ID: 1184751326

View in Genome Browser
Species Human (GRCh38)
Location 22:46488108-46488130
Sequence CTGAAACTGAGGTGCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184751326_1184751337 8 Left 1184751326 22:46488108-46488130 CCTGCCCTGCACCTCAGTTTCAG No data
Right 1184751337 22:46488139-46488161 TCTGCAGGCTGACAGCAGCTGGG 0: 1
1: 0
2: 3
3: 33
4: 298
1184751326_1184751339 30 Left 1184751326 22:46488108-46488130 CCTGCCCTGCACCTCAGTTTCAG No data
Right 1184751339 22:46488161-46488183 GTGACAGCAGGAAGCAGCTGTGG 0: 1
1: 1
2: 5
3: 48
4: 495
1184751326_1184751336 7 Left 1184751326 22:46488108-46488130 CCTGCCCTGCACCTCAGTTTCAG No data
Right 1184751336 22:46488138-46488160 CTCTGCAGGCTGACAGCAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 308
1184751326_1184751335 -7 Left 1184751326 22:46488108-46488130 CCTGCCCTGCACCTCAGTTTCAG No data
Right 1184751335 22:46488124-46488146 GTTTCAGGGGAGGGCTCTGCAGG 0: 1
1: 0
2: 1
3: 48
4: 401
1184751326_1184751338 18 Left 1184751326 22:46488108-46488130 CCTGCCCTGCACCTCAGTTTCAG No data
Right 1184751338 22:46488149-46488171 GACAGCAGCTGGGTGACAGCAGG 0: 1
1: 2
2: 1
3: 36
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184751326 Original CRISPR CTGAAACTGAGGTGCAGGGC AGG (reversed) Intronic
No off target data available for this crispr