ID: 1184751335

View in Genome Browser
Species Human (GRCh38)
Location 22:46488124-46488146
Sequence GTTTCAGGGGAGGGCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 401}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184751325_1184751335 16 Left 1184751325 22:46488085-46488107 CCAGTGGAGGCACGGGGAGGGGT 0: 1
1: 0
2: 1
3: 29
4: 259
Right 1184751335 22:46488124-46488146 GTTTCAGGGGAGGGCTCTGCAGG 0: 1
1: 0
2: 1
3: 48
4: 401
1184751326_1184751335 -7 Left 1184751326 22:46488108-46488130 CCTGCCCTGCACCTCAGTTTCAG No data
Right 1184751335 22:46488124-46488146 GTTTCAGGGGAGGGCTCTGCAGG 0: 1
1: 0
2: 1
3: 48
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184751335 Original CRISPR GTTTCAGGGGAGGGCTCTGC AGG Intronic
900318038 1:2069171-2069193 GATGCAGGGGAGGGCTCTCCCGG - Intronic
900401127 1:2473386-2473408 AGTGCATGGGAGGGCTCTGCGGG - Intronic
901261464 1:7874762-7874784 GTGTCAGGGGAGGGACCTGGTGG + Intergenic
901296593 1:8165693-8165715 GTGTCAGGGGAGGGACCTGGTGG + Intergenic
901451977 1:9341344-9341366 GCTTCAGGGGAAGGGGCTGCTGG - Intronic
902584082 1:17427371-17427393 CTTTCAGGGGAGGTGTCTGCAGG - Intronic
902707404 1:18215133-18215155 GTGTCAGGGGAGGGATCTGGTGG - Intronic
902900578 1:19512805-19512827 GTGTCAGGGGAGGGACCTGGTGG + Intergenic
902933021 1:19744770-19744792 GTTTCTGGGGAAGGTTCTGAAGG - Intronic
903189495 1:21648887-21648909 GCTTCCCAGGAGGGCTCTGCGGG + Intronic
903245599 1:22012991-22013013 GTTTTAGAGGAGGGCTCAGAGGG + Intergenic
903591840 1:24462235-24462257 GTGTCATGGGAGGGACCTGCTGG - Intronic
903722840 1:25418772-25418794 GTGTCAGGGGAGGCTTCTGGAGG - Intronic
903741945 1:25563524-25563546 GTGCCAGGGCCGGGCTCTGCTGG + Intronic
903875331 1:26469921-26469943 GTTACAGGGGAGGCCTGTGCTGG - Exonic
904401614 1:30260354-30260376 TTTACAGGGGAGGACTCTGAGGG - Intergenic
905897940 1:41560883-41560905 GTTTGAGGTGAGGCATCTGCTGG - Intronic
906345715 1:45013076-45013098 GGGGCAGGGGAGGGCTCTGGAGG + Intronic
906756799 1:48325331-48325353 CCTTCAGGGGAGGACTCTACGGG - Intronic
907188723 1:52631988-52632010 GAAGCAGGGGAGGGCTCTGAGGG - Intergenic
907274821 1:53311234-53311256 GTTTACAGGGAGGGCCCTGCTGG + Intronic
907599815 1:55756853-55756875 ATTTCAGGGGAGGGCTTTGATGG - Intergenic
908205556 1:61844712-61844734 GTGTCAGGGGAGGGACCTGGTGG + Intronic
908476248 1:64491588-64491610 GTGTCAGGGGAGGGTCCTGGAGG - Intronic
908663272 1:66461511-66461533 GTGTCAGGGGAGGGACCTGGTGG + Intergenic
909085831 1:71169305-71169327 GTGTCAGGGGAGGGATCTGGTGG - Intergenic
909486352 1:76178761-76178783 GGTTCAGAGCAGAGCTCTGCTGG + Intronic
909985678 1:82158037-82158059 GTGTCAGGGGAGGGACCTGGTGG + Intergenic
910466219 1:87503089-87503111 GTGTCAGGGGAGGGGTCTAGTGG - Intergenic
912551789 1:110489682-110489704 GTTTCTCCGGAGGCCTCTGCTGG + Intergenic
912735784 1:112148360-112148382 GTTACAGGGGAGGGACCTGGTGG + Intergenic
912752979 1:112300878-112300900 ATCCCAGGGCAGGGCTCTGCTGG - Intergenic
912775190 1:112502313-112502335 GGTGCAGGGCAGGGCTCTGGCGG - Intronic
914506067 1:148290014-148290036 ATGTCAGGGGAGGGGTCTACTGG - Intergenic
915058570 1:153159884-153159906 ATTTCAAGGGAGGGACCTGCTGG - Intergenic
915787810 1:158635190-158635212 GTATCAGGGGAGGGGCCTGGTGG + Intronic
916786371 1:168089913-168089935 GGCTAAAGGGAGGGCTCTGCAGG + Intronic
916796470 1:168171997-168172019 ATTTCAGGGCAGGGCTGGGCAGG + Intergenic
917424635 1:174901520-174901542 GTGTCATGGGAGGGCTCAGGTGG - Intronic
917508061 1:175647023-175647045 ATTTCAGGGCTGGCCTCTGCTGG - Intronic
917687772 1:177434950-177434972 GTTTCAGGGGAGTTCAATGCAGG - Intergenic
919179362 1:194060843-194060865 GTATCAGGGGAGGGGCCTGGTGG - Intergenic
919212716 1:194509442-194509464 GTTTCAAGGGAGGGACCTGGTGG + Intergenic
920956609 1:210625497-210625519 GATTCAGGGAATTGCTCTGCTGG + Intronic
921300808 1:213749770-213749792 ACTTCAGGAGAGGGCTCTGCTGG + Intergenic
923428271 1:233893290-233893312 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
924261464 1:242235742-242235764 CTTTCAAGGAAGGGCTATGCTGG + Intronic
924936741 1:248778166-248778188 GTGTCAGGGGAGGGGCCTGGTGG + Intergenic
1062861270 10:812297-812319 GTTTCTGGGGTGGCCCCTGCAGG + Exonic
1063009251 10:2006617-2006639 GATTCTGGGGAGGGCTCAGACGG + Intergenic
1063418001 10:5889516-5889538 GTTTGAGGAGGCGGCTCTGCCGG - Exonic
1064238087 10:13595882-13595904 GTTTCAGGGGAAGGATATACAGG - Intronic
1064556265 10:16550023-16550045 GTGTCAGGGGAGGGACCTGGTGG + Intergenic
1064858622 10:19799413-19799435 GTGTCAGAGGAGGGCCCTGGTGG - Intergenic
1065217806 10:23467138-23467160 GTGTCATGGGAGGGATCTGGTGG + Intergenic
1067452821 10:46392773-46392795 GCTTCTGGGGAGGCCTCTGGAGG + Intergenic
1067584411 10:47466982-47467004 GCTTCTGGGGAGGCCTCTGGAGG - Intronic
1067927627 10:50526387-50526409 GTGTCAGGGGAGGGACCTGGTGG - Intronic
1069113707 10:64477626-64477648 ATGTCAAGGGAGGGATCTGCTGG - Intergenic
1069528968 10:69201115-69201137 CTTCCAGGGGAAGGCTGTGCTGG + Intronic
1069765267 10:70852106-70852128 GGGTCAGGGGAGGGCACTGGAGG - Intronic
1069868950 10:71521533-71521555 ATCTCAGGGGAGGGCACCGCAGG - Intronic
1070044376 10:72817010-72817032 GTGTCAGGGGAGGAATATGCAGG - Intronic
1070801169 10:79245177-79245199 GAGCCAGGGGAGGGCTGTGCAGG - Intronic
1071295483 10:84216407-84216429 GTTTCAGGAGAGGACTGTGCTGG + Exonic
1072663737 10:97379518-97379540 GTGTCAGTGCAGGGCTCAGCAGG - Intronic
1074186062 10:111100352-111100374 ATTTCAGGGAGGGGCACTGCAGG + Intergenic
1074413674 10:113248874-113248896 GTTTTGGGGGCAGGCTCTGCAGG - Intergenic
1074868433 10:117558511-117558533 GGTTCAGGACAGGGCTATGCTGG - Intergenic
1074890997 10:117736585-117736607 TCTTCAGGTGAGGGCTGTGCTGG + Intergenic
1075152212 10:119944121-119944143 GTGTCAGGGGAGGGACCTGGTGG + Exonic
1075906360 10:126085091-126085113 CTTTCAGGGGAAGGCCCTGCTGG + Intronic
1076345567 10:129776638-129776660 GATTCAGGGGAGGCATGTGCAGG + Intergenic
1076445624 10:130512072-130512094 GGTTCTGGGGAGGGCTCTTCTGG + Intergenic
1076500041 10:130929991-130930013 ATTGCAGGGGATGGCTCAGCAGG - Intergenic
1077286563 11:1768558-1768580 GGGGCAGGGGAGGGCCCTGCGGG + Intergenic
1077448966 11:2623020-2623042 GTGTCAGGGGAGGGGCCTGGTGG + Intronic
1078308798 11:10218353-10218375 GTGTCATGGGAGGGATCTGGTGG - Intronic
1078401128 11:11028223-11028245 GTATGAGGTGAGGGCTGTGCGGG + Intergenic
1078669118 11:13349246-13349268 GTTTCAGGTGTTGGCTCTGCTGG + Intronic
1079894000 11:26095632-26095654 GTGTCAGGGGAGGGGCTTGCTGG - Intergenic
1080182452 11:29441689-29441711 GTGTCATGGGAGGGATCTGGTGG + Intergenic
1080441078 11:32295151-32295173 GTGTCATGGGAGGGACCTGCTGG - Intergenic
1080502310 11:32882513-32882535 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
1080962987 11:37181771-37181793 GTTTGAAGGCAGGGTTCTGCTGG - Intergenic
1083185804 11:61017284-61017306 GATTAAGGCGAAGGCTCTGCTGG + Intronic
1083322250 11:61854990-61855012 GTTACAGGGGCTGCCTCTGCTGG - Intronic
1084322470 11:68381323-68381345 GTGTCACGGGAGCCCTCTGCAGG + Intronic
1085388483 11:76170515-76170537 GACTCAGGGGAGGATTCTGCTGG + Intergenic
1085459259 11:76683293-76683315 GTGTCAAGGGAGGGATCTGGTGG + Intergenic
1086032760 11:82380000-82380022 GTGTCAGGGGAGGGATCTTGTGG - Intergenic
1086563646 11:88198237-88198259 GTTTGTGGGGAGGGTTTTGCTGG + Intergenic
1086902795 11:92386715-92386737 GTTTGAGGGGAGAGCTCCCCAGG + Intronic
1088111815 11:106270474-106270496 GTGTCAGGGGAAGGCTTTGCAGG - Intergenic
1088771937 11:113043816-113043838 GTGTCAGGCGGGGGCCCTGCAGG - Intronic
1089136684 11:116254861-116254883 GTTTCTGGTGAGGCCTCTCCTGG + Intergenic
1089284165 11:117394997-117395019 GGTCCAGGTGAGGGATCTGCAGG + Exonic
1089350289 11:117818192-117818214 GTTTGGGGGGTGGCCTCTGCAGG - Intronic
1090422956 11:126588403-126588425 GTTACCTGGGAGGGCTATGCTGG + Intronic
1091401876 12:186062-186084 GGGTCAGGGGAGGGCTCTGGAGG + Intergenic
1091532751 12:1375383-1375405 GTGTCAGGGGAGGGGCCTGGTGG - Intronic
1092175261 12:6400373-6400395 GTTGGAGAGGAGAGCTCTGCTGG + Intergenic
1093688912 12:22087332-22087354 GTGTCAGGGGAGGCATCTGGTGG + Intronic
1094251609 12:28368955-28368977 GTGTCAGGGGAGGGCCTTGGTGG - Intronic
1095719779 12:45387768-45387790 GTGTCAGGGGAGGGGCCTGGTGG + Intronic
1095949498 12:47773978-47774000 GTCTCAGCAGAGGGCTCTGCGGG - Intronic
1098319678 12:69230892-69230914 GTGTCAGGGGAGGGGCCTGGTGG - Intergenic
1099667572 12:85652069-85652091 GTTTCAGCTGAGAGGTCTGCTGG + Intergenic
1100898919 12:99215997-99216019 GTGTCAAGGGAGGGCCCTGGAGG + Intronic
1102101215 12:110280750-110280772 GTTTCTGAGGGGGGCTCTGAAGG + Intronic
1103600519 12:122051590-122051612 CTCTCAGGAGAGGCCTCTGCCGG + Intronic
1103700027 12:122844454-122844476 GGGTCAGGGGAGGTCTCTGGAGG - Intronic
1104037423 12:125107273-125107295 GTCTCTGGGGAAGGCTCTGCAGG + Intronic
1104650419 12:130527315-130527337 GTGTCGGGGGAGGGTTCTGGGGG + Intronic
1104729056 12:131095012-131095034 GGTACAGGGGAGGGCCCTGGGGG - Intronic
1106025154 13:25949189-25949211 GTTCCAAGGCTGGGCTCTGCAGG + Intronic
1106127146 13:26909834-26909856 GTGGGAGGGAAGGGCTCTGCTGG + Intergenic
1106355073 13:28974158-28974180 GTTTCCGTGGTGGGCTCTGCAGG + Intronic
1107536068 13:41333948-41333970 GTCTCAGTGGAGGGGTCTGATGG + Intronic
1107554322 13:41504254-41504276 GTGTCATGGGAGGGATCTGGTGG - Intergenic
1107717393 13:43214393-43214415 ATATCAGGGGAGGGCTGTTCAGG - Intronic
1109391936 13:61705086-61705108 GTGTCATGGGAGGGATCTGGTGG + Intergenic
1110317530 13:74128346-74128368 CTTTCAGGGGAGGGCAGTGTGGG + Intronic
1110320806 13:74158150-74158172 GCTTCAGGGGAAGGCCCTGTGGG + Intergenic
1110539094 13:76687744-76687766 GTGTCAGGGGAGGGGCCTGGTGG - Intergenic
1110614766 13:77529361-77529383 GTTTCAGATCAGGGCTGTGCAGG - Intergenic
1110955232 13:81545830-81545852 GTGTCATGGGAGGGATCTGGTGG - Intergenic
1111459866 13:88525095-88525117 GTTTCATGGGAGGGACCTGGTGG + Intergenic
1111553562 13:89849546-89849568 GTGTCAGGGGAGGGTCCTGGTGG - Intergenic
1111953137 13:94726656-94726678 GTATCTGGGCAGGGCTCAGCAGG - Intergenic
1112753970 13:102609787-102609809 GTGTCAGGGGAGGGATGTGGTGG - Intronic
1112881131 13:104107746-104107768 GTTTCTTGGGATGACTCTGCAGG - Intergenic
1113065415 13:106369025-106369047 GTTTGTGGGGCAGGCTCTGCAGG - Intergenic
1113483672 13:110639354-110639376 GTCTCAGGAGAAGGCTCTGGAGG + Exonic
1113497107 13:110739564-110739586 GTGTCAGGGGAGGGGTCTGGTGG + Intergenic
1114635216 14:24183340-24183362 CATTCAGGTGAGGGCACTGCAGG + Exonic
1115259167 14:31435756-31435778 GTTTCCGGTGAGAGCTCTGATGG - Intronic
1115440752 14:33432588-33432610 GTTTCAAAGGAGCCCTCTGCTGG + Intronic
1115599270 14:34940017-34940039 GTTTCACTGGAGGCCTCTCCTGG - Intergenic
1116047815 14:39765745-39765767 GTGTCATGGGAGGGATCTGGTGG + Intergenic
1116375204 14:44190632-44190654 GTGTCAGAGGAGGGATCTGGTGG + Intergenic
1116603314 14:46956792-46956814 TTCTCAGGGGAGGGCTCTAGTGG + Intronic
1117564206 14:56976963-56976985 GATTCAGTGGAGGCCTCTGTGGG - Intergenic
1117786294 14:59289311-59289333 GTGTCAGGGGAGGGGCCTGGTGG - Intronic
1117952817 14:61099813-61099835 GTATCGGGGGAGGGATCTGGTGG + Intergenic
1118261638 14:64252763-64252785 GTGTCAAGGGAGGGATCTGGTGG - Intronic
1118978533 14:70698095-70698117 GTTTGAGGTGAGGGCTAGGCAGG + Intergenic
1120570860 14:86115436-86115458 GTGTCAGGAGAGGGGTCTGGTGG + Intergenic
1121312490 14:92942768-92942790 ATCTCAGGGGAGGATTCTGCTGG + Intronic
1121708661 14:96020275-96020297 GTGTCAGGGGAGGGACCTGGTGG + Intergenic
1121870128 14:97399723-97399745 GTTTCAGGGGAGGGACCTGGTGG - Intergenic
1202865692 14_GL000225v1_random:115342-115364 GTTTCAGGGATTGGCTCTCCGGG + Intergenic
1126434975 15:48627738-48627760 ATTTCAGGGAAGAGCTGTGCTGG - Intronic
1129452479 15:75658768-75658790 AGTTCAGGGGAGGGCTATGCTGG + Exonic
1129726982 15:77906345-77906367 ATTTCTGGGGAGGGGTCTGTGGG + Intergenic
1129900074 15:79140665-79140687 CTTTCAGTGGAGGGCTATGGAGG + Intergenic
1130650436 15:85759499-85759521 GTCCCAGGGGACGGCTCTGCTGG - Exonic
1131361430 15:91794350-91794372 GTGTCAAGGGAGGGACCTGCTGG + Intergenic
1131512347 15:93056286-93056308 GTTTCAGAGAAGGGGGCTGCAGG + Intronic
1132225848 15:100140873-100140895 GTTTCCAGGGAGAACTCTGCAGG - Intronic
1132239246 15:100244932-100244954 GTTTTCGGGGAGGGCTTTGTTGG + Intronic
1132715107 16:1286233-1286255 GTCTCGGGGCAGGGATCTGCGGG + Intergenic
1132804141 16:1767971-1767993 GGTTCACGGGGTGGCTCTGCAGG + Intronic
1133230475 16:4364325-4364347 GTGTCAGGGAGGGGCTCCGCAGG + Exonic
1133271009 16:4610819-4610841 GTGCAGGGGGAGGGCTCTGCAGG - Intronic
1133748412 16:8705377-8705399 GTGTCAAGGGAGGGATCTGGTGG - Intronic
1133875715 16:9732477-9732499 GTGTCAGGGGAGGGCCCGGTAGG - Intergenic
1134231357 16:12432907-12432929 GTTTTAGGGAAGGGCTTTGGTGG + Intronic
1135791229 16:25398098-25398120 GTGTCATGGGAGGGCCCTGGTGG + Intergenic
1136229106 16:28876635-28876657 GCTTCAGGGGAGGGGTTTGTTGG + Intergenic
1136243719 16:28960824-28960846 GTTTCTGGTGAGGTCTCTGGAGG - Intronic
1137694145 16:50449926-50449948 GCTACAGGGGAGAGCTCAGCAGG + Intergenic
1137707733 16:50547600-50547622 TTGTCTGGGGAGGTCTCTGCGGG - Intergenic
1138119086 16:54383803-54383825 GTGTCAGGGGAGGGACCTGGTGG + Intergenic
1138510101 16:57503804-57503826 GTCTCAAGGGATGGCTCTTCAGG - Intergenic
1141727925 16:85801988-85802010 GTTTCAGGGAAGGCTTCTGGAGG + Intronic
1141866195 16:86751762-86751784 GTGCCGGGGGAGGGCTCTGCTGG - Intergenic
1142533315 17:597263-597285 GTTGGAGGGAAGGTCTCTGCCGG - Intronic
1142702809 17:1674426-1674448 TTTTCAGGTGAGGGCTTTCCTGG - Exonic
1143540426 17:7565180-7565202 GCTGAAGGGGAGGACTCTGCAGG + Intronic
1143545393 17:7592292-7592314 GTTCCAGGGGTGGCCTCTGGCGG + Exonic
1147976419 17:44250584-44250606 GTGCCCGGGGAGGGCTCTTCTGG - Intronic
1148228265 17:45914618-45914640 GTTTCAGTGGTGGCCTCTGGTGG + Intronic
1148776639 17:50099362-50099384 GTTTCAGGAAGGGACTCTGCAGG - Intronic
1149701732 17:58660870-58660892 GTTTCATTGGAGGCCTCTTCTGG + Intronic
1153487636 18:5616171-5616193 GATTCACGGGCGGGCTGTGCAGG - Intronic
1154091690 18:11369827-11369849 GTGTCAGGGGAGGGCCCTGGTGG - Intergenic
1154396407 18:13994176-13994198 GTTTCTGTGGAGGGCACAGCAGG - Intergenic
1155422925 18:25675190-25675212 GTTTGAGGGCAGGGCTTTGAGGG - Intergenic
1156416386 18:36895918-36895940 GTTTCTGGTGAGGGCTCTCTTGG - Intronic
1157083123 18:44549849-44549871 GTATCAGGGGTGTGCTCTGTTGG - Intergenic
1157095629 18:44683187-44683209 GTTACATAGGAAGGCTCTGCTGG + Intronic
1157252669 18:46109328-46109350 GTGTCAGGGGAGGGGACTGATGG - Intronic
1158172636 18:54616755-54616777 CTTTCTGGGGAGAGCACTGCAGG - Intergenic
1158526687 18:58220905-58220927 GTCCCAGGGTAGAGCTCTGCTGG + Intronic
1158984906 18:62804271-62804293 GTGTCAGGGGAGGGACCTGATGG - Intronic
1159377588 18:67613809-67613831 GTGTCAGGGGAGGGGCCTGGTGG + Intergenic
1159627293 18:70709493-70709515 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
1159812058 18:73027497-73027519 GCTTCAGGGGAGGGACCTGGTGG + Intergenic
1160067966 18:75595010-75595032 GTTTCAAGGGAGGGAACTGGTGG - Intergenic
1160088321 18:75801161-75801183 TTTTCAAGGAAGGGCTCTGCAGG + Intergenic
1160231602 18:77053256-77053278 GCTTCAGGGGAGGGGTGGGCAGG + Intronic
1160354834 18:78218493-78218515 GAGTCCGGGGAGGGCTCTGCAGG - Intergenic
1160462902 18:79052882-79052904 GTTGCTGGAGAGGGGTCTGCTGG - Intergenic
1160750693 19:732885-732907 GTTTCGTGGGAGGGCTGGGCAGG + Intronic
1160947475 19:1650485-1650507 GTCTCTGGGGAGGACTCTGCAGG - Intronic
1162566002 19:11446164-11446186 GTTCCAGGGTGGGGCCCTGCAGG + Intronic
1163418561 19:17201633-17201655 GCCTCAGGGGAGGGCGCTGTTGG + Intronic
1163635916 19:18437251-18437273 GTCTCAGGGGAGGGGCCTGGGGG - Intronic
1164146225 19:22514229-22514251 CTCACAGGGGAGGGGTCTGCAGG + Intronic
1164900748 19:31919997-31920019 GTTTCATGGGAGGGACCTGGTGG + Intergenic
1165487082 19:36102641-36102663 GTTTCTGGGGAGTGCCCCGCTGG + Intronic
1166248278 19:41546478-41546500 GTTTGAGGGCAGGGCTCTCTGGG - Intergenic
1167237839 19:48325802-48325824 TTTCCAGTGGAGGGCTCTGCTGG - Intronic
1167954959 19:53057198-53057220 TGTTCAGGGGAGAGGTCTGCAGG + Intergenic
1167988788 19:53340394-53340416 CGTTCAGGGGAGAGGTCTGCAGG - Intronic
1168562462 19:57395679-57395701 GTGTCAGGGGAGGGACCTGGTGG - Intronic
925311756 2:2889715-2889737 GTTCCAGTGGCCGGCTCTGCAGG - Intergenic
925711025 2:6740211-6740233 GTGTCAAGGGAGGGATCTGGTGG + Intergenic
925897464 2:8483728-8483750 GTTTCAGGGGAGGGACGTGGTGG - Intergenic
926459525 2:13111473-13111495 GTGTCATGGGAGGGATCTGGTGG + Intergenic
926597131 2:14803338-14803360 ATTTTAGGGGAAGCCTCTGCTGG + Intergenic
926919068 2:17921792-17921814 GTGTCAGGGGAGGGGCCTGGTGG - Intronic
926996215 2:18739104-18739126 GTTTCCTGGGGGGGCACTGCTGG + Intergenic
927170084 2:20362167-20362189 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
927882317 2:26697512-26697534 GCTTCTGGGGAGGGCTTTGCTGG - Intronic
927964547 2:27261175-27261197 GTGTCAGGGGAGGGCTGAGGAGG + Intronic
929741230 2:44602806-44602828 GTGTCAGGGGAGGGACCTGGTGG - Intronic
929923485 2:46190520-46190542 GTTCCAGGGGAGCGCTGGGCAGG + Intergenic
932131724 2:69193772-69193794 GTTTCAGGAGGGAGCTCTGCTGG + Intronic
932721737 2:74143651-74143673 ACATCAGGTGAGGGCTCTGCAGG - Intronic
932841810 2:75090140-75090162 CATTCAGGGGAGGGCACAGCAGG - Intronic
933000955 2:76922477-76922499 GTGTCAGGGGAAGGGTCTGGTGG - Intronic
934762781 2:96865569-96865591 GCTTAAGGGCAGGGCTCTGTGGG + Intronic
935437196 2:103047442-103047464 ATGTCAGGGGAGGGATCTGGTGG - Intergenic
935568198 2:104631753-104631775 GTGTCAAGGGAGGGATCTGGTGG - Intergenic
936090699 2:109499659-109499681 GTTTTAGAGGAAGGCTCTCCTGG + Intronic
936233685 2:110725449-110725471 TTTTCAGGTGAGGACACTGCAGG - Intergenic
936374217 2:111927050-111927072 GCTTTAGGGGAGGGCTATGTGGG - Intronic
936696013 2:114949317-114949339 GGGTCAGGGGAGGGACCTGCTGG - Intronic
937309294 2:120892246-120892268 GTTTCACGAGAGGTTTCTGCAGG + Intronic
938583420 2:132668573-132668595 ATTTCCGGGGTGGGCTCTGTGGG - Intronic
939852778 2:147320241-147320263 GTGTCAGGGGAGGGCCCTGGTGG + Intergenic
940789350 2:158015641-158015663 GTGTCAGGGGAGGGGCCTGGCGG + Intronic
940812654 2:158262780-158262802 GTTTCAAGGGAGGGACCTGGTGG - Intronic
941503260 2:166308330-166308352 GTCTCAGGGGAGGGACCTGGTGG + Intronic
942139437 2:172963193-172963215 GTTTCAGGGGAAGGGCCTGGTGG - Intronic
943237518 2:185341134-185341156 GTTTCAAGAGAGGGATCTGGTGG - Intergenic
945326013 2:208483069-208483091 GTTTCAGGGGGGGTCCCTGCAGG + Intronic
945694974 2:213090829-213090851 GTTTCATGTGAGGGCTGTGAGGG - Intronic
945875597 2:215274901-215274923 GTTTCAGGTGATGACTCCGCTGG - Intergenic
946189812 2:218002276-218002298 GTAGCAGGGGAGGGCTGTGGAGG + Intronic
946429105 2:219615171-219615193 GCTGGAGGAGAGGGCTCTGCCGG - Exonic
947255626 2:228160605-228160627 GTGTCATGGGAGGGATCTGGTGG - Intronic
1169777871 20:9276005-9276027 GTTTCAGGGGAGAGCACAGTAGG + Intronic
1171382923 20:24746645-24746667 GCTCCAGAGCAGGGCTCTGCAGG + Intergenic
1171396702 20:24839062-24839084 GTTTCAGGGGAGGCCAGTGCGGG - Intergenic
1172338405 20:34135768-34135790 GGTTTAAGGGAGGGCTGTGCAGG + Intergenic
1172969093 20:38860557-38860579 ATTGCAGGGGAGGGATCTGCAGG + Intronic
1174152003 20:48492567-48492589 GCTTCAGGCCAGGGTTCTGCCGG - Intergenic
1174664970 20:52249422-52249444 GTGTCAGGGGAGGGGCCTGGTGG + Intergenic
1177211900 21:18082075-18082097 GTGTCAGGGAAGGGCCCTGGTGG + Intronic
1177719420 21:24885385-24885407 GTTTCATGGGAGGGACCTGGTGG - Intergenic
1178518266 21:33266508-33266530 GTGTCAGGTGAGGGGTCCGCGGG + Exonic
1178622611 21:34189653-34189675 GTGTCAGGGGAGGGATCAGGTGG + Intergenic
1179191476 21:39126029-39126051 GGTGCAGGGCAGGGCTCAGCTGG + Intergenic
1179942478 21:44649062-44649084 GTTTCACGGGATGCCTTTGCAGG - Intronic
1180041076 21:45280439-45280461 GTTCCTGGGCAGGGGTCTGCGGG + Intronic
1180583112 22:16860162-16860184 TGTTTAGGGGTGGGCTCTGCAGG + Intergenic
1181179160 22:21055204-21055226 GTTACAGGGCAGGTCTGTGCTGG - Intronic
1181431417 22:22884041-22884063 GACCCAGGGGAGGGCTCTGGTGG - Intronic
1181545357 22:23599333-23599355 GGTCCAGGGCAGGGCCCTGCGGG - Intergenic
1181569959 22:23763198-23763220 GCTTCAGGGCCGGGCTCTGGAGG - Exonic
1181812094 22:25409551-25409573 GTTTTGGGGGAGAGGTCTGCAGG - Intergenic
1181814951 22:25430567-25430589 GGTCCAGGGCAGGGCCCTGCAGG + Intergenic
1182057389 22:27370420-27370442 GTGTCGGGGGAGGGGCCTGCTGG + Intergenic
1182815824 22:33162450-33162472 GTGTCAGGGGAGGGACCTGGTGG - Intronic
1183886477 22:40887481-40887503 ATTTCTGGTGAGGGCTCTCCCGG + Intronic
1184279029 22:43426684-43426706 GCTGCAGGGAAGGGCTCTGCAGG + Intronic
1184751335 22:46488124-46488146 GTTTCAGGGGAGGGCTCTGCAGG + Intronic
1185117131 22:48944359-48944381 GTTCCTCCGGAGGGCTCTGCGGG - Intergenic
949585251 3:5430994-5431016 ATTTCAGGGGAGGGGCCTGGTGG - Intergenic
949881565 3:8664966-8664988 TTTTTAAGGGAGGGGTCTGCAGG - Intronic
951288767 3:20849378-20849400 GTTTCTGTTGAGGGCTCTTCTGG - Intergenic
953554084 3:43928520-43928542 CCTTTAGGGGAGGGCTCTGCCGG + Intergenic
954303903 3:49715568-49715590 GTGGAAGGGCAGGGCTCTGCAGG - Exonic
954439498 3:50513985-50514007 ATCTCTGGGGAGGGCTTTGCAGG + Intergenic
954530466 3:51314399-51314421 CTTTTAGGGTAGGGCTGTGCAGG + Intronic
956683731 3:71805132-71805154 TTTTCAGGGGAGAGCTCTCTGGG - Intergenic
957444164 3:80293104-80293126 GTTTCAGGGGAGGGACCTGGTGG - Intergenic
957504414 3:81101150-81101172 GTATCAGGGGAGGGTACTGGTGG + Intergenic
958684732 3:97378354-97378376 TTTGCAGGGGAGGGCTCTCATGG + Intronic
958935543 3:100251872-100251894 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
959295691 3:104531380-104531402 GCTACAGGGCAGGGCACTGCAGG - Intergenic
960019905 3:112937292-112937314 GTGTCATGGGAGGGACCTGCTGG - Intronic
960581590 3:119283490-119283512 GTGTCAGGGGAGGGACCTGGTGG + Intergenic
961543884 3:127618691-127618713 CTTTCAGGGAGGGGCTTTGCCGG + Intronic
961573554 3:127817251-127817273 GTGTGAGGGCAGGGCTCTGGAGG + Intronic
962832550 3:139157416-139157438 GTTTGTGTGGAGGGCTTTGCTGG - Intronic
963478770 3:145840815-145840837 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
964873349 3:161337576-161337598 GTTTCAGGAGTGTGCTCTGAGGG + Intergenic
965190806 3:165526613-165526635 GTGTCATGGGAGGGATCTGGTGG - Intergenic
967010756 3:185431144-185431166 GAGTCAGGGGAGGGGTCTGGTGG - Intronic
967183760 3:186928742-186928764 GTGTCAGGGGAGGGACCTCCTGG - Intergenic
967247479 3:187502635-187502657 GTGTCAGGGGAGGGGCCTGGTGG - Intergenic
967261689 3:187648954-187648976 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
967348172 3:188481975-188481997 GTGTCAAGGGAGGGATCTGGTGG + Intronic
967458533 3:189718545-189718567 ATGTCAGGGGAGGGATCTGATGG - Intronic
967891039 3:194364863-194364885 GTTTCAGGGGAGCACTTTGGAGG - Intronic
968280647 3:197474239-197474261 ATGTCAGGGGAGGGATCTGGAGG + Intergenic
968483220 4:846086-846108 ATGTCAGGGGAGGGGCCTGCTGG + Intergenic
968787899 4:2637688-2637710 CATGCAGGGGTGGGCTCTGCAGG - Intronic
969087334 4:4666196-4666218 GTTTCTGGCCTGGGCTCTGCAGG + Intergenic
969708672 4:8830450-8830472 GAGTCCAGGGAGGGCTCTGCAGG - Intergenic
970312859 4:14800371-14800393 GTGTCAGGGGAGGGGCCTGGTGG - Intergenic
970537280 4:17042349-17042371 GTGTCAGGGGAGGGATCTGGTGG - Intergenic
971278602 4:25221948-25221970 GTGTCATGGGAGGGATCTGGTGG - Intronic
973848235 4:54934885-54934907 CTGTCAGCTGAGGGCTCTGCAGG - Intergenic
974090618 4:57306621-57306643 GTGTCAGGGGAGGGGCCTGGTGG + Intergenic
974134608 4:57799362-57799384 GTGTCACGGGAGGGATCTGGTGG - Intergenic
974485104 4:62494416-62494438 GCTTCAGGGCAGGGCCCTGATGG + Intergenic
974529721 4:63092062-63092084 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
974561611 4:63529784-63529806 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
975905052 4:79199967-79199989 GTTACAGGGCATGTCTCTGCTGG + Intergenic
976181330 4:82401870-82401892 GTTTCACTGGAGGCCTCTCCTGG + Intergenic
976350438 4:84054347-84054369 GTATCAGAGGTGGGCTCTGTAGG - Intergenic
976822188 4:89218974-89218996 GTTTCAGAGTATGGCTTTGCAGG - Intergenic
976956701 4:90910226-90910248 GTATCAGGGGAGGGCCCTGGTGG - Intronic
977415852 4:96732311-96732333 GTGTCAGGGGAGGGGTCTGGTGG + Intergenic
978344996 4:107757297-107757319 GTGTCAGGGGAGGGGCCTGGTGG + Intergenic
979704321 4:123703476-123703498 GTTTCTGGTGAGGTCTCTCCAGG - Intergenic
980881105 4:138710577-138710599 GTGTCAGGGGAGGGACCTGGTGG + Intergenic
981356752 4:143798408-143798430 GTTTTGGGGGAGGGATCTGGTGG - Intergenic
982486122 4:155967996-155968018 GTGTCAGGGGAGGGTCCTGGTGG + Intergenic
983860209 4:172696513-172696535 GTGTCATGGGAGGGATCTGGTGG + Intronic
984057155 4:174943627-174943649 GTGTCAGGGGAGGGACCTGGTGG - Intronic
984721430 4:182976801-182976823 GTTTCTGGGGAGGGCTCTCTTGG - Intergenic
986075778 5:4336854-4336876 GTTTCTGGTGAGGGCTCTCCTGG + Intergenic
986550724 5:8951913-8951935 GTGTCAGGGGAGGGACCCGCTGG + Intergenic
987172191 5:15270426-15270448 GTGTCATGGGAGGGATCTGGTGG + Intergenic
987363059 5:17123970-17123992 GTGTCAGGGGAGGGGCCTGGTGG - Intronic
987659686 5:20855787-20855809 GTGTCATGGGAGGGATCTGGTGG + Intergenic
988763958 5:34349860-34349882 GTGTCATGGGAGGGATCTGGTGG - Intergenic
988941613 5:36152945-36152967 GTTTCCGTGGGGGGCTCTCCGGG - Exonic
989757219 5:44969961-44969983 ATGTCAGGGGAGGACTCTGCAGG - Intergenic
993036728 5:82767400-82767422 GTGTCATGGGAGGGATCTGGTGG + Intergenic
994093721 5:95830243-95830265 GTTTAAAGGGAGAGCTCTGATGG + Intergenic
994578255 5:101608886-101608908 GTCTCAGGAGAGGGCTCAGGTGG - Intergenic
996431326 5:123381391-123381413 ATTTGAGGGGATGGCTCTACAGG - Intronic
996915509 5:128707536-128707558 GTGTCAGGGAAGGGATCTGGAGG - Intronic
997159763 5:131595151-131595173 GTGTCAGGGGAGGGACCTGGTGG + Intronic
997446849 5:133946645-133946667 GTTGAAGGGGAGGTCTCTGCAGG - Intergenic
997975744 5:138440430-138440452 GGCTCAGGGGAGGGCCCCGCTGG - Intronic
997981238 5:138468455-138468477 GGTGCAGGGCAGGGCTCTGAGGG - Exonic
999269874 5:150290566-150290588 GTTGCAGAGGAGGGCTCTGGAGG - Intergenic
1000783739 5:165516543-165516565 GTGTCAGGGGAGGGGCCTGATGG - Intergenic
1001194761 5:169662768-169662790 GTGTCAGGGGAGGGACCTGGTGG - Intronic
1004326755 6:14682016-14682038 ATTTCAGGAGAGGGCTCTGAGGG - Intergenic
1004751251 6:18565082-18565104 GATTCAAGGGAGGGCTCTCCTGG + Intergenic
1009345687 6:62611073-62611095 GTATTAGGGGAGGGGTCTGGTGG - Intergenic
1009882995 6:69592477-69592499 GTGTCAGAGGAGGGATCTGGTGG + Intergenic
1011230301 6:85153946-85153968 GTGTCAGAGGAGGGGTCTGGTGG + Intergenic
1011370932 6:86635456-86635478 GTGTCAGGGGAGGGGCCTGGTGG + Intergenic
1011955344 6:93018551-93018573 GTGTCAAGGGAGGGATCTGGTGG + Intergenic
1012201020 6:96406127-96406149 GTGTCATGGGAGGGCTGTGGTGG - Intergenic
1012977532 6:105796068-105796090 GAGCCAGGGGAAGGCTCTGCAGG + Intergenic
1014068400 6:117152977-117152999 GTGTCGGGGGAGGGACCTGCTGG - Intergenic
1014247348 6:119082222-119082244 GTGTTAGGGGAGGGACCTGCTGG - Intronic
1015628199 6:135204031-135204053 GATGGAGGAGAGGGCTCTGCAGG - Intronic
1016126172 6:140407233-140407255 GTGTCAGGGGAGGGGCCTCCTGG + Intergenic
1016273894 6:142325266-142325288 ATTACAGTGGAGGGCTATGCTGG - Intronic
1016669168 6:146681350-146681372 GTTTCTGGGGAGGCCTCAGGGGG - Intronic
1016732333 6:147440159-147440181 GTATCATGGGAGGGATCTGGTGG - Intergenic
1016935080 6:149443625-149443647 GTTCAAGGGGAGGGCTCTGAAGG + Intergenic
1016989844 6:149921639-149921661 GTTTCAGGGAAGGTCACTGATGG + Intronic
1017763176 6:157586648-157586670 GGGTCCTGGGAGGGCTCTGCTGG - Intronic
1018154516 6:160973359-160973381 GTCTCAGGAGAAGGCTGTGCGGG + Intergenic
1018534361 6:164804749-164804771 CTTTCAGGGGAGGACTCTTAGGG - Intergenic
1020050077 7:5075616-5075638 GTGTCAGGGGAGGGACCTGGTGG + Intergenic
1020478125 7:8623181-8623203 ATTGCAGTGCAGGGCTCTGCAGG + Intronic
1020567098 7:9811431-9811453 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
1020904457 7:14048098-14048120 GTGTCAGAGGAGGGATCTGGTGG + Intergenic
1022846707 7:34217066-34217088 GTGTCAAGGGAGGGATCTGGTGG - Intergenic
1023848753 7:44139070-44139092 GACTCAGGTGAGGTCTCTGCCGG - Intronic
1023986008 7:45096448-45096470 GTTTCTGGGGAGGCCTCAGGAGG - Intergenic
1024275152 7:47671406-47671428 GAGTGAGGGGAGGGCTCTGGGGG + Intergenic
1028377201 7:90156827-90156849 GCTTCTGGGGAGGGCTCAGAGGG - Intronic
1029459966 7:100688747-100688769 GGTTCAGGACATGGCTCTGCCGG + Exonic
1031294315 7:119983158-119983180 GTTGGAGGGGACTGCTCTGCTGG - Intergenic
1031793486 7:126140073-126140095 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
1033764438 7:144472931-144472953 GTATCAGGGGAGGGGCCTGGTGG - Intronic
1034083875 7:148305778-148305800 GTGTCAGGGGAGGGTCCTGGTGG - Intronic
1034498485 7:151435679-151435701 GGTTCAGGGGTCAGCTCTGCGGG + Intronic
1035120843 7:156565333-156565355 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
1035288047 7:157818890-157818912 GTTTCAGAGGAGGGGTGTGTTGG - Intronic
1035547758 8:496765-496787 GTGTCAGGGGAGGGACCTGGTGG + Intronic
1036705094 8:11040632-11040654 GTGTCTGGTGAGGGCTCTCCTGG + Intronic
1038360640 8:26872534-26872556 GTGTCAGGGGAGAGATCTGGTGG + Intergenic
1038740456 8:30212313-30212335 GTGTCAGGGGAGGGGCCTGGTGG - Intergenic
1039889327 8:41673567-41673589 GCTACAGGGGAGGGCTCTTAGGG + Intronic
1040819642 8:51541589-51541611 ATTTTAGGGGAAGCCTCTGCAGG + Intronic
1041188564 8:55328764-55328786 GATTCAGGGAAGGGAGCTGCAGG - Intronic
1042350462 8:67772093-67772115 GTGTCATGGGAGGGACCTGCTGG + Intergenic
1042979561 8:74509919-74509941 GTATCAGGGGAGGGGACTGGAGG - Intergenic
1043127473 8:76417938-76417960 GTTTCAGGGGAGGGACCCGGTGG + Intergenic
1043779597 8:84314230-84314252 GTGTCAAGGGAGGGATCTGGTGG - Intronic
1046755927 8:117972897-117972919 GTGTCATGGGAGGGATCTGGTGG - Intronic
1047117287 8:121857767-121857789 GATTCAGGGGATATCTCTGCAGG + Intergenic
1047153906 8:122295694-122295716 GTGTCATGGGAGGGCCCTGGTGG - Intergenic
1047870077 8:129072328-129072350 GTGTCATGGGAGGGATCTGGTGG + Intergenic
1048288284 8:133159718-133159740 GTTTCAGGGGAGGGACCAGGTGG + Intergenic
1048405710 8:134118118-134118140 GTGTCAGGGGAGGGACCTGTTGG - Intergenic
1048765834 8:137843435-137843457 GTTTCAGGGAAGTGCCCAGCTGG - Intergenic
1048968297 8:139629693-139629715 GTTTCTGGTGGGGGCTCTCCGGG + Intronic
1049791194 8:144473416-144473438 GTCTCAGGCCAGGTCTCTGCTGG + Exonic
1051218856 9:14827766-14827788 GTTTCAAGGGAGGGACCTGTGGG + Intronic
1051437421 9:17047873-17047895 GTATCGGGGGAGGGATCTGGTGG + Intergenic
1052474106 9:28936900-28936922 GTTTCTGGTGAGGCCTCTACTGG + Intergenic
1052978312 9:34428536-34428558 GACTCAGGGGAGGGCACAGCTGG - Intronic
1053264411 9:36700198-36700220 GTGTCAAGGGAGGGATCTGGTGG - Intergenic
1056783366 9:89568517-89568539 GTGTCATGAGAGGGATCTGCTGG + Intergenic
1057838909 9:98469391-98469413 GTGTCAGGGGAGGGACCTGGTGG - Intronic
1057903539 9:98967367-98967389 CTGTCAGGAGAGGGTTCTGCAGG - Intronic
1058324769 9:103681528-103681550 GTGTCAGGGGAGGGGTCTGCTGG + Intergenic
1059675023 9:116529655-116529677 GTGTCAGGGGAGGGGCCTGGTGG + Intronic
1060496825 9:124125493-124125515 GTCTGTGGGCAGGGCTCTGCAGG - Intergenic
1060731039 9:126037205-126037227 TTATCAGGGGATGGCTCGGCGGG + Intergenic
1061061204 9:128251150-128251172 GTTTCTGGGGAGGGGGCTGTGGG + Intronic
1061907458 9:133705939-133705961 GTTCCTGGAGAGGGCTCTCCTGG - Intronic
1062528813 9:136990691-136990713 GTCTCATGGGAAGGCTCAGCTGG + Intergenic
1062531337 9:137001994-137002016 GGTTCTGGCGAGGGCTCTTCTGG - Intergenic
1203738645 Un_GL000216v2:160816-160838 GTTTCAGGGATTGGCTCTCCGGG - Intergenic
1185643144 X:1599477-1599499 ATTTCAGGGGAGGGCACTGAGGG - Intronic
1188530803 X:31138793-31138815 GTGTCAGGGGAGGGACCTGATGG - Intronic
1188674064 X:32917041-32917063 GTGTCAGGGGAGGGACCTGGTGG + Intronic
1188813294 X:34680029-34680051 GTGTCAAGGGAGGGATCTGGTGG - Intergenic
1189101245 X:38192412-38192434 GTTTCAGGGCAGGGGACAGCGGG - Intronic
1189354124 X:40298637-40298659 GTGTCAGGGCTGCGCTCTGCAGG - Intergenic
1189567502 X:42258407-42258429 GTGTCATGGGAGGGATCTGTGGG + Intergenic
1190047850 X:47127045-47127067 GTGTCAGGGGAGGGACCTGATGG - Intergenic
1192327867 X:70148784-70148806 GTTTCACTGGAGGCCTCTCCTGG - Exonic
1192904814 X:75540171-75540193 GTGTCAGGGGAGGGACCTGGTGG - Intergenic
1193827416 X:86242722-86242744 GTGTCAGGGGAGGGACCTGGTGG + Intronic
1193939081 X:87658043-87658065 GCTTCAGGAGGGAGCTCTGCAGG - Intronic
1194812003 X:98398578-98398600 ATGTCAGGGGAGGGGTCTGGTGG + Intergenic
1195178173 X:102331043-102331065 GTTTCAGGGAAGGGGCCTGGTGG + Intergenic
1195180691 X:102356050-102356072 GTTTCAGGGAAGGGGCCTGGTGG - Intergenic
1197865085 X:131009024-131009046 GTGTCAGGGGAGGGGTCTGGGGG + Intergenic
1198672384 X:139094958-139094980 GTTTCAAGACAGAGCTCTGCTGG - Intronic
1201275407 Y:12292699-12292721 ATTCCAGGGGAGGGCACTGTAGG - Intergenic
1201977225 Y:19865070-19865092 GTTTTAGGGGAGGTCTCTCTGGG - Intergenic