Intronic
1121632308 14:95430324-95430346 CCCACCAGGACCCACCAGGCTGG + Intronic
1122358339 14:101138051-101138073 GCCACCAGAAGCCCAGAAGCTGG + Intergenic
1122923334 14:104888881-104888903 GACAGCAGGCTCCACCAAGCAGG - Intronic
1124545845 15:30626121-30626143 GACACCCGGAGCCACCACGGGGG - Intronic
1125509242 15:40283803-40283825 GCCACCAGGAGCTGGCACGCGGG - Intronic
1128115503 15:65102413-65102435 GCCCCCAGCAGCCTCCAACCGGG - Exonic
1129457150 15:75682120-75682142 TCCTCCAGGAGCCGCCAGGCTGG - Intronic
1132519149 16:379450-379472 GCCACCAGGTCCCACCCACCAGG + Intronic
1132617314 16:848040-848062 ACCAGCAGGAGGCAGCAAGCAGG - Intergenic
1133006485 16:2884324-2884346 TCCACCATGAGGCACCAGGCAGG + Intronic
1133320283 16:4909299-4909321 GCCATCAGGAGCAGCCAAGGGGG + Intronic
1133384296 16:5356211-5356233 GCCACCAGGAGCCAGGAGGGAGG + Intergenic
1136094629 16:27946067-27946089 GGAACCAGGAGGCACCAGGCAGG + Intronic
1136190166 16:28610652-28610674 GTCCCCAGGAGCCATGAAGCTGG - Intronic
1136512690 16:30748726-30748748 GCCCCCGGGAGCCGCCATGCGGG + Intronic
1137028831 16:35503266-35503288 GCCACCAGGAGCCACACCTCAGG - Intergenic
1137506458 16:49057994-49058016 GCTCCCATGAGCCACCCAGCTGG + Intergenic
1138574259 16:57897525-57897547 GCCCCCAACAGCCAGCAAGCTGG + Exonic
1139666530 16:68460748-68460770 GAGACCAGGAGCCACCATGATGG - Intergenic
1139901185 16:70329794-70329816 GCCACCTGGGGCCACCTACCAGG + Intronic
1141625448 16:85259000-85259022 GCCCCCAGGAGCTGCCAGGCTGG + Intergenic
1141762162 16:86035790-86035812 GCCACCAGGAGCTAGAAGGCTGG + Intergenic
1142363499 16:89638099-89638121 TCCTGCAGGAGCCACCCAGCTGG - Exonic
1142402902 16:89870290-89870312 GCCTCCAGGAGGCACCAGGCAGG + Exonic
1142448938 16:90162345-90162367 GCCGCAAGGAGCCACACAGCAGG + Intergenic
1142449339 16:90165764-90165786 GCCGCAAGGAGCCACACAGCAGG + Intergenic
1142457757 17:66117-66139 GCCGCAAGGAGCCACACAGCAGG - Intergenic
1142458158 17:69537-69559 GCCGCAAGGAGCCACACAGCAGG - Intergenic
1142458552 17:72944-72966 GCCGCAAGGAGCCACACAGCAGG - Intergenic
1142487813 17:258205-258227 CCCACCAGGCTCCACCAAACAGG + Intronic
1143019250 17:3908156-3908178 GCCACCTGGAGCCCACAAGCCGG + Intronic
1143290731 17:5825998-5826020 CCCACCAGAGGCCACCAAGCAGG - Intronic
1143749922 17:9021037-9021059 GCCACCGGGGGCCATCAGGCTGG + Intergenic
1144677825 17:17173129-17173151 CCCACCAGGAGCCAGGCAGCCGG + Intronic
1145771239 17:27494866-27494888 GGCACAGGGAGCCACCCAGCAGG - Intronic
1146263281 17:31435482-31435504 GCCACCAGGAGGGACCTCGCTGG - Intronic
1146941264 17:36845960-36845982 GCCACCTGGAGACACGGAGCAGG - Intergenic
1147651101 17:42062482-42062504 GCTACCAGGAGGCTCCAGGCTGG + Intronic
1149655649 17:58308488-58308510 GCCACCAGGTGGCAGCAGGCAGG + Intronic
1150994912 17:70306423-70306445 GCAACCAGGAGACACTGAGCAGG + Intergenic
1151454534 17:74218129-74218151 AGCAGCAGGTGCCACCAAGCTGG + Intronic
1151489927 17:74426875-74426897 GCCACCAGGGGCCATCACTCTGG + Intronic
1151605033 17:75130620-75130642 GCCAGGAGGAGACCCCAAGCTGG - Exonic
1151605196 17:75131328-75131350 GCCCCCAGGAGCCTCCCTGCGGG - Intronic
1151911529 17:77086664-77086686 GCCACCAAGAGCCACCACCAGGG + Intergenic
1152244108 17:79176375-79176397 GCCCCCAGCACCCCCCAAGCAGG + Intronic
1152295712 17:79465974-79465996 GCCCCCAGGAACAACCCAGCTGG + Intronic
1152771693 17:82173778-82173800 CCCGCAAGGAGCCACCAAGGCGG + Intronic
1152893027 17:82893153-82893175 GCCACAAAGTGCCACAAAGCTGG - Intronic
1154047092 18:10916314-10916336 GGGACCAGGAGCCGCCTAGCAGG + Intronic
1156558355 18:38092830-38092852 ACCAGCATGAGCCACCAAGCCGG - Intergenic
1160647870 19:202043-202065 GCCGCAAGGAGCCACACAGCAGG - Intergenic
1160648268 19:205457-205479 GCCGCAAGGAGCCACACAGCAGG - Intergenic
1160962654 19:1730422-1730444 GCCACCAAGAGCCCCTGAGCGGG - Intergenic
1161042230 19:2116339-2116361 TCCACCACCAGCCACCCAGCTGG + Intronic
1161130861 19:2587717-2587739 GCCTCCAGGAGCTACCTGGCAGG + Intronic
1161371568 19:3914900-3914922 GCTACCAGGAGCCAGCAATGAGG + Intronic
1162509000 19:11105831-11105853 GCCACCATGAGGCCCCAGGCTGG + Intronic
1162800826 19:13109666-13109688 CCCACATGGGGCCACCAAGCTGG + Exonic
1162824637 19:13244111-13244133 GCCAGGAGAAGCCACCAAGTGGG - Intronic
1163268325 19:16234457-16234479 GCCACCAGGAGCCCCGAGGCCGG - Exonic
1163528545 19:17835969-17835991 GCCACCTGGTGCCAGCCAGCTGG - Exonic
1163896234 19:20062628-20062650 GCAACCAGGAGAAAGCAAGCAGG - Intergenic
1163900674 19:20096785-20096807 GCAACCAGGAGAAAGCAAGCAGG + Intronic
1163909622 19:20177188-20177210 GCAACCAGGAGAAAGCAAGCAGG + Intronic
1163918749 19:20267695-20267717 GCAACCAGGAGAAAGCAAGCAGG - Intergenic
1163924320 19:20324669-20324691 GCAACCAGGAGAAAGCAAGCAGG + Intergenic
1163933012 19:20416373-20416395 GCAACCAGGAGAAAGCAAGCAGG - Intergenic
1163935962 19:20443854-20443876 GCAACCAGGAGAAAGCAAGCAGG + Intergenic
1166597698 19:44064873-44064895 GACACAAGGAACCACCAATCAGG + Intronic
1166696861 19:44856778-44856800 GCCCCCAGGAGCCACATATCCGG + Intronic
1167077994 19:47260632-47260654 GCCCCCAGGGGCCAGCAAGGGGG + Exonic
1167117757 19:47498039-47498061 CCCACCCAGAGCCACCAAGGTGG + Intronic
1167118289 19:47500950-47500972 GCCACCAGGAGCCTCAGCGCAGG - Intronic
1167383620 19:49151935-49151957 CCCACCAGGATTCACCACGCTGG + Intronic
925792977 2:7511736-7511758 GCCACCATGTGGCACCATGCTGG + Intergenic
925913152 2:8586540-8586562 GCCCCCAGGAGCTCCCAAGCAGG + Intergenic
927672633 2:25081991-25082013 GCAAACAGGATCCAGCAAGCAGG + Intronic
932833132 2:75009710-75009732 GCCACCAGTAGTGACCAAGAGGG - Intergenic
935836789 2:107063847-107063869 GCCACCAGGGGCCCCCAACCAGG - Intergenic
936025540 2:109028492-109028514 GCCACCATGAGCCACTGTGCAGG - Intergenic
936152187 2:110027938-110027960 GCCTTCAGGAACCAGCAAGCTGG - Intergenic
936192491 2:110343475-110343497 GCCTTCAGGAACCAGCAAGCTGG + Intergenic
937605015 2:123789630-123789652 GCCACGAGCAGCCGGCAAGCAGG + Intergenic
938280681 2:130061664-130061686 GCCATCAGGAAGCACCAATCAGG + Intergenic
938280788 2:130062295-130062317 GCCATCAGGAAGCACCAATCAGG + Intergenic
938403116 2:131010628-131010650 GCTACCAGGAACCACCAATGTGG - Intronic
941713638 2:168741324-168741346 TCCAAGAGGAGGCACCAAGCAGG + Intronic
942454466 2:176128871-176128893 CCCCCCAGGAGCCTCCCAGCCGG - Intergenic
944157210 2:196620071-196620093 GCCACCAGGACCCTGCAAGATGG + Intergenic
944229838 2:197381444-197381466 GACACAAGGAAACACCAAGCGGG + Intergenic
948555645 2:238808652-238808674 GCAGCCATGAGTCACCAAGCAGG - Intergenic
948572657 2:238927301-238927323 GCCTCCGTGAGCCACCAGGCAGG + Intergenic
948625032 2:239263484-239263506 ACCACCAGGAACCCCCAGGCAGG + Intronic
1172278538 20:33694424-33694446 GCCAGCTGGATCCACCAGGCAGG - Intergenic
1173518148 20:43679627-43679649 GCCACCGTGACCCACCAAGTTGG - Intronic
1174611000 20:51798917-51798939 GACACCATGGGCCATCAAGCAGG + Intronic
1174688318 20:52477044-52477066 GCAACCAGGAGTCACCTAACTGG - Intergenic
1175342939 20:58246359-58246381 GACACCAGGAGACACAAAGAGGG - Intergenic
1176297823 21:5083606-5083628 GCCACCAGAGGCCACCAGGCAGG + Intergenic
1176372717 21:6072009-6072031 GCGACCACCAGCCACCAAGACGG - Intergenic
1179469639 21:41602055-41602077 CCCACCACAAGCCACCAAACTGG - Intergenic
1179726610 21:43344622-43344644 ACCCCCAGGAGCCCCCACGCAGG - Intergenic
1179859206 21:44178343-44178365 GCCACCAGAGGCCACCAGGCAGG - Intergenic
1180174047 21:46078946-46078968 GTCACCCGGAGTCCCCAAGCTGG + Intergenic
1181560873 22:23698795-23698817 GCCACCATGAGCCACACATCAGG - Intronic
1184286791 22:43476545-43476567 GTCACCATGAGGCACCAACCAGG - Intronic
1184287019 22:43477539-43477561 GCCACCATGTGGCACCAACCAGG - Intronic
1184466752 22:44672972-44672994 GCCATCAGGAACCACCATGGCGG + Intronic
1184749063 22:46473736-46473758 GCCACCAGGAGCCACCAAGCAGG - Intronic
1185179005 22:49348682-49348704 GCCCCCTGCAGCCACCATGCAGG + Intergenic
1185285974 22:50000043-50000065 CCCAGCAGGAGCCACCACGTCGG - Intronic
1185342738 22:50299013-50299035 GCCAAGAGCAGCCCCCAAGCTGG - Intronic
1185420415 22:50731583-50731605 GCCACCAGGAGCTGCGAAGGAGG - Intergenic
949336164 3:2978056-2978078 GCCTCCAGCAGCAACCAACCTGG + Intronic
950169968 3:10832181-10832203 GCCACTAGGAGCCAAGAGGCTGG - Intronic
955803067 3:62706001-62706023 GAAGCCAGGAGCCACAAAGCAGG - Intronic
956710499 3:72034966-72034988 CCAACCAGGAGCCACAAACCAGG - Intergenic
961268925 3:125672627-125672649 GCCAGCAGCAGCAACCAAGTGGG + Intergenic
961466669 3:127085916-127085938 TGCACCAGGAGCCACCACCCAGG + Intergenic
961471254 3:127114622-127114644 GCCACCAGCAGCCATGCAGCTGG + Intergenic
961734601 3:128993641-128993663 GCTCCCGGGAGCCACCAGGCGGG + Intronic
962616827 3:137134945-137134967 GTCACCATTATCCACCAAGCTGG - Intergenic
965971481 3:174561474-174561496 ACCGCCATGAGCCACCATGCCGG + Intronic
966849418 3:184155512-184155534 GCCGCCAGCAGCCGCCGAGCTGG + Exonic
967880332 3:194297195-194297217 GCCGGGAGGAGCCAGCAAGCTGG - Intergenic
968142908 3:196273495-196273517 GCCCTCAGGAGACCCCAAGCGGG + Intronic
968369578 3:198214658-198214680 GCCGCAAGGAGCCACACAGCAGG + Intergenic
968369977 3:198218072-198218094 GCCGCAAGGAGCCACACAGCAGG + Intergenic
968616333 4:1579272-1579294 GCCACCAGGGGGCGCCCAGCAGG - Intergenic
968997658 4:3955717-3955739 GCCTCCAGGACCCGCCAACCTGG - Intergenic
969177431 4:5409309-5409331 GACTCCAGGAGGCACCATGCTGG - Intronic
969971376 4:11051856-11051878 GCCACCAGAACCAACCAATCAGG + Intergenic
971404875 4:26313197-26313219 ACAAGCATGAGCCACCAAGCCGG + Intronic
974919366 4:68219456-68219478 GCAACCTGGAGCCACCATCCTGG + Intergenic
976131139 4:81885190-81885212 TCCACAAGGAACTACCAAGCCGG + Intronic
976209650 4:82654687-82654709 GCCACTGGGAGCCACCTACCTGG - Intronic
976257067 4:83110068-83110090 GGCGCCAGGAGCCGCAAAGCTGG + Intronic
978529281 4:109698016-109698038 GCCCCCAGGATCCAGCAACCAGG + Intronic
985809913 5:2075419-2075441 GGCACCTGCTGCCACCAAGCAGG + Intergenic
986667241 5:10114365-10114387 GCTCCCAGGAGACACCAAGAGGG - Intergenic
986890577 5:12299721-12299743 GCCACCAGCAACCACCAGGTGGG - Intergenic
988716482 5:33834052-33834074 GCCATCTAAAGCCACCAAGCAGG - Intronic
990510875 5:56488010-56488032 GGGACCAGGAGCCACGGAGCAGG - Intergenic
991493889 5:67209458-67209480 GCCACATGGGGCCTCCAAGCAGG - Intergenic
995320013 5:110823817-110823839 GCCAGCTGGAGACACCCAGCTGG - Intergenic
997286126 5:132679917-132679939 TCCACCAGGAGCCACGCGGCCGG - Intronic
997519844 5:134515943-134515965 GCCATCTGTAGCCACCAGGCTGG + Intergenic
997598927 5:135126307-135126329 GCCAAGAGGAGCCACTAAGCGGG - Intronic
999039960 5:148398017-148398039 GCCACCTGGAGCCCTCCAGCTGG + Intronic
1001542441 5:172549138-172549160 CCCACCAGCAGCCACCAGCCTGG - Intergenic
1002728857 5:181320243-181320265 GCCGCAAGGAGCCACACAGCAGG + Intergenic
1002729256 5:181323650-181323672 GCCGCAAGGAGCCACACAGCAGG + Intergenic
1002915596 6:1525676-1525698 GCAACCAGGGGCCAGCGAGCTGG - Intergenic
1002932963 6:1646958-1646980 GCCCACAGGAGCCATCAAGGTGG - Intronic
1006444207 6:34069779-34069801 CCCACCAGGATCCACCCATCTGG + Intronic
1006653292 6:35569020-35569042 GCCACCAGGAGAAACCATCCTGG + Intergenic
1007092415 6:39192495-39192517 GCCCCCAGCACCCTCCAAGCTGG + Intronic
1007126122 6:39427069-39427091 GCAACCAGGACCCACCAGCCTGG - Intronic
1008480283 6:51978641-51978663 GACATCAGGTGCTACCAAGCAGG + Intronic
1008651123 6:53564028-53564050 GCCACCAAAAGCCACCTCGCTGG + Intronic
1010046003 6:71444337-71444359 GTCAGCAGGAAGCACCAAGCTGG - Intergenic
1013148082 6:107414788-107414810 GCCACAAGGAGACAGCAAGAAGG + Intronic
1014114095 6:117653242-117653264 GCCACCACGCCCCACCAAGAGGG - Intergenic
1014844480 6:126258393-126258415 GCCACCAGGAGCCAGGCAGCTGG - Intergenic
1016448825 6:144159950-144159972 CCCAGCATGAGCCACCAAGCTGG - Intronic
1017713633 6:157191551-157191573 GCCATCAGGAGACACCAGGCTGG + Intronic
1018071379 6:160167318-160167340 GCCACCTACAGCAACCAAGCAGG - Intergenic
1018913496 6:168118096-168118118 ATTACCTGGAGCCACCAAGCTGG + Intergenic
1019190377 6:170247470-170247492 GCCACCAGCATCCACCGAGGTGG + Intergenic
1019345760 7:529979-530001 GGCACCAGGAGCCACCAGTGTGG + Intergenic
1019508057 7:1403406-1403428 GCCTCCAGGAGACACCACACTGG + Intergenic
1020067599 7:5200908-5200930 GCCACCAGGAGCCATGAGTCAGG - Intronic
1023984588 7:45087491-45087513 GAGAGCAGGAGCCACCAGGCAGG - Intronic
1025791113 7:64687531-64687553 GCTACCAGGAGACGGCAAGCAGG + Intronic
1026734850 7:72942927-72942949 GCCACCGGGGGCCGCCAAGCCGG + Exonic
1026785183 7:73297839-73297861 GCCACCGGGGGCCGCCAAGCCGG + Intergenic
1029640270 7:101815951-101815973 GCCGCCAGGAGGCAGCAGGCGGG - Intronic
1032050981 7:128650786-128650808 GCCACAAGGAACCACACAGCAGG + Intergenic
1034183690 7:149157921-149157943 GCCACCATGAGCCACGGCGCTGG - Intronic
1034509307 7:151520745-151520767 CCCTCCAGCAGCCACCACGCCGG - Intergenic
1035068254 7:156123263-156123285 GCCACGTGGAGCGACCACGCAGG - Intergenic
1035638024 8:1161818-1161840 GCCACCAAGAGGCACCAATGTGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1039731572 8:40284754-40284776 GGCACCAGGAGCTTCAAAGCTGG - Intergenic
1041854710 8:62438425-62438447 GCCCCCAGGAGCCACAGAGAGGG - Intronic
1048738306 8:137526348-137526370 GCTACCTGAAGCCACCATGCTGG - Intergenic
1048889643 8:138936103-138936125 GACCCCAGGGGCCCCCAAGCAGG - Intergenic
1049606689 8:143532863-143532885 GCCACCGTGAGACTCCAAGCTGG - Intronic
1049610198 8:143551571-143551593 GCCAGCTGGAGACACCCAGCCGG - Intergenic
1049753175 8:144295383-144295405 AGCCCCAGGAGCCACCCAGCTGG + Intronic
1051513721 9:17906880-17906902 GGCACCAGGTGCCACCGAGGAGG - Intergenic
1052537512 9:29765967-29765989 TACACCAGCAGCAACCAAGCAGG + Intergenic
1053678347 9:40461353-40461375 GGGACCAGGCGCCACGAAGCAGG - Intergenic
1053928329 9:43089697-43089719 GGGACCAGGCGCCACGAAGCAGG - Intergenic
1054285378 9:63163594-63163616 GGGACCAGGCGCCACAAAGCAGG + Intergenic
1054291424 9:63296890-63296912 GGGACCAGGCGCCACGAAGCAGG - Intergenic
1054389442 9:64601429-64601451 GGGACCAGGCGCCACAAAGCAGG - Intergenic
1054506273 9:65914942-65914964 GGGACCAGGCGCCACGAAGCAGG + Intergenic
1054827957 9:69591616-69591638 GCCCAGAGGAGGCACCAAGCTGG + Intronic
1056836894 9:89962739-89962761 GCCACCCTGAGCCACTAAGGGGG - Intergenic
1057053781 9:91946358-91946380 GCCCCGAGGAGCCCCCAAGGAGG + Intronic
1061039062 9:128129109-128129131 GCAAGCAGGAGCTAGCAAGCAGG - Intergenic
1061381896 9:130263895-130263917 GCCAACAGGAGCCAGGAACCAGG - Intergenic
1061612288 9:131755071-131755093 GCCAACCGGAGCCAGCAACCAGG - Intergenic
1062045066 9:134421235-134421257 GCCTCCAGGAGCCAGCCGGCAGG - Intronic
1062185476 9:135216021-135216043 GCGACCAGGACCCACCAAGGTGG - Intergenic
1062283227 9:135761293-135761315 CCCACCAGGAACCACCATGTGGG + Intronic
1062519703 9:136952551-136952573 GCTTCCAGGAGCCCCCAGGCGGG + Intronic
1062753917 9:138277342-138277364 GCCGCAAGGAGCCACACAGCAGG + Intergenic
1203576436 Un_KI270745v1:12121-12143 GCCGCAAGGAGCCACACAGCAGG + Intergenic
1203576833 Un_KI270745v1:15530-15552 GCCGCAAGGAGCCACACAGCAGG + Intergenic
1203577235 Un_KI270745v1:18952-18974 GCCGCAAGGAGCCACACAGCAGG + Intergenic
1187310428 X:18136228-18136250 CCCACCAGGGGTCACAAAGCTGG - Intergenic
1189198926 X:39175323-39175345 GTCTCCAGGAGGCACCAAGCAGG + Intergenic
1189269616 X:39741771-39741793 GCCACCAGGAGAAACAAAGAGGG + Intergenic
1192208669 X:69112840-69112862 GTCACCAAGGGCCACCAAGGAGG - Intergenic
1193731253 X:85106742-85106764 GCCCCCAGGAGCCAAGGAGCTGG - Intronic
1198494651 X:137179569-137179591 TCCAACAGGAGCTATCAAGCTGG - Intergenic
1199248224 X:145631308-145631330 CCCACATGGAGCAACCAAGCTGG - Intergenic
1201904667 Y:19076845-19076867 GCCAACAGGGGGCTCCAAGCGGG - Intergenic