ID: 1184751338

View in Genome Browser
Species Human (GRCh38)
Location 22:46488149-46488171
Sequence GACAGCAGCTGGGTGACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 2, 2: 1, 3: 36, 4: 309}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184751334_1184751338 7 Left 1184751334 22:46488119-46488141 CCTCAGTTTCAGGGGAGGGCTCT 0: 1
1: 0
2: 1
3: 32
4: 264
Right 1184751338 22:46488149-46488171 GACAGCAGCTGGGTGACAGCAGG 0: 1
1: 2
2: 1
3: 36
4: 309
1184751326_1184751338 18 Left 1184751326 22:46488108-46488130 CCTGCCCTGCACCTCAGTTTCAG No data
Right 1184751338 22:46488149-46488171 GACAGCAGCTGGGTGACAGCAGG 0: 1
1: 2
2: 1
3: 36
4: 309
1184751330_1184751338 14 Left 1184751330 22:46488112-46488134 CCCTGCACCTCAGTTTCAGGGGA 0: 1
1: 0
2: 1
3: 12
4: 170
Right 1184751338 22:46488149-46488171 GACAGCAGCTGGGTGACAGCAGG 0: 1
1: 2
2: 1
3: 36
4: 309
1184751331_1184751338 13 Left 1184751331 22:46488113-46488135 CCTGCACCTCAGTTTCAGGGGAG 0: 1
1: 0
2: 3
3: 16
4: 160
Right 1184751338 22:46488149-46488171 GACAGCAGCTGGGTGACAGCAGG 0: 1
1: 2
2: 1
3: 36
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184751338 Original CRISPR GACAGCAGCTGGGTGACAGC AGG Intronic
900837396 1:5015793-5015815 CACAGCATCTGAGTGACAACTGG + Intergenic
901463337 1:9404734-9404756 GACAGGAGGTGGGTGGCTGCAGG - Intergenic
901515165 1:9740404-9740426 TTCATCAGCTGGGTGACACCTGG + Intronic
902247653 1:15131876-15131898 AACAGCAGCTGGTTGGCTGCTGG + Intergenic
903832801 1:26184555-26184577 GACAGCAGAAGGGTGAGAGAAGG - Intronic
905472328 1:38202898-38202920 CTCAGCAGCTGTGTGACATCAGG - Intergenic
906687933 1:47774501-47774523 GACAGCATCCTGGTCACAGCAGG + Intronic
906905903 1:49891972-49891994 GACGGCAGCTGAGAGGCAGCAGG + Intronic
909078959 1:71086029-71086051 GCCAGCAGCAGGGTGACGGCAGG - Intergenic
912631588 1:111251141-111251163 AAGAGCTGCTGGGTGTCAGCTGG - Intergenic
912931380 1:113966251-113966273 GACAGCAGCTAGCTGACTGGAGG + Exonic
913614256 1:120541161-120541183 CACTCCAGCTGGGTGACAGAGGG + Intergenic
913972036 1:143423215-143423237 GCCAGCAGGTGGGTGACAGGTGG + Intergenic
914066417 1:144248828-144248850 GCCAGCAGGTGGGTGACAGGTGG + Intergenic
914112736 1:144717526-144717548 GCCAGCAGGTGGGTGACAGGTGG - Intergenic
914576013 1:148969738-148969760 CACTCCAGCTGGGTGACAGAGGG - Intronic
914917953 1:151829875-151829897 TACAGCAGTTAGGTGACAGTTGG - Intronic
917063180 1:171063284-171063306 CACTCCAGCTGGGTGACAGAGGG - Intronic
918444707 1:184605681-184605703 GGCAGCAGCTGTGTGACCCCAGG + Intronic
919900573 1:202041290-202041312 GATACCAGCTGGGGGTCAGCAGG + Intergenic
920304047 1:205007583-205007605 GATAGCAGCTGGGTGGGAGTTGG + Intronic
921179408 1:212619811-212619833 GACACCAGCTGGGGGCCATCTGG - Exonic
921951130 1:220931422-220931444 GACTGTAGCTGTGTAACAGCTGG - Intergenic
922171587 1:223159997-223160019 GACAGCATATGGGTCACAGAAGG - Intergenic
922464549 1:225838318-225838340 GACAGCTCCTGGCTCACAGCAGG - Intronic
1062961632 10:1576940-1576962 GGCTGGGGCTGGGTGACAGCGGG + Intronic
1062963728 10:1592301-1592323 GAGGGAAGCTGGGTGACAGAGGG - Intronic
1062963745 10:1592364-1592386 GAAGGGAGCTGGGTGACAGAGGG - Intronic
1062963762 10:1592427-1592449 GAGGGTAGCTGGGTGACAGAGGG - Intronic
1062963779 10:1592490-1592512 GAGGGAAGCTGGGTGACAGAGGG - Intronic
1062963796 10:1592553-1592575 GAAGGGAGCTGGGTGACAGAGGG - Intronic
1062963812 10:1592616-1592638 GAGGGTAGCTGGGTGACAGAGGG - Intronic
1062963829 10:1592679-1592701 GAGGGAAGCTGGGTGACAGAGGG - Intronic
1062963860 10:1592805-1592827 GAGGGAAGCTGGGTGACAGAGGG - Intronic
1062963877 10:1592868-1592890 GAGGGAAGCTGGGTGACAGAGGG - Intronic
1062963894 10:1592931-1592953 GAGGGAAGCTGGGTGACAGAGGG - Intronic
1062963911 10:1592994-1593016 GAGGGAAGCTGGGTGACAGAGGG - Intronic
1062963928 10:1593057-1593079 GAGGGAAGCTGGGTGACAGAGGG - Intronic
1062963945 10:1593120-1593142 GAAGGGAGCTGGGTGACAGAGGG - Intronic
1062963960 10:1593183-1593205 GAAGGGAGCTGGGTGACAGAGGG - Intronic
1062963977 10:1593246-1593268 GAGGGAAGCTGGGTGACAGAGGG - Intronic
1063650646 10:7933466-7933488 GACAGCAGATGTGTGACTGAAGG + Intronic
1064357239 10:14630815-14630837 CACTCCAGCTGGGTGACAGAGGG + Intronic
1066426168 10:35309445-35309467 GACAGAATCTGGGTGTCACCCGG + Intronic
1068112649 10:52697975-52697997 GAAAACATGTGGGTGACAGCTGG - Intergenic
1071252125 10:83829641-83829663 GTCAGTAGCTGGGTGATGGCAGG - Intergenic
1074386551 10:113020951-113020973 CACAGCAGTTGAGTGCCAGCTGG + Intronic
1074629419 10:115234726-115234748 GACCCCAGATGGGTGCCAGCAGG + Intronic
1075898452 10:126018832-126018854 GAAAGCAGCTGCCTGGCAGCAGG - Intronic
1077307820 11:1875819-1875841 GCCAGCAGGTGGGTGACAGGTGG - Intronic
1078334363 11:10451707-10451729 CAAAGGAGCTGGGTGAAAGCAGG + Intronic
1079129956 11:17741533-17741555 GAGAGCAGCTGGGGGGCTGCCGG - Intronic
1080645740 11:34186381-34186403 GACAGGAGCTGGGTGGTATCTGG - Intronic
1081741170 11:45441810-45441832 CACAGCAGCTGTATGACAGAGGG - Intergenic
1082655311 11:55848095-55848117 GACAGCAGCTATGTGCCACCAGG + Intergenic
1083858198 11:65404336-65404358 TGCAGCAGCCGGGTGCCAGCGGG - Intronic
1084510836 11:69602612-69602634 CACTGCAGGTGGATGACAGCTGG - Intergenic
1085297578 11:75439699-75439721 GACAGAGGCTGGGTGACTTCTGG - Intronic
1086249289 11:84794936-84794958 GACAGCAGGTTGATGGCAGCAGG + Intronic
1088169197 11:106976588-106976610 GCCAGCATCTGGTTGACAGGTGG + Intronic
1089733373 11:120533479-120533501 GACAGCAGCAGTGAGGCAGCAGG - Intronic
1090085250 11:123644734-123644756 CACTCCAGCTGGGTGACAGAGGG + Intronic
1090401716 11:126453434-126453456 GACAGCCTCTTAGTGACAGCAGG + Intronic
1090893821 11:130951445-130951467 GGCAGCAGCTGGGTGCAAACTGG + Intergenic
1091223377 11:133944040-133944062 GACAGCAGCGGGGACACTGCAGG + Intronic
1091442588 12:522908-522930 CACTCCAGCTGGGTGACAGAGGG + Intronic
1092146272 12:6216784-6216806 GAAGGCGGCTGGGTGGCAGCGGG - Intronic
1092191616 12:6525616-6525638 CACAGCAGCTGGGTCACTGCTGG - Exonic
1092965517 12:13638052-13638074 GACAGCAGAAAGATGACAGCAGG - Intronic
1093435550 12:19130489-19130511 GACGGCAGCTGGGGGTCACCGGG - Intronic
1095995608 12:48081147-48081169 GACAACAGCAGCATGACAGCTGG - Intronic
1097221358 12:57453047-57453069 GACAGCAGCTGGCTTGTAGCTGG - Intronic
1100077137 12:90799091-90799113 GATAGCATCAGGGTGACAGGAGG + Intergenic
1100440990 12:94616795-94616817 GACAGCAGATGGGTCACACCCGG + Intronic
1101530722 12:105571006-105571028 GACAGGCCCTGGGTGAGAGCAGG - Intergenic
1101871452 12:108568950-108568972 CACAGCAGGTGGGAAACAGCTGG - Exonic
1103417960 12:120757219-120757241 GACAGCAGCTGGGTCAGCCCAGG + Intergenic
1103656597 12:122475878-122475900 GCCAGCAGCAGGGTGACAGCTGG - Intronic
1103718810 12:122962380-122962402 GTGAGGCGCTGGGTGACAGCGGG + Intronic
1103882211 12:124174887-124174909 CCCAGCAGCTTGGTGGCAGCTGG - Intronic
1104056583 12:125235351-125235373 GACAGCAGCTGGGACAAAGGTGG - Intronic
1105453222 13:20518697-20518719 GAGACCAGCTGGGTGTCAGGAGG + Intronic
1106310345 13:28548754-28548776 GACAGAAGCTGGGTTAGAGTGGG + Intergenic
1106592883 13:31112091-31112113 AGCAGCATCTCGGTGACAGCAGG + Intergenic
1108747360 13:53409113-53409135 GACAGCAGGTTGGGGGCAGCGGG + Intergenic
1108975530 13:56438970-56438992 GACAGGACCTGGGTGCCAGTGGG - Intergenic
1109930030 13:69204239-69204261 GAGAGTAGCTGGATGAAAGCTGG + Intergenic
1111354468 13:87080229-87080251 GACAGCATGTTGATGACAGCAGG - Intergenic
1113030806 13:105991825-105991847 GAAAGGAGCAGCGTGACAGCTGG - Intergenic
1113638912 13:111943463-111943485 GACAGAGGCTGGGAGAGAGCCGG - Intergenic
1113674561 13:112198485-112198507 GACACCAGCTGGTTCCCAGCCGG + Intergenic
1114040909 14:18677547-18677569 GAATTCTGCTGGGTGACAGCTGG - Intergenic
1114045946 14:18876034-18876056 GAATTCTGCTGGGTGACAGCTGG - Intergenic
1114118268 14:19643432-19643454 GAATTCTGCTGGGTGACAGCTGG + Intergenic
1114245060 14:20905312-20905334 GACAGCAGCTTAGCTACAGCGGG + Intergenic
1115504604 14:34081107-34081129 GACAGAAGCTTGAAGACAGCAGG + Intronic
1118660708 14:68007028-68007050 GCCAGGAGCTGGGGGAAAGCAGG - Intronic
1119079748 14:71681232-71681254 TACTGCAGAGGGGTGACAGCAGG - Intronic
1119257210 14:73208838-73208860 GACAGCAGGTTGATGGCAGCAGG - Intronic
1119596155 14:75936111-75936133 TACAGCACCTGGGATACAGCAGG - Intronic
1121015504 14:90546502-90546524 GACAGCAGCTGGGAGGCAGGAGG - Intronic
1121562565 14:94885960-94885982 GACTGCAGCTGCGTGAGAGTGGG + Intergenic
1121605275 14:95235969-95235991 TACAGCAGCTTGGTGGCAGAGGG - Intronic
1121753331 14:96378214-96378236 GACTGCAGGTGGGTGCCATCAGG - Intronic
1121827170 14:97019612-97019634 GCCAGCTGCTGGGAGTCAGCAGG - Intergenic
1122238868 14:100348667-100348689 GACAGCAGCTGTCTGTCACCTGG + Intronic
1122640530 14:103156626-103156648 GACAGAAGCTGGGTCACCCCTGG + Intergenic
1124069286 15:26376565-26376587 GACATCAGCTAGGAGACAGGAGG + Intergenic
1125420893 15:39503098-39503120 GACACCAGATAGGTGACAGAGGG + Intergenic
1125456226 15:39861737-39861759 GACATCAGCTGGCTGCCAGCTGG + Intronic
1125692035 15:41603700-41603722 GACTTCAGCTGGATGACAGTGGG + Intergenic
1126049022 15:44670230-44670252 CACTCCAGCTGGGTGACAGAGGG - Intronic
1126900635 15:53310645-53310667 GACAGCAGCTGGGTATCAAGTGG - Intergenic
1127394464 15:58532780-58532802 ATCAGCAGATGGGTGACTGCAGG - Intronic
1128176584 15:65561705-65561727 GACACCAGCTGGGTGCCCTCTGG + Intronic
1130383564 15:83392498-83392520 TACAGCAGCAGAGTGACGGCTGG + Intergenic
1131266304 15:90917464-90917486 GACTGGAGGAGGGTGACAGCGGG + Intronic
1131527722 15:93165915-93165937 ATCAGCAGCTGGGAGACAACCGG - Intergenic
1132483422 16:177576-177598 GACAGCAGCTGGGACACACATGG + Intergenic
1132932660 16:2466921-2466943 GACAGGAGGTGGATGACACCTGG + Intergenic
1133214792 16:4285341-4285363 GGCAGCAGGTGGGAGGCAGCAGG + Intergenic
1133987042 16:10676504-10676526 GAGAGCAGCTGGTTGGCAGAAGG + Intronic
1135629448 16:24024298-24024320 ACCAGAAGCTGGGGGACAGCAGG + Intronic
1136751169 16:32637618-32637640 GGTAGGAGCAGGGTGACAGCTGG + Intergenic
1138869493 16:60864753-60864775 CACAGCAGCTGGTTTAAAGCAGG - Intergenic
1139667295 16:68466603-68466625 AACAGCAGCTCGGGGACAGCTGG - Intergenic
1139671331 16:68493874-68493896 GCCAGCTGCTGGGTGACACCAGG - Intergenic
1141459581 16:84170077-84170099 GACAGTAGCAGGGTCTCAGCTGG - Exonic
1141459622 16:84170233-84170255 GACAGTAGCAGGGTCTCAGCTGG - Exonic
1141699445 16:85635755-85635777 CACAGCTGCTGGATGAAAGCAGG - Intronic
1142193043 16:88726636-88726658 GCCAGGAGCTGGGGGAGAGCAGG + Exonic
1142420345 16:89966112-89966134 GCAAGCACCTGGGAGACAGCGGG - Exonic
1203053303 16_KI270728v1_random:896873-896895 GGTAGGAGCAGGGTGACAGCTGG + Intergenic
1143018255 17:3903364-3903386 GACAGCTGCTGTGTGTCATCCGG + Intronic
1143217764 17:5237908-5237930 GGCAGAAGCTGGGTGCCACCCGG - Intergenic
1143757151 17:9075446-9075468 CACTCCAGCTGGGTGACAGAGGG + Intronic
1144376220 17:14644711-14644733 GACAGCAGGTGGGTACAAGCTGG + Intergenic
1145058574 17:19718442-19718464 GCCATCAGCTCGGTGACATCAGG + Intronic
1145911050 17:28543371-28543393 GACAGCAGCTTTTTAACAGCTGG + Intronic
1147013058 17:37467248-37467270 GACAGCAGCTGGAAGATAGCTGG + Intronic
1147593044 17:41697537-41697559 GACAGCAGCTGCTTGGCTGCGGG - Intergenic
1149133420 17:53336356-53336378 GACTGCGGCAGGGTGACAGCAGG - Intergenic
1149698691 17:58637380-58637402 GAAAGCATCAGGATGACAGCTGG + Intronic
1151322488 17:73360204-73360226 GACAGCGGCTGGGTGGCTCCTGG + Intronic
1151535726 17:74737822-74737844 GGGAGCAGCTGGGGGACATCAGG - Intronic
1153469719 18:5430302-5430324 GACAAAAGCTGGTTGAGAGCAGG + Intronic
1153838579 18:8986378-8986400 GACACCAGCAAGGTGTCAGCTGG + Intergenic
1154011597 18:10579350-10579372 GACAGCACCTGGGTAACCTCTGG - Intergenic
1154379770 18:13838493-13838515 GAGAGCAGCTAGGAGCCAGCTGG + Intergenic
1157256813 18:46146880-46146902 CACAGCAACTGGGAGACAGAGGG - Intergenic
1158050748 18:53215656-53215678 GACAGCAGTTGGGTGAGTGAAGG - Intronic
1159937201 18:74378664-74378686 GGTAGCTGCTGGGTGACTGCAGG - Intergenic
1160001707 18:75030795-75030817 GACAGCAGCAGGGTGGGGGCTGG - Intronic
1160229679 18:77037768-77037790 CATCGCTGCTGGGTGACAGCAGG + Intronic
1160412625 18:78685467-78685489 GTCAGCAGCTGGGTCCCTGCTGG - Intergenic
1161720591 19:5900124-5900146 CACCACAGCTGGATGACAGCTGG - Intronic
1162113301 19:8413148-8413170 GCCAGCAGCTGCGGCACAGCGGG + Intronic
1165929512 19:39347471-39347493 GACTGCGGCTGGGGGACAGTGGG - Intronic
1166741645 19:45118190-45118212 GACAGCGGCTGGGTGCCGGGAGG - Intronic
1167029425 19:46947636-46947658 GACACCAGCTGGGTGTCCTCCGG + Intronic
1167666199 19:50823847-50823869 GCCAACATCTGGGTGCCAGCAGG - Intergenic
1167671192 19:50854835-50854857 GTCAGCCTCTGGGTGCCAGCAGG + Intergenic
1168639208 19:58019689-58019711 CATAGCAGCTGGGGGCCAGCAGG - Intergenic
925425904 2:3748447-3748469 CAGAGCAGCTGGGTGACTGTCGG + Intronic
926163304 2:10502839-10502861 GAGAGAAGCTTGGGGACAGCGGG - Intergenic
926293490 2:11550248-11550270 GAAAGCTGCTGGTTGACTGCTGG + Intronic
928374244 2:30762154-30762176 GATAGCATCTGAGAGACAGCTGG - Intronic
928409922 2:31047168-31047190 GACAGCAGGTGGTTGAGAACAGG + Intronic
931690877 2:64833999-64834021 GACAGGAGTTGGGTGGGAGCTGG + Intergenic
932004079 2:67910789-67910811 GACAGCAGCTGGGATGCAGGGGG + Intergenic
932055239 2:68436874-68436896 GACAGCTGCTGGGTGTGACCAGG + Intergenic
932660716 2:73649243-73649265 TAAAGCAGCTGGGTGGCTGCTGG - Intergenic
932667990 2:73712260-73712282 TACAGCAGTTGGGTGGCTGCTGG - Intergenic
934176735 2:89584152-89584174 GCCAGCAGGTGGGTGACAGGTGG + Intergenic
934287041 2:91658512-91658534 GCCAGCAGGTGGGTGACAGGTGG + Intergenic
936049644 2:109213355-109213377 GATAACTGCTGGGTGACAGGAGG + Intronic
937017595 2:118619939-118619961 GGGGGCTGCTGGGTGACAGCAGG - Intergenic
938227095 2:129625609-129625631 AACAGAAGCTGCATGACAGCAGG - Intergenic
938269278 2:129954974-129954996 GAATTCTGCTGGGTGACAGCTGG + Intergenic
938606141 2:132894763-132894785 GACAGTAGCAGGGTGACAGAGGG + Intronic
941166974 2:162093110-162093132 GTCAGCTGCTGCTTGACAGCTGG + Intergenic
943485490 2:188474128-188474150 GATAGCAGCTCAGTGACAGCAGG - Intronic
943626608 2:190208358-190208380 CACAGCAGCAGGATGGCAGCAGG + Intronic
943753270 2:191532048-191532070 GGCAGCATATGGGTGGCAGCTGG + Intergenic
945194947 2:207228854-207228876 GAAATCTGCTGGGGGACAGCAGG + Intergenic
945590981 2:211731159-211731181 GACAGCTGCTGGGTGAGAGAAGG - Intronic
946402186 2:219473896-219473918 GCTGGCAGGTGGGTGACAGCGGG + Exonic
946749799 2:222882651-222882673 GACAGCAGGTAGGCAACAGCAGG - Intronic
947909534 2:233792061-233792083 CACAGAAGCAGGGAGACAGCAGG - Intronic
948323594 2:237092732-237092754 GACAGTGGCTGAGTGAAAGCTGG + Intronic
948366167 2:237456237-237456259 GAGAGCAGTTGGGTGGCACCGGG + Intergenic
948750336 2:240128556-240128578 GAAAGCTGCTGGGGGACCGCAGG - Intronic
948956542 2:241297229-241297251 GACAGCAGCTGAGTGAGATGAGG + Intronic
949003637 2:241632914-241632936 GACCGCGGCTGGGCGACAGCAGG + Exonic
949072411 2:242033511-242033533 GAGAACAGCTGGGTGGGAGCAGG - Intergenic
1169774308 20:9235696-9235718 GACACCAGCTGGTTTACATCAGG + Intronic
1171149197 20:22811867-22811889 GTCACCAGCTGGGTGACTCCAGG - Intergenic
1171339826 20:24419279-24419301 GTCAGCAGGAGGGTGGCAGCAGG + Intergenic
1171393828 20:24818165-24818187 GCCAGGTGCAGGGTGACAGCAGG - Intergenic
1171990665 20:31694071-31694093 GGCAGCAGCTGGGGCACAGTGGG + Intronic
1173475127 20:43353432-43353454 GCCAGCAGCTGGGGATCAGCTGG + Intergenic
1174059917 20:47825640-47825662 AACAGCAGCTGTGTGACCCCCGG + Intergenic
1175472425 20:59240129-59240151 GACAGCAGCTGGGGGACTGTGGG - Intronic
1175729020 20:61340344-61340366 GACAGCGGCAGGCTGGCAGCTGG - Intronic
1175767706 20:61602729-61602751 CACAGCACCTGGGAGACAGGAGG - Intronic
1175857234 20:62128398-62128420 GACAGCAGCTGTGTGCCATAAGG - Intronic
1175971443 20:62688616-62688638 GACACCAACTGGGTGAGAGCAGG + Intergenic
1176057498 20:63156356-63156378 GCCAGCAGCTGGCAGCCAGCAGG - Intergenic
1176248577 20:64109375-64109397 GACAGCAGCTCGGTGACAGCAGG - Intergenic
1176248599 20:64109446-64109468 GACAGCAGCTCGGTGACAGCAGG - Intergenic
1176369392 21:6053326-6053348 GCCAGCAGCTCGGTGGCACCCGG + Intergenic
1178148937 21:29771806-29771828 GACAGCAGCTATTTGCCAGCTGG - Intronic
1178535070 21:33403889-33403911 GACAGGAGCTGGGCAGCAGCAGG + Intronic
1179068677 21:38051451-38051473 GACAGCAGCTGGTTGACCTTAGG - Intronic
1179571499 21:42281290-42281312 GACAATAGCTGGGTGAATGCTGG + Intronic
1179655701 21:42842897-42842919 GACAGCAGGAGGGTCACACCTGG + Intergenic
1179754127 21:43485215-43485237 GCCAGCAGCTCGGTGGCACCCGG - Intergenic
1180464477 22:15598655-15598677 GAATTCTGCTGGGTGACAGCTGG - Intergenic
1180578888 22:16810467-16810489 GCCTGCATCTGGGTGATAGCAGG - Intronic
1180800421 22:18629250-18629272 GACCGCACCTGGGGGACAGAGGG + Intergenic
1180851655 22:19024806-19024828 GACCGCACCTGGGGGACAGAGGG + Intergenic
1181221298 22:21366012-21366034 GACCGCACCTGGGGGACAGAGGG - Intergenic
1181556453 22:23674429-23674451 GAGAGGAGCTGGGTCACAGCGGG - Intergenic
1181618646 22:24072312-24072334 GACAGCAGAAGTGTCACAGCAGG - Intronic
1181810530 22:25401158-25401180 TACAGAAGCTGTGAGACAGCCGG - Intronic
1181815985 22:25437282-25437304 GCCAGCATCTGGGGGCCAGCAGG + Intergenic
1182022172 22:27090494-27090516 GAGAGCAGCTGGGCATCAGCTGG - Intergenic
1182149129 22:28016468-28016490 GACAGCAGATGGGCAGCAGCAGG + Intronic
1182156971 22:28083654-28083676 GACAGCAGGTGCAGGACAGCGGG + Intronic
1182787758 22:32921871-32921893 GACAGCAGCTGTGTGACCGTGGG - Intronic
1184751338 22:46488149-46488171 GACAGCAGCTGGGTGACAGCAGG + Intronic
1184773841 22:46613482-46613504 GACAGCAGCTCGGGGACACAGGG - Intronic
949538398 3:5013319-5013341 GACAGCAGCTGGGTGTTATCAGG - Intergenic
950235749 3:11318821-11318843 GGCAGCAGCCAGGTGACAGAAGG - Intronic
954638608 3:52085059-52085081 GGCAGCAGCTGGGTGAAGCCTGG + Intronic
954638974 3:52086878-52086900 GACAGCACCTGGTACACAGCAGG + Intronic
955974158 3:64464514-64464536 GACAGCAGCTGCCAAACAGCAGG + Intergenic
959871446 3:111332926-111332948 GACAACCACAGGGTGACAGCTGG + Intronic
960902335 3:122564904-122564926 GACAGCAGCTGGCAGGCATCTGG - Intronic
961431681 3:126888533-126888555 GGCAGCAGGTGGGGCACAGCAGG - Intronic
961439526 3:126944685-126944707 CACAGCACCTGTGTGACAGCGGG + Intronic
964480073 3:157131064-157131086 GCCAGCAGCTGGGTAGTAGCCGG - Intergenic
964517408 3:157527449-157527471 GCCAATAGCAGGGTGACAGCAGG + Intronic
964927300 3:161975035-161975057 GACAGCATGTTGATGACAGCAGG - Intergenic
968142993 3:196273906-196273928 GACAGCAGGTTGATGACAGCAGG - Intronic
968528351 4:1076321-1076343 GACAGCGCCTGGGGCACAGCTGG - Intronic
968665017 4:1816259-1816281 AACAGCTGTTGGGTGACTGCTGG - Intronic
970850611 4:20598365-20598387 GGCAGAAGCTGGATGAGAGCCGG - Exonic
970919341 4:21374824-21374846 GAGTGTAGCTTGGTGACAGCTGG + Intronic
970954022 4:21789553-21789575 TACAGCAACTGGGTCACAGAGGG + Intronic
972349595 4:38224471-38224493 GAAAGCAGCTGGGAGAGAGAGGG - Intergenic
973801446 4:54482717-54482739 GACAGGACCTGGGTGTCAGACGG - Intergenic
974272117 4:59663574-59663596 GACAACTGGTGGGTGACAGATGG + Intergenic
977176984 4:93829679-93829701 GACCGCAGCTGGGGCTCAGCAGG + Exonic
978409920 4:108415714-108415736 GACAGCAGGTGGGAGAAACCAGG - Intergenic
979940747 4:126759046-126759068 GACAGCATCTGCATGACAGAAGG - Intergenic
982163061 4:152589107-152589129 GTCAGGAGCTGGGTGATAGGTGG - Intergenic
985321980 4:188723078-188723100 AAGAGCAGCTGGATGCCAGCTGG - Intergenic
985765505 5:1777388-1777410 GACAGCAGCCTGGTGAGACCAGG + Intergenic
987142788 5:14962514-14962536 GGCAGCAGACAGGTGACAGCAGG - Intergenic
987268273 5:16278636-16278658 GAGATCAGCTGTGGGACAGCCGG + Intergenic
988409341 5:30866349-30866371 GAGAGCAGCAGGGTGAAAGGTGG + Intergenic
988454190 5:31372988-31373010 GACAGAAGCTGGGGGACAGGAGG - Intergenic
990889536 5:60633020-60633042 CACAGCAGCTGGCACACAGCAGG - Intronic
991205207 5:64042061-64042083 AATACCAGCTTGGTGACAGCAGG + Intergenic
992222197 5:74584167-74584189 GACACCAGCCTGGTGACATCTGG + Intergenic
992530841 5:77650432-77650454 AGCAGCACCTGGGTGCCAGCAGG - Intergenic
994703943 5:103175688-103175710 GACAGCAGATAGGTGAAAGTGGG + Intronic
995534408 5:113120794-113120816 AAAAGCAGCTGGGAGACATCAGG - Intronic
998172539 5:139881032-139881054 GGCAACCGCTGGGTGACTGCTGG - Intronic
998253274 5:140566832-140566854 GATAGCAAATGGATGACAGCTGG - Exonic
998446291 5:142200857-142200879 GATGGCAGATGGGTGACAGCAGG + Intergenic
999114013 5:149145921-149145943 GACCGCAGGTGGGTGCCACCAGG + Intronic
999452547 5:151689180-151689202 GACAGAAGCTTGGTGAGAGCAGG + Intergenic
999734925 5:154505978-154506000 GACACCAGGTAGGTGAGAGCTGG + Intergenic
1000245131 5:159442663-159442685 GACAGCAGCTGGGGGAGGGGAGG + Intergenic
1001328758 5:170747574-170747596 AAAGGCTGCTGGGTGACAGCAGG - Intergenic
1001957080 5:175855139-175855161 GAGAGCAGCTGGATGAGAGCAGG + Intronic
1002270466 5:178068476-178068498 GACAGCTGGTGGGTGGGAGCCGG + Intergenic
1002533858 5:179865401-179865423 GACGGCTGCGGGCTGACAGCAGG + Intronic
1002603541 5:180368991-180369013 GACAGAAGCTGGGAGAAGGCAGG - Intergenic
1002633575 5:180596333-180596355 GATAGCAGCTGGCTGTCAGGTGG + Intergenic
1003387475 6:5682661-5682683 AACAGGACCTGGCTGACAGCAGG - Intronic
1003624107 6:7727077-7727099 GGCAGCTGCTGGGGGACGGCGGG + Exonic
1006077057 6:31540454-31540476 GACAGCAGCTGGGGGAGATGGGG - Exonic
1006598263 6:35209218-35209240 GAAAGCAGCTGGGGCACAGGTGG + Intergenic
1006855660 6:37131463-37131485 GGCAGCAACTGTGTGACATCAGG - Intergenic
1007111282 6:39314594-39314616 GGAAGCTGCTGGGTGACCGCAGG + Intergenic
1007737847 6:43993004-43993026 GCCAGCTGCCAGGTGACAGCAGG + Intergenic
1012628056 6:101428807-101428829 GTCTGCAGGTGGGTGACAGGGGG + Intronic
1014711807 6:124815305-124815327 CACTCCAGCTGGGTGACAGGAGG - Intronic
1016606516 6:145934936-145934958 AACAGCCTGTGGGTGACAGCAGG + Exonic
1016850434 6:148613517-148613539 GACAGCAGATTGGTTGCAGCTGG + Intergenic
1017053409 6:150415697-150415719 AAGAGCAGCAGGGTAACAGCAGG + Intergenic
1017801318 6:157898852-157898874 GACAGGAGCTGCCTGTCAGCAGG + Intronic
1018893191 6:167996761-167996783 GACAGCGGGGGGGGGACAGCGGG + Intronic
1018893195 6:167996775-167996797 GACAGCGGGGGTGTGACAGCGGG + Intronic
1020180027 7:5915094-5915116 TCCAGCAGCTCCGTGACAGCAGG + Intronic
1020302907 7:6809788-6809810 TCCAGCAGCTCCGTGACAGCAGG - Intronic
1021343158 7:19489208-19489230 GACAGCAGGTTGATGGCAGCAGG - Intergenic
1022845907 7:34209569-34209591 GACTGGAGATGGGTGAGAGCTGG + Intergenic
1023176290 7:37438792-37438814 TACAGCAGATGGGTGACTTCAGG - Intronic
1023437252 7:40151370-40151392 GAAAGCATCTGTGTGGCAGCTGG + Intronic
1023818254 7:43966196-43966218 GCCAGGTGCTGGGGGACAGCAGG + Intergenic
1024348806 7:48341331-48341353 GAAAGCAGCTGGGTGCTGGCAGG - Intronic
1025091590 7:56068732-56068754 TCCAGCACCTGGGTGACAGAGGG - Intronic
1026176740 7:68004108-68004130 GACAGCTCCTAGGTGACAGCAGG + Intergenic
1026428550 7:70320951-70320973 GACACCAGCTGAGTGACCACAGG + Intronic
1026865519 7:73821840-73821862 GACACCAACTGGGTGGCAGCTGG + Intronic
1029223299 7:99007253-99007275 GACAGCAGCTGTCTCAGAGCAGG + Intronic
1029452372 7:100648345-100648367 GAAACCAGCTGGCAGACAGCAGG - Intronic
1031808064 7:126330686-126330708 GACAGCTGCTGGGTGGTAGCTGG + Intergenic
1032542909 7:132718543-132718565 GACAGCAGGTTGGAGACAGAAGG - Intronic
1035750717 8:1994220-1994242 GAGGGCAGGTGGGGGACAGCTGG + Intronic
1035754818 8:2023239-2023261 GACAGCAGCCTGGTTACAGTGGG + Intergenic
1036663798 8:10726059-10726081 GGCAGGAGATGGGGGACAGCCGG + Exonic
1036909153 8:12738705-12738727 GAAATAAGCTGGGAGACAGCTGG + Intronic
1037188106 8:16089289-16089311 GACAGCAGAATGGTGACAGAAGG + Intergenic
1041074204 8:54154330-54154352 GACAGCAGCTGTGTGACCTCGGG + Intergenic
1041239120 8:55833767-55833789 CACTCCAGCTGGGTGACAGATGG - Intergenic
1042209904 8:66369664-66369686 GACAGCTGCTGAGTGCCAGCCGG + Intergenic
1044775035 8:95678561-95678583 GCCAGGAGCAGGGAGACAGCAGG + Intergenic
1045315304 8:101038834-101038856 GACAGCAGCTAGGAGGGAGCCGG - Intergenic
1050361672 9:4836532-4836554 GACAGGATCTGGGTGGGAGCAGG + Intronic
1051107126 9:13593126-13593148 AACAGTTGCTGGGTGACAGAAGG + Intergenic
1051873069 9:21761579-21761601 AACAGCAGCTGAATGAGAGCAGG - Intergenic
1054803841 9:69379397-69379419 GATGTCAGCTGGGTGACAGGTGG + Intronic
1057050980 9:91924082-91924104 AACAGCAGCTTGGGGAGAGCAGG - Intronic
1057490214 9:95514982-95515004 GAAGGAAGCTGGGTGACAACTGG + Intronic
1058012959 9:99998584-99998606 GACAGCATGTGGATGACGGCAGG - Intronic
1059980553 9:119767049-119767071 GATTGGAGGTGGGTGACAGCAGG - Intergenic
1060540836 9:124429082-124429104 GACAGCAGTCGGGAGACAGGTGG + Intergenic
1060817288 9:126641778-126641800 GACAGCAGCTGTGTGGAAGGTGG - Intronic
1061943067 9:133893360-133893382 AACAGCAGCTGGGCCTCAGCTGG + Intronic
1062340049 9:136090163-136090185 GACACCAGCTGGGTGGTAGAAGG + Intronic
1062564705 9:137158996-137159018 AAGAGCAGATGGGGGACAGCAGG + Intronic
1186215018 X:7290324-7290346 GACAGCGGCAGCGTGACAACAGG - Intronic
1187362858 X:18644355-18644377 GACAGGAGCTCGGGGACAGGAGG + Intronic
1190101309 X:47524572-47524594 GGCAGCAGCTGGGTGAGTCCTGG - Intergenic
1190976367 X:55405690-55405712 GAAAATAGCTGGGTGACAGGTGG + Intergenic
1192853238 X:74980232-74980254 GATACCAGCTCGGTCACAGCAGG + Intergenic
1195579026 X:106480774-106480796 GACAGAAGCTAGGTGATAGCAGG + Intergenic
1195697719 X:107679086-107679108 GACAGGAGGAGGGTGATAGCAGG - Intergenic
1196457499 X:115900728-115900750 GAGACTATCTGGGTGACAGCTGG - Intergenic
1197673222 X:129301837-129301859 GTGAGCAGTTGGGTGGCAGCTGG - Intergenic
1199616418 X:149659560-149659582 GAAAGCAGCTGGGTGTGAGAGGG + Intergenic
1199626223 X:149743688-149743710 GAAAGCAGCTGGGTGTGAGAGGG - Intergenic
1199794531 X:151181303-151181325 GACTCCAGCTGGCTGGCAGCAGG - Exonic
1200147257 X:153932688-153932710 GACCCCAGCTGGGGGAGAGCCGG + Intronic