ID: 1184751336

View in Genome Browser
Species Human (GRCh38)
Location 22:46488138-46488160
Sequence CTCTGCAGGCTGACAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 308}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184751331_1184751336 2 Left 1184751331 22:46488113-46488135 CCTGCACCTCAGTTTCAGGGGAG 0: 1
1: 0
2: 3
3: 16
4: 160
Right 1184751336 22:46488138-46488160 CTCTGCAGGCTGACAGCAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 308
1184751326_1184751336 7 Left 1184751326 22:46488108-46488130 CCTGCCCTGCACCTCAGTTTCAG No data
Right 1184751336 22:46488138-46488160 CTCTGCAGGCTGACAGCAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 308
1184751330_1184751336 3 Left 1184751330 22:46488112-46488134 CCCTGCACCTCAGTTTCAGGGGA 0: 1
1: 0
2: 1
3: 12
4: 170
Right 1184751336 22:46488138-46488160 CTCTGCAGGCTGACAGCAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 308
1184751325_1184751336 30 Left 1184751325 22:46488085-46488107 CCAGTGGAGGCACGGGGAGGGGT 0: 1
1: 0
2: 1
3: 29
4: 259
Right 1184751336 22:46488138-46488160 CTCTGCAGGCTGACAGCAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 308
1184751334_1184751336 -4 Left 1184751334 22:46488119-46488141 CCTCAGTTTCAGGGGAGGGCTCT 0: 1
1: 0
2: 1
3: 32
4: 264
Right 1184751336 22:46488138-46488160 CTCTGCAGGCTGACAGCAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184751336 Original CRISPR CTCTGCAGGCTGACAGCAGC TGG Intronic
900568749 1:3348084-3348106 CTCTGCCTGCTGCCAGCAGATGG - Intronic
900929311 1:5726306-5726328 CCCTGCAGTCTGTCAGCATCTGG + Intergenic
902521904 1:17023195-17023217 CTCAGCAGCCTGAGATCAGCAGG + Intronic
902645868 1:17797550-17797572 CTCTGCAGGCGGACAGGGCCAGG + Intronic
902731584 1:18373437-18373459 GTGAGGAGGCTGACAGCAGCAGG + Intronic
905012174 1:34755152-34755174 CTCTCCTGGCTCCCAGCAGCCGG - Exonic
905264191 1:36739805-36739827 CTCTGCAGGCTGAGAGGAAGGGG + Intergenic
906731844 1:48089597-48089619 GGCTGCAGGCTGCCAGCCGCGGG - Intergenic
906927105 1:50129369-50129391 CTCTGCATACTGACAGCAGAGGG - Intronic
907328093 1:53653857-53653879 CCCTACAGGCTGCCAGCAGTGGG + Intronic
907407525 1:54262795-54262817 CTCTGCAGGGTGATGGCAGCAGG + Intronic
907419727 1:54338834-54338856 CCCTGTTGGCTCACAGCAGCTGG - Intronic
907504759 1:54909981-54910003 TCCTGCAGGCAGACAGCAGTTGG + Intergenic
910087965 1:83426740-83426762 CTCTGCACCCTGGCAGAAGCTGG + Intergenic
910388976 1:86717534-86717556 CTCTGCCTGCTGAGAGTAGCTGG + Intronic
912670428 1:111619822-111619844 CTCTGCGCGGCGACAGCAGCGGG - Exonic
913116367 1:115701412-115701434 CACTGCAGGCTGACAGTGTCTGG - Exonic
914717744 1:150266180-150266202 CTCTGCAGGCCGACGGCAGGAGG - Exonic
915162977 1:153932776-153932798 CACTGCAGGGGGATAGCAGCAGG + Exonic
915215900 1:154340666-154340688 CTCTGCTGGCTGTGTGCAGCCGG + Intronic
915342654 1:155184856-155184878 CACTGCAGGGGGACGGCAGCGGG - Exonic
915729673 1:158044246-158044268 CTCTGGAGGCAGACAGAAGGGGG - Intronic
915980409 1:160416592-160416614 TTCTACAGGCTGACACCAGAGGG - Intronic
916718102 1:167461959-167461981 TTCTTCAGGCACACAGCAGCAGG + Intronic
918080446 1:181203884-181203906 CTCTGCAGTCTGGGAGCAGGAGG + Intergenic
918421978 1:184373314-184373336 CTCTGCAGACGCACAGCAACGGG + Intergenic
919666964 1:200301651-200301673 CTCTACTGGCTGGCAGCAGAGGG - Intergenic
920619958 1:207535434-207535456 CTGTGAAGGCTGACAGAAGCTGG + Intronic
920621739 1:207553989-207554011 CTGTGAAGGCTGACAGAAGCTGG + Intronic
920623365 1:207571084-207571106 CTGTGAAGGCTGACAGAAGCTGG + Intronic
922505073 1:226121610-226121632 CTCCGCGGGGTGACAGCAGCCGG + Intergenic
922699432 1:227750242-227750264 GTCTGCAGGGGGCCAGCAGCTGG + Intronic
922911507 1:229221556-229221578 CCATGCAGGGTCACAGCAGCAGG + Intergenic
923402604 1:233629485-233629507 CCCTGCTGGCACACAGCAGCAGG + Intronic
924013904 1:239698701-239698723 TTCTGCAGTAAGACAGCAGCTGG - Intronic
924579363 1:245310665-245310687 CTCTGAAGGCAGGAAGCAGCAGG + Intronic
1062825078 10:561349-561371 CTCTGCAGACTGAGAGCCACTGG + Intronic
1063001528 10:1928641-1928663 CATTGCAGGCTGACAGCTGTGGG + Intergenic
1063092503 10:2879706-2879728 CCCTCCAGGCTCACAGCAGCGGG - Intergenic
1063954888 10:11256543-11256565 CTCTTCAGTCTGGCTGCAGCTGG + Intronic
1064732508 10:18346991-18347013 CCCTTCTGACTGACAGCAGCAGG - Intronic
1064735841 10:18381028-18381050 CTCTGAAGAATGACAGCAGCAGG + Intronic
1065553104 10:26888683-26888705 CCCTGGAGGGTGACAGCACCTGG + Intergenic
1066442549 10:35451852-35451874 CTCGCCTGGGTGACAGCAGCAGG - Intronic
1067110285 10:43395857-43395879 GTCTACAGGCTTACAGCGGCTGG - Intronic
1067205686 10:44210062-44210084 CTCTGCATGCAGGCAGCACCAGG + Intergenic
1067625030 10:47918663-47918685 CTCTGCACGCAGGCAGCATCGGG + Intergenic
1068138226 10:52972307-52972329 CTCTGCAAGCTGACTGAAACTGG - Intergenic
1068781428 10:60922700-60922722 CACTCCATGCTGATAGCAGCAGG - Intronic
1072733925 10:97866360-97866382 CTTTGCAGGCTGCCAGGTGCTGG + Exonic
1072847293 10:98845816-98845838 ATTTGCAGGCTGAAGGCAGCTGG + Intronic
1073395249 10:103212010-103212032 CCCTGCAGGCAGACGGCAGTTGG - Intergenic
1073426745 10:103459627-103459649 GTCTGCATGCTGACAGCAAGGGG + Intergenic
1075134883 10:119775365-119775387 CTCAGGAGGCTGACAGTAGAAGG - Intronic
1076336625 10:129710803-129710825 CTTTGCAGACTGAGAGGAGCGGG + Intronic
1076569867 10:131425638-131425660 CTCTGCAGTGGGACAGTAGCAGG + Intergenic
1076758942 10:132590401-132590423 CCCTGCCGGCAGACAGCTGCTGG - Intronic
1076770177 10:132658669-132658691 GTCTGCAAGCTGCCCGCAGCTGG + Intronic
1077493093 11:2871132-2871154 CTGTGCTGGCTGCCTGCAGCAGG + Intergenic
1078540917 11:12212193-12212215 CTATGGAGGATCACAGCAGCTGG - Intronic
1078672310 11:13376343-13376365 CACTGCAGGCTGGCAGGAGGAGG + Intronic
1080136211 11:28857702-28857724 CTCTGCAGGCTCACTCCTGCAGG + Intergenic
1080231687 11:30023222-30023244 TTCTACAGGCTGCCAGCATCCGG + Intergenic
1080524479 11:33100660-33100682 CTCTGAAAACTTACAGCAGCAGG + Intronic
1082039444 11:47672895-47672917 CTCAGAAGCCTGAAAGCAGCTGG + Intronic
1083182800 11:60998675-60998697 CTCTGCAGGCTCATTGGAGCAGG + Intronic
1083622802 11:64057271-64057293 CCCTGCAGACTGAGAGCAGGTGG + Intronic
1089281849 11:117380279-117380301 CAGTGCAGGCTTCCAGCAGCAGG + Intronic
1089305698 11:117524926-117524948 CCCTCCCGGCTGACAGCCGCTGG - Exonic
1090202508 11:124866420-124866442 CTCCGCAGGCTGGCGGCGGCCGG - Intronic
1090402883 11:126460279-126460301 CTCTGCGTCCTGACAGCAGCTGG + Intronic
1090523383 11:127503186-127503208 CACTGCAGGCAGAGACCAGCAGG + Intergenic
1090668399 11:128930257-128930279 CGCTGCAGCCTGCGAGCAGCCGG + Intergenic
1091011715 11:132007364-132007386 CTGTGCAGCCTGGCATCAGCTGG - Intronic
1091413127 12:257384-257406 CGCTGATGGATGACAGCAGCTGG - Intronic
1092937056 12:13373978-13374000 CTCTGCTACCTGACTGCAGCAGG + Intronic
1094394618 12:29992411-29992433 CTCTACAGCCTGGAAGCAGCCGG - Intergenic
1095139746 12:38646998-38647020 GTCAAAAGGCTGACAGCAGCAGG - Intronic
1095430116 12:42124992-42125014 CTCTGCAGGCTGATACCATATGG - Intronic
1096553967 12:52391832-52391854 CTGGGCAGGATGCCAGCAGCAGG - Intergenic
1100469284 12:94875124-94875146 GTATGCAGGCAGACAGCAGTGGG + Intergenic
1101322497 12:103685248-103685270 TTCTACAGGCTGAAGGCAGCTGG + Intronic
1102007515 12:109597899-109597921 CCCTGCAGGAAGACAACAGCAGG - Exonic
1105239137 13:18594956-18594978 CTCAGCAGGCTCTCAGCAGATGG + Intergenic
1107421594 13:40252618-40252640 CTTTGCAGGCAGACAACAGGTGG - Intergenic
1107484552 13:40813508-40813530 CTCTCCAGCCTGAGGGCAGCAGG - Intergenic
1109192072 13:59337360-59337382 CTTTGCACGCAGACAACAGCAGG + Intergenic
1112315606 13:98359728-98359750 GTTTGCAGCCTGACAGCAGTAGG + Intronic
1114219073 14:20681292-20681314 CTCTGGAGGCAGACAGTTGCTGG + Intergenic
1114643895 14:24242763-24242785 CTCTGCCGGCTGACATGAGTTGG + Intergenic
1114731112 14:24993738-24993760 CTGTACAGGCTGACAGGAGCTGG - Intronic
1116565871 14:46443532-46443554 CTCAGCAGGCTAACAGGAACAGG + Intergenic
1116867040 14:50039689-50039711 GTCCGCAGGCTGCCATCAGCGGG - Intergenic
1117017584 14:51534127-51534149 CCCTACAGGCAGACAGGAGCAGG - Intronic
1118259639 14:64235104-64235126 CCCAGGATGCTGACAGCAGCCGG - Exonic
1118368819 14:65118548-65118570 CTTTGGACGCTGACAGCTGCTGG + Intergenic
1118647303 14:67852052-67852074 CTCCCCAGCCTGAGAGCAGCAGG + Intronic
1119186539 14:72646800-72646822 CTCTGAAGTTTGAGAGCAGCCGG - Intronic
1119382632 14:74239061-74239083 CTATGCAGGTTGGCAGCATCAGG - Intergenic
1119389782 14:74283344-74283366 GTCTGAAGGCAGAAAGCAGCAGG - Intergenic
1120696735 14:87653475-87653497 CTCAGCAGACTGACACAAGCTGG - Intergenic
1121656226 14:95597812-95597834 CTTTGAACGCTGACAGCACCAGG - Intergenic
1122364032 14:101183695-101183717 CCCAGGAGGCTGTCAGCAGCTGG + Intergenic
1122778115 14:104131716-104131738 CTCTGCAGGGGGAATGCAGCAGG + Intergenic
1122947128 14:105017136-105017158 CTCTGGAGGCTCACACCTGCTGG - Intronic
1125519616 15:40340536-40340558 CTCTCCAGGCCGAAAGCTGCTGG + Intronic
1126108646 15:45162982-45163004 CTCTGAATGCTGACAGCACATGG - Intronic
1127557450 15:60101407-60101429 GTCTGCAGGAGGTCAGCAGCTGG - Intergenic
1128452045 15:67811402-67811424 GTCTGCAGGCTGGCAGCCCCTGG + Intergenic
1129846187 15:78768707-78768729 GTTTGCATGCTAACAGCAGCTGG - Intronic
1132152902 15:99475095-99475117 CACTCCAGGCTGACAGCAGCTGG + Intergenic
1132625357 16:888997-889019 CTCTGCCGGCTGAGAGCAAGCGG + Intronic
1133100949 16:3479348-3479370 CTCGGCAGCCTTAGAGCAGCAGG + Intronic
1133766344 16:8840739-8840761 TCCTGCAGGCGGACAGCAGTCGG + Intronic
1138099642 16:54242324-54242346 CTTTGCAGTCTGACAGCAGGTGG + Intergenic
1138129338 16:54466315-54466337 CTCTGCAGGATCACAGCACCTGG - Intergenic
1138758614 16:59517765-59517787 CCCTGAAGGCAGACAGCAGTTGG + Intergenic
1140604556 16:76518961-76518983 CTCAGCAGGCAGGCAGCAGCAGG - Intronic
1140882978 16:79215608-79215630 ATCTGCAGGCTGACAACATGAGG + Intergenic
1141715995 16:85727175-85727197 CTCTGCTGGCGGACAGCTGCAGG - Intronic
1141767663 16:86069670-86069692 CTCTGCAGCCTGGGACCAGCAGG - Intergenic
1141929168 16:87189708-87189730 TTCTGCAGAATGACACCAGCTGG + Intronic
1144676841 17:17167485-17167507 CACTGCAGGCTGAGCGCAGCCGG + Intronic
1146891746 17:36510819-36510841 CAGGGCAGGCAGACAGCAGCAGG - Exonic
1147317554 17:39627999-39628021 CTCTGGGGCCTGACAGCAGGAGG - Intronic
1147530916 17:41276179-41276201 GCAAGCAGGCTGACAGCAGCTGG - Exonic
1147556963 17:41485754-41485776 GGCAGCAGGGTGACAGCAGCTGG + Intergenic
1147572503 17:41580017-41580039 CTCTGGAGCCTGACAGCACAGGG + Intergenic
1147700023 17:42388102-42388124 CTCTTCGGGATGACAGGAGCGGG - Intronic
1148203552 17:45765692-45765714 CTCTGCAGGTGGGCAGAAGCAGG - Intergenic
1150046504 17:61918769-61918791 CTCTGTAAACTGACAGCAGTAGG + Intronic
1150456379 17:65309878-65309900 ATTTGTAGGCTGACAGCAGGAGG - Intergenic
1150653067 17:67022478-67022500 CTCTGCCTTCTGGCAGCAGCGGG - Intronic
1151261395 17:72918704-72918726 CTCCGCAGGCTGACTGTTGCTGG - Intronic
1151391782 17:73792007-73792029 CTCTGAAAGCTGAGAGCACCTGG + Intergenic
1152353811 17:79797411-79797433 CCCCGCAGACTGACAGCGGCCGG - Intronic
1152765947 17:82138836-82138858 TGCTGCCGGCTGACAGCATCTGG - Intronic
1152906437 17:82973054-82973076 CTGTCCAGGCTGGCAGCCGCGGG - Intronic
1154338486 18:13484196-13484218 GTCTGTAGGCTGAGAGGAGCAGG + Intronic
1154378778 18:13831297-13831319 CTCTGCTGGATGAAAACAGCTGG + Intergenic
1155685188 18:28539939-28539961 CTCTGCAGGATGCCAGCCCCAGG + Intergenic
1156923644 18:42553174-42553196 TCCTGCAGGCAGACAGCAGTTGG + Intergenic
1159532008 18:69666814-69666836 GCCTGCAGGCTGCCATCAGCAGG + Intronic
1160367996 18:78345486-78345508 GTCTGTAGGCTGGCAGCAACAGG - Intergenic
1160396452 18:78575778-78575800 CTCTGCAGGCTGTCACCACAAGG + Intergenic
1160585537 18:79911556-79911578 CTCTGCAGCATGGCAGCTGCAGG + Intronic
1161457661 19:4377644-4377666 CACTGCAAGGTGACAGCTGCTGG - Intronic
1161618411 19:5285450-5285472 CTCGTCAGGATGACAGCACCCGG - Intronic
1161727443 19:5938036-5938058 CTCTGCAGGATGAGACCAGGTGG + Intronic
1162445327 19:10719018-10719040 CTCTGTTGGGTGACACCAGCTGG + Intronic
1163054195 19:14706105-14706127 CTGGGCAGGATGGCAGCAGCAGG - Intronic
1164435287 19:28223315-28223337 CTCTGCAGGCAAGCAGCATCAGG + Intergenic
1164752075 19:30664458-30664480 CTCTGCAGGCTCAGAGCAACAGG + Intronic
1165225806 19:34353721-34353743 CTCTGCACATGGACAGCAGCTGG - Exonic
1166090554 19:40506007-40506029 CTGTGAGAGCTGACAGCAGCTGG + Intronic
1166251417 19:41573420-41573442 CTCAGCAGGGTGAAAGTAGCTGG - Intronic
1166397137 19:42449739-42449761 TCCTGCAGGCGGACAGCAGTTGG + Intergenic
1166417241 19:42604822-42604844 CTCAGCAGGGTGAAAGCAGCTGG + Intronic
1166905271 19:46103948-46103970 TCCTGCAGGCGGACAGCAGTTGG + Intergenic
1167138372 19:47632281-47632303 CACTGCTGGCAAACAGCAGCCGG + Intronic
1168288716 19:55346969-55346991 CGCTGCAGGCTGGCAGGCGCAGG - Exonic
1168682369 19:58325391-58325413 CCCTGCAGACTGCTAGCAGCTGG - Intergenic
924993928 2:340270-340292 CACTGCAGGCAGACATAAGCTGG + Intergenic
925069747 2:956654-956676 CTCCACGGGCTCACAGCAGCAGG - Intronic
926966807 2:18423807-18423829 ATGTGCAGGCTGAGAGCAGGAGG + Intergenic
927520965 2:23697787-23697809 CACTGAAGGCTGCCAGCACCGGG - Intronic
927641377 2:24847803-24847825 CTCTCAAGGCAGACAGCTGCTGG + Intronic
928212659 2:29335038-29335060 CTCTGCAGGCTGTGGCCAGCCGG - Intronic
932188554 2:69719368-69719390 CTCAGGAGGCTGAAAGCAGGAGG - Intronic
932819432 2:74886950-74886972 CTCTTCAGCCTGTCAGCAGCAGG - Intronic
933816441 2:86072666-86072688 CTCAGCAGCCTGCCAGAAGCAGG - Intronic
934569767 2:95361825-95361847 CTCTACAGGGTGACCGCAGCAGG - Intronic
934835845 2:97589443-97589465 CTTTGCAGGCTGAGGGCTGCGGG - Intronic
936676763 2:114724707-114724729 CTCTGAAAGCTGACTGAAGCTGG + Intronic
937288603 2:120768441-120768463 GCCTGCAGGCTGAGAGCAGGTGG + Intronic
937620194 2:123976506-123976528 CTCTTCAGGCTGAGAGAAGGTGG - Intergenic
937665863 2:124485822-124485844 CGCTGCAGGGTGACAGAGGCTGG - Intronic
938243786 2:129762222-129762244 CTCAGCAAGCTGCCAGCAGTGGG - Intergenic
941455674 2:165710378-165710400 TTCTGCAGGCAGACGGCAGTCGG + Intergenic
942706082 2:178774175-178774197 CACTGCAGGCTGACAGGAATGGG + Intronic
943436240 2:187868439-187868461 CTCTCCAGGTTTCCAGCAGCAGG + Intergenic
943595949 2:189856773-189856795 CTTTGCAGCCTCACAACAGCAGG + Intronic
944487847 2:200225300-200225322 CTCTGCAGAGTGAGAGAAGCTGG + Intergenic
944658708 2:201902180-201902202 TTCTTCCTGCTGACAGCAGCGGG + Intergenic
944679817 2:202066880-202066902 CTATGGAGGGTGACAGGAGCAGG - Intergenic
945829855 2:214770747-214770769 CGCTGGAGGCTGGCAGCAGAGGG - Intronic
946226007 2:218264461-218264483 CTCTGCTGGCAGACAGGGGCAGG + Exonic
946787312 2:223261425-223261447 CTTTGCAGGCAGTCAGCAGGAGG - Intergenic
947240593 2:227990049-227990071 CCCTGCTGGCTGTCAGCAGAGGG - Intronic
947632157 2:231661081-231661103 CTCAGCAGGCTCAGAGGAGCCGG - Intergenic
948667247 2:239544388-239544410 CTCAGCAGCCAGGCAGCAGCAGG - Intergenic
1169067345 20:2701481-2701503 CTCAGCAGCCTGGCAGGAGCTGG + Intronic
1169870299 20:10241813-10241835 CTCTGCAGGCTGGCAGGCCCTGG - Intronic
1170877576 20:20265199-20265221 CACTGCAGGCTGACAGGATTGGG - Intronic
1171101086 20:22384539-22384561 GTCTGCTGTCTGGCAGCAGCTGG + Intergenic
1171113105 20:22502072-22502094 CTCTGCAGGCTCAGCCCAGCTGG + Intergenic
1173135135 20:40432717-40432739 TACTGCATGCTTACAGCAGCCGG - Intergenic
1174059874 20:47825342-47825364 GTCTGCAGGCTCCCAGGAGCTGG - Intergenic
1174125995 20:48306807-48306829 CTCTACAGGCTGAAGGCAGGAGG + Intergenic
1175626384 20:60491455-60491477 CCCTGCAGGCTGGGAACAGCAGG - Intergenic
1175822570 20:61918308-61918330 TTCTGCAGGGTGACAGCTGCAGG + Intronic
1175869437 20:62201277-62201299 CGGTGCAGGCTGACAGGTGCAGG - Exonic
1176057497 20:63156355-63156377 CCCTGCTGGCTGCCAGCTGCTGG + Intergenic
1178246704 21:30960125-30960147 CTGTCCAGGCTGAAGGCAGCAGG + Intergenic
1179022889 21:37656152-37656174 CTCCACAGGCTGGCATCAGCTGG + Intronic
1179126788 21:38598196-38598218 CTCTGCAGCCTGACAGGGACTGG - Intronic
1179333352 21:40427010-40427032 CTCAGACGGCTGACAGCATCAGG - Intronic
1180670337 22:17548238-17548260 CCCTGCAGACTGACTGCACCAGG + Exonic
1180720953 22:17908030-17908052 TTCTGCAGACTCACAGGAGCCGG - Intronic
1180836043 22:18929883-18929905 CCCTGCACCCTGACAGCAGCCGG - Intronic
1181495838 22:23287058-23287080 CTCTGCAGGCTGAATGCAGCTGG + Intronic
1181712302 22:24698063-24698085 CCCTGCACCCTGACAGCAGCTGG - Intergenic
1182428449 22:30286947-30286969 CCCTGCTGGAGGACAGCAGCAGG + Exonic
1182865709 22:33602610-33602632 CTCTGGAGGCTGAGGGCAGGGGG - Intronic
1183100846 22:35583195-35583217 CCCTGCAGGCTGACCTCAGGAGG - Intergenic
1183317852 22:37146662-37146684 CCCTCTAGGCTGGCAGCAGCAGG + Intronic
1183382733 22:37498533-37498555 CTCCCCAGGCTGGCAGCAGGGGG - Intronic
1183899843 22:40996763-40996785 CTCTGCAGGCTGAGGCCAGGAGG + Intergenic
1184347238 22:43921451-43921473 CACTGCATGTAGACAGCAGCTGG - Intergenic
1184413545 22:44339288-44339310 CTCTGACTGGTGACAGCAGCTGG + Intergenic
1184751336 22:46488138-46488160 CTCTGCAGGCTGACAGCAGCTGG + Intronic
1203286135 22_KI270734v1_random:155182-155204 CCCTGCACCCTGACAGCAGCCGG - Intergenic
950442436 3:13018011-13018033 CTCTGCAGGCTGTCCAGAGCTGG + Intronic
950720549 3:14879513-14879535 CTCTGCAGGCTGACCTCAGATGG - Intronic
951762300 3:26160420-26160442 TCCTGCAGGCAGACAGCAGTTGG + Intergenic
954303897 3:49715554-49715576 CTCTGCAGGGGGACAGGAGGCGG - Exonic
954328591 3:49877227-49877249 CTCAGCCGGCAGCCAGCAGCTGG - Intergenic
954542260 3:51401387-51401409 CTCTCCTTGCTGACAGCAGCTGG + Intronic
954624821 3:52016678-52016700 CCCTGGAGGCTGAGGGCAGCAGG + Intergenic
954956926 3:54529482-54529504 CTGAGCATGCTGACATCAGCGGG + Intronic
955378323 3:58416581-58416603 CTCTGCAGAGTGAGAGCAGGAGG + Intronic
955500771 3:59580373-59580395 TTCCTCAGGCTGTCAGCAGCAGG + Intergenic
957955132 3:87176767-87176789 CACTACAGGCTGGCAGCAGTGGG + Intergenic
959576525 3:107940219-107940241 CTCTGCTGCCTGACTGCAGTTGG - Intergenic
960869321 3:122233143-122233165 CTTTGCATGCTGTCAGAAGCAGG - Intronic
961534513 3:127561651-127561673 CTCCCCAGGCTGGCTGCAGCAGG + Intergenic
961619885 3:128215790-128215812 CTCTGCAATCTCACAGGAGCCGG - Intronic
966274616 3:178150425-178150447 ATCTGTAGGCTGACATCAGCTGG + Intergenic
966934718 3:184698450-184698472 CTCGGCAGTCTGAAACCAGCTGG + Intergenic
968511769 4:998825-998847 CTGTGCAGGCTGTGAGCAGAGGG - Intronic
968981347 4:3851419-3851441 CTCTGCAGCCTCCCAGCAGCTGG - Intergenic
969577997 4:8047515-8047537 TTCTGCAGGCTGGCAGGGGCTGG + Intronic
969601130 4:8177025-8177047 CTCTCCAGGCTGACACTAACTGG + Intergenic
969719327 4:8884721-8884743 CCCTTCAGGCTGAAACCAGCTGG + Intergenic
973556726 4:52091527-52091549 TCCAGCAGGCTGACAGCAGAGGG - Intronic
976219585 4:82745343-82745365 CCCTGCAGGCAGACCTCAGCGGG + Intronic
976482088 4:85557039-85557061 CTCTGGAGCCTGAGAGCAACAGG + Intronic
977524361 4:98126097-98126119 CTCTGCTGCCTAGCAGCAGCAGG - Intronic
977634767 4:99284576-99284598 CCCTGCAGGATGGCACCAGCAGG - Exonic
980714929 4:136616096-136616118 TCCTGCAGGCAGACAGCAGTTGG - Intergenic
981317537 4:143355207-143355229 CTCTGCATGCTGAAACCAGCTGG - Intronic
984260804 4:177442159-177442181 CCCTGCCGGGTGACTGCAGCGGG + Intronic
985535540 5:463466-463488 CTCAGCAGGATGGCAGGAGCCGG + Intronic
986790048 5:11150561-11150583 CTCTGCATGCTGACATCAGGTGG + Intronic
988963799 5:36395003-36395025 CTCTGCTAGCTGATAACAGCAGG + Intergenic
989530968 5:42507920-42507942 CTCAGGAGGCTGACTGCTGCGGG - Intronic
992019803 5:72611296-72611318 CTTTGCAGCCTGCCAGCAGGGGG + Intergenic
993758378 5:91761535-91761557 TTCTGCAGTCTGAGAGGAGCAGG + Intergenic
993899431 5:93574292-93574314 CTCTGCAGGCTTTCAGCCGCTGG - Intergenic
997090543 5:130851312-130851334 GTCAGCAAACTGACAGCAGCAGG - Intergenic
997742662 5:136270798-136270820 CTCAGCAGGGTGACAGGTGCTGG + Intronic
998393753 5:141804966-141804988 CTCTGCAGGCAGACAGGACTGGG + Intergenic
998559243 5:143155617-143155639 CTCTACAGCCTGTCAGCAGAGGG + Intronic
1000393424 5:160748537-160748559 CTCTGCAGGCCGAGAGCAGGAGG - Intronic
1000999857 5:167995335-167995357 ATCTGCAGGCTGCTAGAAGCTGG + Intronic
1001702823 5:173719936-173719958 TTCTGCAGGCTGAGGGGAGCAGG + Intergenic
1002423034 5:179159656-179159678 CTCTGCACCATGACATCAGCAGG + Intronic
1002441648 5:179267399-179267421 TGCTGCAGCCTGACAGCAGCAGG + Intronic
1002658806 5:180775884-180775906 CACTGCAGGCACACAGCAGGAGG + Intergenic
1002781988 6:374054-374076 CTCCCCAGGCTGGCAGAAGCTGG + Intergenic
1003991737 6:11493280-11493302 CTCTGTGCACTGACAGCAGCAGG - Intergenic
1005730842 6:28695405-28695427 CCCTGCATGCTGATAGCATCTGG + Intergenic
1006976892 6:38110894-38110916 GTGTGCAGGCTGCCAGCTGCAGG + Intronic
1007925787 6:45648486-45648508 CTCAACAGGCAGACAGCAGATGG + Intronic
1011242472 6:85287454-85287476 CACTGCAGGAAGTCAGCAGCAGG + Intergenic
1012379729 6:98605700-98605722 CTCTACAGTATTACAGCAGCTGG + Intergenic
1015883859 6:137896346-137896368 CTGTGTAGTCTGACAGCAGCTGG - Intergenic
1016204944 6:141457923-141457945 TCCTGCAGGCAGACAGCAGTTGG - Intergenic
1016285530 6:142468604-142468626 ATCTGCAGGAAGACAGCAGCAGG + Intergenic
1017551766 6:155517183-155517205 CTAAGCTGGCTGACACCAGCTGG + Intergenic
1018647880 6:165964917-165964939 CTCAGCAGGCAGACAGGAGAAGG + Intronic
1018718551 6:166554658-166554680 CACTGCAGCCTGAAAGCAGGGGG + Intronic
1018945231 6:168343301-168343323 CTTTGCAGGCACACAGCACCAGG - Intergenic
1019062241 6:169264897-169264919 CTCTGCATGCTGGAAGCAGTCGG + Intergenic
1019225700 6:170505847-170505869 CTCTCTAGACTGACAGCAGCAGG + Intergenic
1019308991 7:349837-349859 CTCTGCAGGCTGTGGTCAGCAGG + Intergenic
1019896877 7:3989719-3989741 GTGTACAGGCTGACATCAGCTGG - Intronic
1020529042 7:9306537-9306559 CTTTCCAGGCTCACAGCACCCGG + Intergenic
1022044745 7:26613852-26613874 CTGTGCAGGCAGGCAGCAGGGGG + Intergenic
1022319185 7:29272252-29272274 TTCTGTAGGCTGACTGCAGGAGG - Intronic
1022391568 7:29948751-29948773 CTCTCCAAGCTGGTAGCAGCTGG - Intronic
1023081904 7:36534031-36534053 CTCTGCAGCCTGACAGGAGGTGG + Intronic
1023715469 7:43039490-43039512 CCCAGCAGGGTGCCAGCAGCTGG + Intergenic
1023720698 7:43090875-43090897 CTTTCCAGGCATACAGCAGCAGG + Intergenic
1024090893 7:45939082-45939104 ACCTGCAGCCTGAGAGCAGCAGG + Intergenic
1024969975 7:55060008-55060030 CTCTGCTGGCAGCCACCAGCGGG + Intronic
1026019043 7:66694131-66694153 CTCTGCAGGCTTGGAGCAGAGGG - Intronic
1026556806 7:71415611-71415633 GTCTGCCGGCTCATAGCAGCCGG + Intronic
1027304843 7:76883174-76883196 CTCTGCACCCTGGCAGAAGCTGG + Intergenic
1027713387 7:81637628-81637650 CTCTGCTGTTTAACAGCAGCAGG - Intergenic
1029657330 7:101935879-101935901 CTCTACAGCCTGGCAGCAGATGG + Intronic
1030113496 7:106046158-106046180 CTCTGCACACCCACAGCAGCTGG - Intergenic
1032500311 7:132395047-132395069 CTCTGCAGCCTTACAGCAAATGG + Intronic
1032506387 7:132437789-132437811 CACTGCAGACTGTCAGCAGCAGG + Intronic
1035085549 7:156254581-156254603 CCCTGCAAGCTGACAGCCACTGG - Intergenic
1035197398 7:157233384-157233406 CTCGGGAGGCTGAAAGCAGGAGG - Intronic
1035651511 8:1269294-1269316 CTCTGCAGGCTGGGAGCTCCAGG - Intergenic
1036392245 8:8333710-8333732 CTCTGCTGTGTGATAGCAGCTGG + Intronic
1037333427 8:17767588-17767610 CTCTGAAGGCTGAGGGCAGGAGG + Intronic
1040459518 8:47633984-47634006 CTCTGGAGGCTGATGGCAGTTGG + Intronic
1040873332 8:52123793-52123815 CTTTGCAGGGGGCCAGCAGCAGG - Intronic
1041309627 8:56502156-56502178 ATCTGCCGGCTGCCAGCACCAGG - Intergenic
1041766926 8:61428649-61428671 CTCTGCAGGATAACATCATCAGG - Intronic
1042028845 8:64452079-64452101 CTCTGCAGGCTGCCTGCAGCTGG - Intergenic
1049088245 8:140494336-140494358 CTCTGCACCCTAACTGCAGCTGG + Intergenic
1049279330 8:141736428-141736450 TTCTGCAGGCAGACAGGACCGGG + Intergenic
1049476101 8:142797616-142797638 CTCAGCGGGCTGCCTGCAGCAGG + Intergenic
1049664379 8:143836533-143836555 CTCTGCTGGCAGCCAGGAGCAGG + Intronic
1049672314 8:143875394-143875416 CTGAGCAGCCTGTCAGCAGCAGG - Intronic
1050676570 9:8062607-8062629 CACTGCTGGCTGCCAGCACCAGG - Intergenic
1051320619 9:15900860-15900882 CTGTGCAGGGTGGCAGCAGCTGG - Intronic
1053299612 9:36939649-36939671 CTTAGCAGGCTGTCAGGAGCTGG - Intronic
1054856438 9:69904635-69904657 CTCTTCAGTTTGACTGCAGCAGG + Intronic
1055390315 9:75814777-75814799 TTCTGCATGATCACAGCAGCTGG - Intergenic
1056324352 9:85464097-85464119 TCCTGCAGGCAGACAGCAGTTGG - Intergenic
1056890758 9:90489478-90489500 CAGTGCAGGCTGGTAGCAGCTGG - Intergenic
1059642801 9:116234232-116234254 CGCTGCAGGCTGAGATCAGTGGG + Intronic
1060273302 9:122163419-122163441 CTCTGAAGGGCCACAGCAGCAGG - Intronic
1060817889 9:126644968-126644990 CACGGCAGACTGACAGCAGGTGG - Intronic
1061028765 9:128067294-128067316 CGCTGCTGGCTGGCAGCGGCCGG - Exonic
1061548721 9:131320116-131320138 CTGTGAAGTCTGGCAGCAGCGGG + Intergenic
1061605320 9:131705807-131705829 CTCTGTAGGGTGACAGCAGGTGG + Intronic
1061888802 9:133606854-133606876 CTCTGCAGCCTCATGGCAGCGGG - Intergenic
1061959258 9:133979697-133979719 GTCAGCAGGCTGACAGCAGGAGG - Intronic
1062125480 9:134858623-134858645 CTCTGCATGTTGACACCAGGAGG - Intergenic
1062284730 9:135767965-135767987 GTGTGCAGGCTGACAGCGGGTGG - Intronic
1062284747 9:135768023-135768045 GTGTGCAGGCTGACAGCGGGTGG - Intronic
1062293044 9:135806007-135806029 GTCTGCAGCCAGCCAGCAGCCGG + Intergenic
1062659255 9:137619615-137619637 CCCTGCTGGCTGTCAGAAGCAGG + Intronic
1186349575 X:8729037-8729059 CTCTGCAGGCCGACGACAGCAGG + Intronic
1186719442 X:12287418-12287440 ATTTGCAGATTGACAGCAGCAGG + Intronic
1187194794 X:17072687-17072709 CTACGCAGGCTGCCTGCAGCTGG - Intronic
1187277355 X:17827830-17827852 CTCTGCAGGCTGAGGGAAGGTGG + Intronic
1188443118 X:30231995-30232017 CTCCGAGGGCTGACAGCAGCGGG - Intronic
1188443420 X:30233732-30233754 CTCCGAGGGCTGACAGCAGGGGG - Intronic
1189298567 X:39936068-39936090 CTCTCCAGCCTGCCAGAAGCCGG + Intergenic
1189374829 X:40458830-40458852 CTCTGAAGGATGGCAGCAGCTGG + Intergenic
1189959617 X:46311979-46312001 CTCAGCAGGCACACAGCATCAGG - Intergenic
1190992438 X:55566192-55566214 CTGTGCAGACTCACAGCAACTGG + Intergenic
1192763998 X:74124346-74124368 TCCTGCAGGCAGACAGCAGTTGG + Intergenic
1194366356 X:93018883-93018905 CTCCCCAGCCTGAGAGCAGCAGG - Intergenic
1196003347 X:110809408-110809430 TTTCCCAGGCTGACAGCAGCAGG - Intergenic
1197713736 X:129690588-129690610 TTCTGGAGGCTGACAGCTGATGG - Intergenic
1197979395 X:132199565-132199587 CTCTTAATGCTTACAGCAGCTGG + Intergenic
1199756081 X:150866160-150866182 CTCTGCAGGCTGATAGTTGAAGG - Intronic
1200674583 Y:6135145-6135167 CTCCCCAGCCTGAGAGCAGCAGG - Intergenic
1201416772 Y:13754893-13754915 CACAGCAGGCTGACAACAGCAGG - Intergenic