ID: 1184751339

View in Genome Browser
Species Human (GRCh38)
Location 22:46488161-46488183
Sequence GTGACAGCAGGAAGCAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 495}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184751334_1184751339 19 Left 1184751334 22:46488119-46488141 CCTCAGTTTCAGGGGAGGGCTCT 0: 1
1: 0
2: 1
3: 32
4: 264
Right 1184751339 22:46488161-46488183 GTGACAGCAGGAAGCAGCTGTGG 0: 1
1: 1
2: 5
3: 48
4: 495
1184751326_1184751339 30 Left 1184751326 22:46488108-46488130 CCTGCCCTGCACCTCAGTTTCAG No data
Right 1184751339 22:46488161-46488183 GTGACAGCAGGAAGCAGCTGTGG 0: 1
1: 1
2: 5
3: 48
4: 495
1184751331_1184751339 25 Left 1184751331 22:46488113-46488135 CCTGCACCTCAGTTTCAGGGGAG 0: 1
1: 0
2: 3
3: 16
4: 160
Right 1184751339 22:46488161-46488183 GTGACAGCAGGAAGCAGCTGTGG 0: 1
1: 1
2: 5
3: 48
4: 495
1184751330_1184751339 26 Left 1184751330 22:46488112-46488134 CCCTGCACCTCAGTTTCAGGGGA 0: 1
1: 0
2: 1
3: 12
4: 170
Right 1184751339 22:46488161-46488183 GTGACAGCAGGAAGCAGCTGTGG 0: 1
1: 1
2: 5
3: 48
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184751339 Original CRISPR GTGACAGCAGGAAGCAGCTG TGG Intronic
900142715 1:1145292-1145314 GGGACAGGCGGGAGCAGCTGAGG + Intergenic
900242976 1:1625676-1625698 GTTACAGAAGCAAGCAGATGAGG - Intronic
900243286 1:1626796-1626818 GTCACAGCAGGCTGCAGGTGTGG - Intronic
900428325 1:2590527-2590549 GTGACAGCTGGGAGCTGATGGGG - Exonic
900647992 1:3717675-3717697 GAGACAGGAGGAAGGAGCTGGGG + Intronic
901558315 1:10049276-10049298 GTGACCTCAGGCTGCAGCTGGGG + Intronic
901971652 1:12913393-12913415 AGGTCAGAAGGAAGCAGCTGTGG - Intronic
902013515 1:13288347-13288369 AGGTCAGAAGGAAGCAGCTGTGG + Intergenic
903337820 1:22636686-22636708 TTGACAACAGGAGGCAGGTGAGG + Exonic
903476759 1:23624812-23624834 ATGACAGCAGGAAGAAGGTGGGG + Intronic
903625751 1:24729190-24729212 GTGACTTCGGGAAGCACCTGAGG + Intergenic
903679157 1:25085530-25085552 GTGAGAGAAGAAAGCAACTGGGG + Intergenic
904141376 1:28356397-28356419 AAGACAGCAGGAAGAAGATGAGG - Intergenic
904257085 1:29260633-29260655 GGGCCAGCACGCAGCAGCTGTGG - Exonic
904289894 1:29478325-29478347 CAGACAGCAGGAATCAGCCGCGG - Intergenic
904455312 1:30644234-30644256 GTGAAAGCAGGAGGGAGCTCTGG - Intergenic
904474443 1:30755945-30755967 GTGACAGCAGGGGGCAGATGGGG - Intronic
905272974 1:36798918-36798940 GTGACAGGAGGAAGAAGAAGTGG - Exonic
906295729 1:44647938-44647960 TGGACAGCAGGAAGCTGCTGAGG - Intronic
906372037 1:45262238-45262260 GTTACAGCTGGGAGCAACTGGGG - Intronic
906535921 1:46550953-46550975 GGGTCAGCAGGAATCAGCTGGGG - Intronic
906631988 1:47379151-47379173 GGGACAACTGGAAGCAGGTGTGG + Intergenic
907506073 1:54919138-54919160 GTGACAGCGGCAAACAGCAGTGG + Intergenic
907509234 1:54946004-54946026 GGGAGACCAGGAAGAAGCTGAGG + Intergenic
907938259 1:59062109-59062131 GTGACATCAGTGAGCAGCTGGGG - Intergenic
908389900 1:63674988-63675010 CTCACAGCAAGTAGCAGCTGTGG - Intergenic
908775252 1:67633295-67633317 GTGACAGCAGGAAATCTCTGAGG - Intergenic
910141455 1:84031468-84031490 GTGAAAGCAGCCAGAAGCTGGGG - Intergenic
910802769 1:91162249-91162271 GTGACAGAAGGAGGCAGAGGAGG + Intergenic
912146242 1:106797473-106797495 GAGAAAGAAAGAAGCAGCTGGGG - Intergenic
913159514 1:116132628-116132650 GTGAGGGCAGGAGGCAGATGTGG + Intronic
914871320 1:151477249-151477271 GTGATAAGAGGAAGGAGCTGGGG - Intergenic
915726403 1:158020964-158020986 GTGCCAGGAGGAAGAAGCAGTGG + Intronic
915836586 1:159181600-159181622 GTCCCAGAAGGAAGCAGCTAAGG + Intronic
915943976 1:160136516-160136538 GTCAGAGCAGGAAGCAGAAGGGG - Intronic
916950781 1:169778282-169778304 GTGACAACTGGAAGGAGCAGTGG - Intronic
918229242 1:182513215-182513237 CTGTCAGCAGGAAGTAGCTCAGG - Intronic
918514948 1:185353285-185353307 GAGACACAAGGAAACAGCTGTGG - Intergenic
918615677 1:186541212-186541234 GTGACAGCAGGCACCAGCTGTGG - Intergenic
919648615 1:200123072-200123094 GGGACAGCAGGTACCAGCTTAGG - Intronic
919709349 1:200710651-200710673 GTTTCAGCAGGCAGCAGCTGGGG + Intergenic
920337478 1:205254852-205254874 GTGGCAGCAGGAGACAGGTGGGG - Intronic
921115637 1:212088243-212088265 GAGACTGCAGCAAGCAACTGAGG - Intronic
922007937 1:221551048-221551070 GTGACAGCGGCAAACAGCAGTGG + Intergenic
922150800 1:223002425-223002447 GGGGCAGCAGGAGGCAGCAGTGG - Exonic
922159869 1:223071574-223071596 GTGGAAGCAGGCAGCAGCTTTGG + Intergenic
922571492 1:226637196-226637218 GGGGCAGCAGGCAGCAGGTGGGG - Intronic
922627795 1:227067246-227067268 GTGAGAGCAGAAACAAGCTGAGG + Intronic
923051219 1:230392687-230392709 GTGAGAGCAGGCCGCTGCTGAGG - Intronic
923350548 1:233101035-233101057 GAGAGAACAGGAAGAAGCTGAGG + Intronic
923626023 1:235614705-235614727 GGGCCAGTAGGAGGCAGCTGTGG - Intronic
1063516627 10:6702770-6702792 GTGACAACAGCAAGCAGATAAGG + Intergenic
1064324315 10:14334403-14334425 GTCACAGAAGGAAGAAGGTGTGG + Intronic
1064681551 10:17815469-17815491 GTGAGAGCAGAAACTAGCTGTGG + Intronic
1066780709 10:38942516-38942538 GCGGCGGCAGAAAGCAGCTGAGG - Intergenic
1067797598 10:49332059-49332081 GTGGCAGCAGGAAGCAGGCCAGG - Intergenic
1067955987 10:50791343-50791365 GAAACACCAGGAAGCATCTGTGG - Intronic
1067964412 10:50893256-50893278 GTCACACCAGGAACCAGCTTGGG + Intergenic
1068423440 10:56824068-56824090 GTGACAGTAGGTGGCAGTTGTGG - Intergenic
1068679108 10:59799687-59799709 CTGGGAGCAGGAAGAAGCTGTGG - Intronic
1068833766 10:61528567-61528589 GAAACAGCAGGAAGCCGTTGTGG + Intergenic
1069802990 10:71093793-71093815 GTGCCAGCAGCCAGCAGCTTCGG + Intergenic
1071228626 10:83561019-83561041 GAGACAGCTGTAGGCAGCTGTGG + Intergenic
1073054351 10:100689499-100689521 GTGGATGCAGGAAGCAGCAGGGG - Intergenic
1073374291 10:103019485-103019507 GTGATAGCAGGAACCAGATAGGG + Intronic
1073444207 10:103571194-103571216 GTGGCAGCAGGCAGCGGCTGAGG - Intronic
1075711507 10:124533314-124533336 GTGAAGGCAGGAAGCCGCTCTGG - Intronic
1075932909 10:126314308-126314330 GGGAGAGCAGAAACCAGCTGGGG + Intronic
1076105956 10:127823932-127823954 GTGACATGAGGAACCTGCTGAGG + Intergenic
1076121406 10:127939813-127939835 GAGACAGGAAGAAGCAGGTGAGG + Intronic
1076121420 10:127939873-127939895 GAGACAGGAGGAAGCAGGTGAGG + Intronic
1076121433 10:127939933-127939955 GAGACAGGAGGAGGCAGGTGAGG + Intronic
1076596928 10:131629214-131629236 GTGAAAGAAGGAAGAAGGTGGGG - Intergenic
1076693145 10:132233889-132233911 CAGCCAGCATGAAGCAGCTGAGG - Intronic
1076841589 10:133048576-133048598 GAGGCAGCAGGAGGAAGCTGTGG + Intergenic
1077154131 11:1083961-1083983 GCCACAGCAGGAAGCAGCAGGGG - Intergenic
1077231771 11:1461017-1461039 GTGACCGAAGGCAGCTGCTGCGG + Exonic
1077324125 11:1956399-1956421 GTCACAGCCCGAACCAGCTGGGG - Exonic
1077536293 11:3126403-3126425 GGGACAGCAGGAAACGGCTGGGG - Intronic
1078079661 11:8194621-8194643 GTGCCATCAGGAAGCAGCTATGG - Intergenic
1079601744 11:22317934-22317956 GTGACGGCAGCCAGCAGCAGTGG + Intergenic
1081581073 11:44352389-44352411 GAGGCAGCAGGAGGCAGCTGGGG + Intergenic
1083299937 11:61735029-61735051 GTGTCAGGAGCAGGCAGCTGAGG + Intronic
1083722803 11:64611761-64611783 TGGAGACCAGGAAGCAGCTGGGG - Intronic
1083723146 11:64613514-64613536 GTGGCACCAGGAGGCTGCTGGGG - Intronic
1083775053 11:64890533-64890555 GGGAGAGTAGGAAGCAGATGGGG + Intergenic
1084509887 11:69596963-69596985 GTCCCTGCAGGAAGAAGCTGAGG + Intergenic
1084554405 11:69867378-69867400 GTGGCAGCAGGAACAAGCAGAGG - Intergenic
1084835703 11:71800589-71800611 GAGACACCAAGAAGAAGCTGCGG + Exonic
1085012051 11:73148045-73148067 GGGACAGCAGGATGCAGAGGTGG + Intergenic
1087277355 11:96173937-96173959 GGGACAGCAGGAAACACTTGTGG + Intronic
1089049645 11:115535079-115535101 GTGAGAATATGAAGCAGCTGAGG - Intergenic
1089340948 11:117757022-117757044 GAGACAGAAGGAAACATCTGTGG + Intronic
1089528381 11:119111375-119111397 GTGAGAGCTGGAAGTGGCTGCGG + Intronic
1090337326 11:125980599-125980621 GTGTCTTCAGGAAGCAGCCGCGG - Intronic
1090582917 11:128179661-128179683 GTGAAACCATGAAGTAGCTGTGG + Intergenic
1091067446 11:132529391-132529413 GCGATAGCAGGAGGCAGATGTGG + Intronic
1202807111 11_KI270721v1_random:11594-11616 GTCACAGCCCGAACCAGCTGGGG - Intergenic
1093135618 12:15446836-15446858 GTGCCAGCAGGGAGCCGTTGAGG + Intronic
1093156943 12:15697364-15697386 GTGACAGCAGGAAGAGGAAGAGG + Intronic
1093159903 12:15734265-15734287 GGAAGAGGAGGAAGCAGCTGAGG - Intronic
1095254978 12:40023982-40024004 ATTATAACAGGAAGCAGCTGTGG - Intronic
1095921158 12:47532687-47532709 GTGAGAGAAGGCACCAGCTGTGG + Intergenic
1096331708 12:50718868-50718890 CTTACTGCAGGTAGCAGCTGGGG + Intronic
1096816736 12:54206426-54206448 GAGACAGCAAGAAGCAGAGGAGG + Intergenic
1097133449 12:56831443-56831465 CTGTCAGCAGGAAGCAGTTACGG - Intergenic
1097363120 12:58680058-58680080 GTGAGAGCAGGCACCAGCCGTGG + Intronic
1097366893 12:58725643-58725665 GTGATAGAAGGAAGCAGTTATGG - Intronic
1098742165 12:74186667-74186689 GTGACATCAAGAAGTAGATGGGG + Intergenic
1100734985 12:97518372-97518394 GAGAGAGCAGGAAGAAACTGTGG - Intergenic
1101302259 12:103495115-103495137 ATGCCAGCAGGGAGCAGATGTGG + Intronic
1101466882 12:104958236-104958258 GCGGGAGCAGGAAGGAGCTGTGG - Intronic
1102268466 12:111508284-111508306 GAAACAGGGGGAAGCAGCTGAGG + Intronic
1103033790 12:117640194-117640216 GTGACAAGAGGAAGCAGATGGGG + Intronic
1103917567 12:124383962-124383984 GTGGCAGCAGGCTGCAGCGGGGG + Intronic
1104076434 12:125393836-125393858 GTCACAGGAGGAAGAAGCTGGGG + Intronic
1104322670 12:127766390-127766412 TTGACAGCAGGATGCAGCATTGG - Intergenic
1104428827 12:128699844-128699866 GTGTCAGCAGGAGGGACCTGGGG + Intronic
1104737183 12:131142966-131142988 GTGACAGGAGCCAGCAGCTGTGG + Intergenic
1105467919 13:20664420-20664442 GTGCCAGCAAGAAGCAATTGTGG + Intronic
1106138200 13:26990270-26990292 GTGGCTGCAGGAAGCTGCGGTGG - Intergenic
1106563876 13:30869226-30869248 GTCTCAGCTGTAAGCAGCTGTGG + Intergenic
1106727168 13:32497822-32497844 GTGAGAGAAGGAAACATCTGTGG - Intronic
1107156427 13:37172400-37172422 GTGACAGCAGCAAACAGCAGTGG + Intergenic
1107419367 13:40232466-40232488 GGGACAGCTGGAAGCAGCAGAGG + Intergenic
1108177423 13:47807410-47807432 GTAACATAAGGAGGCAGCTGTGG - Intergenic
1108960131 13:56216752-56216774 GCCACAGCAGGAAGTGGCTGTGG - Intergenic
1109931292 13:69222000-69222022 GTGACAGCAGCAAACAGTAGTGG - Intergenic
1110987075 13:81984437-81984459 GTGACAGTAGCAAACAGCAGTGG + Intergenic
1111915541 13:94356588-94356610 CTGAAAGGATGAAGCAGCTGTGG + Intronic
1112564930 13:100544982-100545004 GTCACACCAGGAGGCAGCAGGGG - Intronic
1113375375 13:109760564-109760586 GCGACAGCAGAAAGGAGATGCGG - Intronic
1113640281 13:111952454-111952476 GTCCCAGCAGGCAGAAGCTGAGG - Intergenic
1114654599 14:24308539-24308561 GTGACTGCAGCAGGCAGCTCTGG - Exonic
1114820254 14:26009730-26009752 GTAACAGCTGGAAGCAACAGAGG + Intergenic
1115619142 14:35123355-35123377 GTGGCATCAGGAACCAGCAGAGG + Exonic
1115814977 14:37153732-37153754 GTGAGAGCAGGCACCAGCTGTGG - Intronic
1117898131 14:60508689-60508711 GTGGGAGCAGGAAGCCGGTGGGG - Intronic
1118348955 14:64960049-64960071 GTCACAGCAGGAAGAGGATGGGG - Intronic
1118592940 14:67414448-67414470 CAGACAGCAGTAAACAGCTGGGG + Intergenic
1118857464 14:69635204-69635226 GGTAGAGGAGGAAGCAGCTGTGG + Intronic
1119398609 14:74347539-74347561 GAGACAGCACGGAGGAGCTGTGG + Intronic
1119536917 14:75410147-75410169 GTGGGAGTAGGAAGCAGGTGGGG - Intergenic
1120392317 14:83924478-83924500 GTGACAGCAGGAAGCAGCCATGG - Intergenic
1121249591 14:92489680-92489702 GTGAGAACAGGAATCACCTGGGG - Intronic
1121791857 14:96704793-96704815 GTGATCCCAGGAAGCAGGTGAGG - Intergenic
1121908544 14:97768771-97768793 GTGAAAGGAGGAAGGAGGTGTGG + Intergenic
1121971303 14:98358886-98358908 GGCCCAGCAGGAAGCAACTGAGG - Intergenic
1122227694 14:100289358-100289380 GTGCCAGCATGGAGCAGCGGAGG - Intergenic
1122776396 14:104118744-104118766 TGGTCAGCAGGCAGCAGCTGGGG - Intergenic
1122799700 14:104223412-104223434 GAGAAAGGAGGAGGCAGCTGGGG - Intergenic
1123888457 15:24749994-24750016 GTGTCAGCCGGAAGCTGCTTGGG + Intergenic
1126039670 15:44577971-44577993 GTGACAGCAGGCAAGAGCTAAGG + Intronic
1126143247 15:45454628-45454650 GGGACAGCAGCAAGCACCAGTGG - Intergenic
1126200561 15:45980896-45980918 GAGAAAGAAGGAAGCAGTTGAGG + Intergenic
1126205221 15:46037741-46037763 GTGTCTGCAGGGGGCAGCTGAGG + Intergenic
1126882639 15:53115762-53115784 GTGACAGGTGGCAGCAGCTGTGG - Intergenic
1127120310 15:55766227-55766249 GCGACAGAAGGAAGCAGAAGAGG - Intergenic
1127385279 15:58461902-58461924 GGGACAGCACGAGGCAGGTGTGG - Intronic
1128142472 15:65311911-65311933 GTGACACCTGGAAGCAGTTCTGG + Intergenic
1128516122 15:68342909-68342931 GTGAGAGCAGGAAGGAGTTCTGG + Intronic
1129330514 15:74824670-74824692 GTGAGAGCAGGACCCAGATGGGG - Intronic
1129360176 15:75019569-75019591 GTGACATCAGGGAACAGATGAGG - Exonic
1129364021 15:75043434-75043456 GTGACAGCTGGAAGTAGCAGTGG + Exonic
1131248877 15:90818264-90818286 GTGACAGCAGGTGGCCCCTGAGG - Intergenic
1131258455 15:90876364-90876386 GTGGCAGCAGGAGGGGGCTGGGG - Intronic
1131302076 15:91208511-91208533 ATGACAGCAGCAGGCAGCTCTGG + Intronic
1131323624 15:91421512-91421534 GTCACAGCAGAAAGCAGCATGGG - Intergenic
1132067515 15:98744417-98744439 GTGATGGCTGGAAGCAGCTCTGG + Intronic
1132665354 16:1078939-1078961 GTGACAACAGGACGCTGGTGGGG + Exonic
1132742182 16:1420380-1420402 GCGCCACGAGGAAGCAGCTGAGG + Exonic
1132750291 16:1454510-1454532 GTTTCAGCAGAAAGGAGCTGTGG - Intronic
1132937353 16:2487922-2487944 GCAACAGCAGCCAGCAGCTGTGG + Intronic
1133178321 16:4033021-4033043 GTGAGAGCATTTAGCAGCTGGGG - Intronic
1133286291 16:4692355-4692377 GGGACAGCTGCAAGCAGCAGGGG - Intergenic
1133850473 16:9498842-9498864 CTGACACCAAGAAGCAGCTCTGG - Intergenic
1134201707 16:12204799-12204821 GTGAGAGCACGAAGCACATGTGG - Intronic
1134227745 16:12404492-12404514 GGAGAAGCAGGAAGCAGCTGGGG - Intronic
1135020415 16:18958239-18958261 AACACAGCAGGAACCAGCTGTGG - Intergenic
1135334540 16:21589829-21589851 GTGACAGCAGCAGGCATCAGAGG - Intergenic
1136047053 16:27623200-27623222 GAAACAGCAGGAAGGAGCAGGGG + Intronic
1136091788 16:27925898-27925920 GTGACAGCAGACAGCAGCCCAGG + Intronic
1137500804 16:49010550-49010572 GAGAAAGCAGGAAGGAGCGGTGG + Intergenic
1137958088 16:52853110-52853132 GTGACAACAGCCAGCAGCAGTGG + Intergenic
1138181029 16:54940148-54940170 CCGCCAGCAGGAAGCAGCTAAGG - Intergenic
1138277629 16:55747512-55747534 ATTAGAGCAGGAAGAAGCTGGGG - Intergenic
1139377918 16:66512104-66512126 GTGAAAGGAGGATGCTGCTGAGG - Intronic
1141670987 16:85491591-85491613 GTGGCAGCTGGAAGGAGCTTGGG + Intergenic
1141831404 16:86511598-86511620 GTGGCAGCGGGACCCAGCTGGGG + Intronic
1141899578 16:86982367-86982389 GTGACAGCTGCATGCAGGTGGGG + Intergenic
1142003187 16:87675731-87675753 GCTGCAGCAGGAAGCAGGTGTGG + Intronic
1142150317 16:88509801-88509823 GAGACTCCAGCAAGCAGCTGGGG - Intronic
1142249797 16:88986056-88986078 GTGACAGCAGGAGGCGGCTCAGG - Intergenic
1142304020 16:89275529-89275551 GAGACAGCAGGAGGGGGCTGGGG + Intronic
1142391662 16:89805013-89805035 GCGACAGAAGGAAGCAGCTGCGG + Intronic
1142416832 16:89947892-89947914 GTGCCCGCAGGGAGGAGCTGAGG - Intergenic
1143407417 17:6686592-6686614 GTGACAGGAGGCAACAGCTTAGG + Intronic
1143732016 17:8886731-8886753 GTGGAAGCAGGAAGCAGGGGAGG + Intronic
1144041822 17:11418759-11418781 ATGACAGCAGTAGGCAGGTGGGG - Intronic
1144520331 17:15948499-15948521 GTGAGAGCTGGGAGCAGCTTTGG - Intronic
1145273873 17:21418683-21418705 CTGGGAGCAGGAACCAGCTGAGG - Exonic
1146405008 17:32529311-32529333 GCTATAGCAGGAAGCAGGTGAGG + Intronic
1146689056 17:34860605-34860627 GTGACTCCAGGAAGCACCAGAGG + Intergenic
1147717504 17:42518338-42518360 ATGACAGCATGGAGCAGTTGAGG + Intronic
1148205372 17:45776372-45776394 GGGAAAGGAGGAAGCAGGTGAGG - Intergenic
1148793911 17:50188242-50188264 GCCACAGTGGGAAGCAGCTGAGG - Intronic
1149443590 17:56696300-56696322 GTGCCACCAGGAAGCTGGTGAGG - Intergenic
1149598166 17:57876060-57876082 GTGACTGGAGGTAGCAGATGGGG + Intronic
1150235963 17:63592937-63592959 GTGGCAGCAGGAAGAAACAGTGG - Exonic
1151658920 17:75508470-75508492 GTGAGGGCAGGATGCTGCTGCGG + Intronic
1151784595 17:76269280-76269302 GTGACAGAAGACAGCAGATGGGG + Intronic
1151991219 17:77575863-77575885 GGCAGAGCAGGAAGCAGATGTGG - Intergenic
1152226132 17:79093731-79093753 GTGTCTGCTGGAAGCAGCTCTGG + Intronic
1152645556 17:81467028-81467050 GTGAGGGCAGGGAGCAGATGAGG + Intergenic
1152660745 17:81540818-81540840 GTCACAGCAGGATGAGGCTGGGG + Exonic
1152760948 17:82106787-82106809 GGGACAGCAAAAAGCAGCAGGGG + Intronic
1152897892 17:82923770-82923792 CTTCCAGCAGGAAGCTGCTGGGG + Intronic
1153444733 18:5158312-5158334 GGCACAAGAGGAAGCAGCTGAGG + Intronic
1153719505 18:7887511-7887533 TTGACAGCAGGGAACAGATGGGG + Intronic
1154001269 18:10484165-10484187 GAGAAAGCAGGAAGCAGATGAGG + Intronic
1154999165 18:21669922-21669944 GCGACACCAGGAAGCACCCGCGG + Intronic
1155578526 18:27276743-27276765 GTGACAGCAGAAGGCAGATTGGG + Intergenic
1156338569 18:36190152-36190174 GTGAGACCTGGAAGCTGCTGGGG - Intronic
1156472179 18:37384241-37384263 GTGACAGCATTTAGCAGCTCAGG - Intronic
1157549887 18:48574131-48574153 GTGACAGCAGGAAGCCGCCCCGG - Intronic
1158786731 18:60721718-60721740 GTGACTTCAGGATGGAGCTGGGG + Intergenic
1159819534 18:73122559-73122581 GTGGCAGCAGGAAGATCCTGAGG - Intergenic
1160575891 18:79853687-79853709 GTGTCAGCAGCACGTAGCTGTGG + Intergenic
1160659135 19:290418-290440 GTGACAGCAAGAAGTCCCTGTGG - Intronic
1161001575 19:1913594-1913616 GGGAAAGGAGGCAGCAGCTGGGG - Intronic
1161208950 19:3056459-3056481 GAGACAGCAAGAGACAGCTGAGG + Intronic
1161441766 19:4295800-4295822 GCGGCAGCAGGAACCAGCTTTGG + Intronic
1161446714 19:4322866-4322888 GTCTCTGCAGGGAGCAGCTGTGG + Intronic
1161624833 19:5320216-5320238 GACACAGCAGGAAGCAGGGGCGG + Intronic
1161761162 19:6173612-6173634 GTGCCCACAGGAAGAAGCTGCGG - Intronic
1161766022 19:6209403-6209425 TTGTCAGCAGGCAGCAGCTGGGG - Intergenic
1161931739 19:7345187-7345209 GGAACAGAAGGAAGCAGGTGTGG - Intergenic
1161978485 19:7618905-7618927 GTGTGGGCAGGAGGCAGCTGGGG - Intergenic
1162746632 19:12802181-12802203 GTGACAGCTGGGAGCAGCTGAGG + Intronic
1163031287 19:14545832-14545854 GGGACAGCAGGAAGAAGCCAGGG - Intronic
1163495943 19:17646707-17646729 GTGACCCCAGGACGGAGCTGGGG - Intronic
1163501621 19:17679848-17679870 GAGGCTGCAGGAAGGAGCTGAGG - Intronic
1164173172 19:22745527-22745549 GTGACAGCAGCAAACAGCAGTGG - Intergenic
1164576672 19:29409205-29409227 CTGACAACAGTGAGCAGCTGGGG + Intergenic
1164820781 19:31249664-31249686 GTGACAGCAGGTCTCAGCGGAGG - Intergenic
1165089859 19:33379333-33379355 GGGCCAGCAGGCACCAGCTGAGG - Exonic
1165742944 19:38214333-38214355 GTGGCTGCAGGTAGCGGCTGCGG - Intronic
1166090556 19:40506009-40506031 GTGAGAGCTGACAGCAGCTGGGG + Intronic
1166231122 19:41426415-41426437 CTGACAGCAAGAAGCGGCGGAGG + Exonic
1166584990 19:43937770-43937792 GTGACAACTGGAAGCAGAGGGGG - Intergenic
1167650303 19:50725047-50725069 GCGAGAGCAGGAAGCACTTGTGG - Exonic
1167945885 19:52988417-52988439 CTGACAGCAGGCTGCAGCTTGGG - Intergenic
1168638850 19:58017336-58017358 TTGAGAGGACGAAGCAGCTGGGG + Intergenic
925297026 2:2784125-2784147 GTGACAGCAGAAAGCCTCAGAGG - Intergenic
925369576 2:3335040-3335062 CTTACAGCTGGGAGCAGCTGAGG + Intronic
925777255 2:7347522-7347544 GTGACTGCAGGTAGCAGCTAGGG - Intergenic
925905779 2:8539024-8539046 GTCACCCCAGGAAGCACCTGTGG - Intergenic
926393343 2:12416754-12416776 GTGCCAGCAGGGGGCAGCTTGGG + Intergenic
927248398 2:20976659-20976681 AAGACAGCAGGAAAGAGCTGAGG + Intergenic
927275151 2:21256208-21256230 TTGTAACCAGGAAGCAGCTGTGG - Intergenic
927422784 2:22950410-22950432 GAGGCACCAGGAAGCAGATGTGG - Intergenic
927504237 2:23602879-23602901 GTGAGATCAGGAAGCAGGAGAGG + Intronic
927610958 2:24539966-24539988 ATGAGAGTAGGAAGCAGTTGGGG + Intronic
927634131 2:24799603-24799625 GTGGCAACAGGAAGCATCTCAGG - Intronic
928671905 2:33611025-33611047 GCGACAGCAGCAAACAGCAGTGG + Intergenic
930666181 2:54101018-54101040 ATGCCAGCAGTTAGCAGCTGAGG + Intronic
931188683 2:59978627-59978649 GTGAGAGCAGGTAGCACCTGAGG - Intergenic
931771356 2:65500739-65500761 GTGACAGCTGGCTGCAGCAGGGG + Intergenic
932134077 2:69213391-69213413 TTAAAAGCAGGAAGCAGATGTGG - Intronic
932575275 2:72959288-72959310 GTGACAGCACGGAGGAGCAGAGG - Intronic
933832856 2:86224650-86224672 TGGACAGCGGGAAGCAGGTGAGG - Intronic
933918154 2:87017612-87017634 GTGTCACTAAGAAGCAGCTGGGG - Exonic
934004840 2:87752301-87752323 GTGTCACTAAGAAGCAGCTGGGG + Exonic
934526586 2:95055887-95055909 GTGCCAGCAAGAAGCAGCTTTGG - Intergenic
934646209 2:96060604-96060626 GGGGCAGGAGGAGGCAGCTGTGG - Intergenic
935086610 2:99852214-99852236 TTGAAAGCAGGAAGCAGGAGAGG - Intronic
935767797 2:106386334-106386356 GTGTCACTAAGAAGCAGCTGGGG + Intergenic
936789754 2:116137609-116137631 GTGAGAGCAGGCAGCAGTGGGGG + Intergenic
936818019 2:116484420-116484442 GTGGCAGCAGTCAGCAGCAGTGG - Intergenic
937229441 2:120389065-120389087 GGGAGGGCAGGAGGCAGCTGTGG - Intergenic
937505464 2:122531728-122531750 GGGACAGCAGGAGGGAGCCGGGG + Intergenic
937594970 2:123661575-123661597 GTGACGGCGGCAAACAGCTGTGG - Intergenic
937867003 2:126759944-126759966 GTAACAGCAGGATGCATGTGGGG - Intergenic
938066062 2:128282692-128282714 GTGGGAGCAGGAAGGGGCTGGGG - Intronic
940890476 2:159030901-159030923 GTGTCAGGAGGAAGGGGCTGAGG + Intronic
941048331 2:160702009-160702031 GTGAATGCAGGAAACAGCTTTGG - Intergenic
941548826 2:166889117-166889139 GTGCCAGGAGGCAGCTGCTGAGG - Intronic
942030265 2:171952332-171952354 GTGATAGCAGGGAGCAGGGGTGG + Intronic
942244200 2:173992055-173992077 TTGACTGCAGTAAGAAGCTGTGG - Intergenic
944362586 2:198875690-198875712 CAGACAGCAGGAAGAAACTGTGG - Intergenic
944580179 2:201125554-201125576 GGGACAGGAGGGACCAGCTGGGG + Intronic
945284190 2:208065805-208065827 GTGGCTGCAGGAAGAAACTGTGG + Intergenic
945917501 2:215719585-215719607 TTCTGAGCAGGAAGCAGCTGGGG + Intergenic
947009546 2:225550590-225550612 GTGGCAGCTGGAAGGAGATGAGG + Intronic
947792741 2:232877167-232877189 GTGAGAGTAGGAAGCAGGGGCGG - Intronic
948121741 2:235535951-235535973 GGGAGAGCAGGAAGCAGATGGGG - Intronic
948192658 2:236071859-236071881 GTGCCAGCCGCAGGCAGCTGTGG - Intronic
948201061 2:236130122-236130144 GTGAGACCAGCAGGCAGCTGTGG + Exonic
948442582 2:238004834-238004856 ATGGAAGCAGGAAGCAGGTGAGG + Intronic
1169080810 20:2796881-2796903 GAGACATCAGGAGGCAGCAGGGG + Intronic
1169794718 20:9449366-9449388 GTCCAAGCAGGAAGTAGCTGAGG + Intronic
1170416393 20:16147437-16147459 TGGGCAGCAGGAAGCAGATGGGG - Intergenic
1171271988 20:23824745-23824767 TGGACAGGAAGAAGCAGCTGTGG - Intronic
1171309830 20:24137109-24137131 GTCCCCGCATGAAGCAGCTGTGG - Intergenic
1171350814 20:24501878-24501900 GTGTCAGCCAGAAGCAGCTCGGG - Intronic
1171370730 20:24660716-24660738 GTGCCAGCAGGCTGAAGCTGGGG - Intronic
1171386377 20:24771948-24771970 GAGCCAGCAGGAAGGAGCTCCGG + Intergenic
1171990663 20:31694062-31694084 GGGAGGGCAGGCAGCAGCTGGGG + Intronic
1172567293 20:35940628-35940650 CAGTCAGTAGGAAGCAGCTGTGG + Intronic
1172629246 20:36367132-36367154 GTGCCGGCAGGAAGCAGCTTGGG - Exonic
1172889795 20:38255958-38255980 AAGACAGTAGGAAGCAGCTCTGG - Intronic
1173676175 20:44837666-44837688 TTGACAGCAGAAAGCAGCATTGG - Intergenic
1174634912 20:51990649-51990671 GTGACAATAGGAAACATCTGTGG - Intergenic
1175018942 20:55823774-55823796 GGTACATCAGGAAGCAGCAGTGG - Intergenic
1175076965 20:56383559-56383581 GGGACTGGAGGGAGCAGCTGGGG - Intronic
1176210400 20:63917926-63917948 GTCACAGCAACAAGCAACTGAGG - Intronic
1177745193 21:25204271-25204293 GTGGCAGAATGGAGCAGCTGTGG + Intergenic
1180001300 21:44996696-44996718 GTGGCAGGAGGAAGGGGCTGTGG + Intergenic
1180572530 22:16741291-16741313 GTAGCAGGAGGAAGCAACTGAGG - Intergenic
1180735467 22:18013119-18013141 TTGACTGCATGAAGCAGCTCCGG - Intronic
1180800204 22:18628214-18628236 GTGCCAGCAGGAAGCCACAGGGG + Intergenic
1180851437 22:19023778-19023800 GTGCCAGCAGGAAGCCACAGGGG + Intergenic
1181221512 22:21367052-21367074 GTGCCAGCAGGAAGCCACAGGGG - Intergenic
1181248499 22:21517573-21517595 GGGACAGGGGGCAGCAGCTGGGG + Intergenic
1181467384 22:23117506-23117528 GTCCCAGCATGAGGCAGCTGAGG - Intronic
1182744261 22:32593589-32593611 GTCACAGGAGGAAGCAGAGGAGG + Intronic
1182756442 22:32683389-32683411 ATGGCACCAGGAAGGAGCTGAGG - Intronic
1183186742 22:36295807-36295829 GTGACCACAGGAGGCAGCTTTGG - Intronic
1183198187 22:36367767-36367789 ATGAAAGAAGGAAGCAGCAGCGG + Intronic
1183303529 22:37070089-37070111 GTGACACGAGGTAGCAGGTGGGG - Intronic
1183322905 22:37176021-37176043 CTGCCAGCAGGGAGGAGCTGGGG - Intergenic
1183499117 22:38167870-38167892 GAGGCTGAAGGAAGCAGCTGGGG - Intronic
1184557806 22:45242457-45242479 GGCACAGCAGGAAGGAGCCGTGG + Intergenic
1184703212 22:46191660-46191682 GTGACAGCAGGCTGTGGCTGCGG + Intronic
1184711314 22:46250861-46250883 GGAACAGAAGGAAGCAGGTGTGG - Intergenic
1184751339 22:46488161-46488183 GTGACAGCAGGAAGCAGCTGTGG + Intronic
1184807035 22:46801996-46802018 GTGACAGGAGGAAGCAGGTGCGG + Intronic
1184876969 22:47282370-47282392 GAAACAGCAGGGAGTAGCTGTGG + Intergenic
1184930370 22:47676817-47676839 GTGGCTGCTGGAGGCAGCTGGGG + Intergenic
1185017317 22:48352321-48352343 GAAACAGCAGGAAACACCTGTGG + Intergenic
1185032442 22:48451524-48451546 GGGAGCGCAGGAAGCAGATGTGG + Intergenic
1185157038 22:49199300-49199322 GAGAGAACAGGAAGTAGCTGGGG - Intergenic
1185274084 22:49942963-49942985 GGGTCAGCAGAGAGCAGCTGGGG - Intergenic
1185346972 22:50314710-50314732 GAGGCAGCAGGGAGCAGGTGAGG + Intronic
950015025 3:9749417-9749439 AAGACGGCAGGCAGCAGCTGTGG + Intergenic
950107193 3:10395837-10395859 GCAGCAACAGGAAGCAGCTGTGG + Intronic
950427430 3:12931987-12932009 GTGTCATCATGAAGCAGCTCTGG + Intronic
950615507 3:14154920-14154942 GTGACAGAAGGAAGCATTAGAGG - Intronic
950631177 3:14283224-14283246 GTGGCAGCAGGACGAAGCTGTGG + Intergenic
950954346 3:17035557-17035579 GTGGGAACAGGAAGCAGGTGGGG - Intronic
951274437 3:20668533-20668555 GTGACTGCAGTGATCAGCTGGGG + Intergenic
951675417 3:25234888-25234910 GTGACAGCAGCAAGTAGCATGGG - Intronic
952330660 3:32361754-32361776 GTGCTAGTAGGAACCAGCTGTGG - Intronic
952699107 3:36306751-36306773 GTCACAGCAGGCAGCAGGTGAGG + Intergenic
953042220 3:39265694-39265716 GTGACATGAGGAAGGATCTGAGG - Exonic
953516852 3:43601948-43601970 CTGATGGCTGGAAGCAGCTGGGG - Intronic
953629060 3:44596682-44596704 GTGAAGGCAAGATGCAGCTGTGG - Exonic
954385757 3:50242996-50243018 GGAAAAGGAGGAAGCAGCTGGGG + Intronic
954444888 3:50541253-50541275 GAAACAGCAGGAAGCTGATGTGG - Intergenic
954581491 3:51705618-51705640 TTGACAGCAGGAGGGTGCTGAGG - Intergenic
954653408 3:52178885-52178907 GGCAGAGCAGGAAGGAGCTGGGG + Intergenic
954776782 3:53026608-53026630 GTAACTGCAGTGAGCAGCTGTGG - Intronic
956470958 3:69566488-69566510 GAGACAGCTGGAGGAAGCTGTGG - Intergenic
956516322 3:70052400-70052422 ATGATTGCAGGAAGCTGCTGAGG - Intergenic
956924283 3:73966970-73966992 ATGAAAGCAGGAGGGAGCTGTGG - Intergenic
960067202 3:113386931-113386953 GTCACAACAGAAAGCAGCTTTGG + Intronic
961241712 3:125417127-125417149 ATCAAAGCAGGAAGCAGGTGTGG + Intergenic
961450810 3:127001497-127001519 TTCACAGCGGGAAGCCGCTGGGG + Intronic
961736531 3:129005220-129005242 GTGGCAGCAGGCAGGAGGTGGGG + Intronic
962381835 3:134904398-134904420 GTGAAAGCAGGCAGCTGCTAGGG + Intronic
963253360 3:143121105-143121127 GGGGCAGCCGGAGGCAGCTGGGG + Exonic
963977836 3:151502512-151502534 TTAAAAACAGGAAGCAGCTGTGG - Intergenic
964979096 3:162656965-162656987 GAGACAGCAGGAAAGAGCTTTGG - Intergenic
965919974 3:173901252-173901274 GTAACTGCAGGAAGGAGATGAGG + Intronic
966177273 3:177152172-177152194 GTGACAGCTGGGAGCATCTTTGG - Intronic
967104018 3:186241025-186241047 GTGAGAGCAAGAAGATGCTGTGG + Intronic
967768212 3:193305614-193305636 ATCAGAGCAGGAAGCATCTGTGG - Exonic
967893305 3:194378623-194378645 GAGACAACAGGAACCAGCTTCGG + Intergenic
968389504 4:177781-177803 ATGTCAGCAGGAAGCAGTTACGG + Intergenic
968432740 4:568326-568348 GGGACAGCAGGAAGGTGCTGAGG - Intergenic
968473084 4:790761-790783 GTGGCAGTGGGTAGCAGCTGAGG - Intronic
968488136 4:874530-874552 GTGACACCCGAAGGCAGCTGAGG - Intronic
968728089 4:2257461-2257483 GTGACAGCCGGAGGCAGCTAGGG - Intronic
968921745 4:3525766-3525788 GTGAGAGAAGGAAGCAAGTGAGG + Intronic
969529595 4:7723389-7723411 GTGTCATCAGAGAGCAGCTGGGG - Intronic
969548838 4:7850726-7850748 GAGCCTGCAGCAAGCAGCTGGGG - Intronic
969854897 4:9991184-9991206 GGGAAAGCAGAAAGCAGCAGGGG - Intronic
970329562 4:14965533-14965555 CAGCCAGGAGGAAGCAGCTGAGG + Intergenic
972626580 4:40805335-40805357 GTGACAGCAGCAAGGAGACGAGG - Intronic
972743707 4:41912713-41912735 GTGAGAGCAGGAACAAGATGGGG - Intergenic
973883150 4:55294016-55294038 GTGACAGTATGAAGCAGTGGGGG - Intergenic
973891537 4:55372361-55372383 GAGACAGCAGGAAACAGGGGTGG - Exonic
974062924 4:57052007-57052029 GGCACAGCAGAAAGCAGATGAGG + Intronic
977554975 4:98479184-98479206 GTGACTGAAGGAGGCAACTGGGG + Intronic
977662067 4:99600566-99600588 GTGACAGCATCCACCAGCTGAGG - Exonic
980070596 4:128239567-128239589 GTGAAAGAATGAAGAAGCTGTGG + Intergenic
980152632 4:129066914-129066936 GGGACAGAAGGAAACAGGTGAGG + Intronic
981531581 4:145759344-145759366 ATTGCAGCAGGAAGCAGGTGTGG - Intronic
982831833 4:160071858-160071880 GTGACTGGAGGAAGCATTTGAGG + Intergenic
983777794 4:171629886-171629908 GTGACAGCGGCAAACAGCAGTGG - Intergenic
985819107 5:2147898-2147920 GTGACAGCAGGAGGAAGAGGAGG - Intergenic
985950972 5:3221058-3221080 GTGACATCTGGAAGCAGCCAGGG - Intergenic
986295605 5:6435514-6435536 GTGCCAGCAGGAGGCAGCATTGG - Intergenic
987122363 5:14779131-14779153 GTGACAGGAGGGAGGAGGTGAGG - Intronic
987326804 5:16819961-16819983 CTGAGCCCAGGAAGCAGCTGGGG - Intronic
990478805 5:56187547-56187569 GCGACAGCAGCAAACAGCAGTGG - Intronic
993373816 5:87125393-87125415 GTGTCTGAAGAAAGCAGCTGTGG - Intergenic
995032622 5:107496560-107496582 GTGAGAGCAGGAAGGAGGAGAGG - Intronic
995483891 5:112619627-112619649 GCAATAGCAGGAATCAGCTGTGG + Intergenic
995683011 5:114741748-114741770 TGGACAGTAGGAAGCATCTGGGG - Intergenic
995839663 5:116431234-116431256 GTGAGGGGAGGAAGGAGCTGAGG - Intergenic
998997330 5:147879954-147879976 GTGGCAGCAGAAAGGAGGTGGGG + Intronic
999195443 5:149778542-149778564 ATGGCAGCCGCAAGCAGCTGTGG - Intronic
999692099 5:154157258-154157280 GTAATTGCAGGAAGCAGCTGAGG + Intronic
999721422 5:154401731-154401753 GAGACAGCAGGAAGTAGTGGGGG + Intronic
1000588267 5:163126742-163126764 GTGACAGCAGGTAGAGGTTGGGG - Intergenic
1001889521 5:175327545-175327567 GTGGCAACAGGACCCAGCTGTGG + Intergenic
1001964903 5:175903263-175903285 GTCACAACAGCAACCAGCTGTGG + Intergenic
1002090058 5:176799047-176799069 GTGGCACCAGGAAGGAGCGGAGG + Intergenic
1002130458 5:177078394-177078416 GGGACAGCAGAGAGCAGCAGAGG + Intronic
1002252052 5:177935925-177935947 GTCACAACAGCAACCAGCTGTGG - Intergenic
1002644442 5:180646271-180646293 GTGGAGGCAGGTAGCAGCTGGGG - Intronic
1002720897 5:181261040-181261062 GTGACAGGACCGAGCAGCTGGGG - Exonic
1002776596 6:333187-333209 GAGACAGGAGGAGGCAACTGGGG + Intronic
1002912121 6:1498420-1498442 GGGAGAGCAGGATGCAGGTGCGG - Intergenic
1003145986 6:3511181-3511203 GTGGGAGCAGGAAGGAGCAGCGG + Intergenic
1003198180 6:3933223-3933245 GGAACAGCAGGAAGCACATGCGG + Intergenic
1003915861 6:10785746-10785768 GTGACAGCTGCAAGGAGCTCTGG - Intronic
1004189888 6:13454764-13454786 CAGACAGCAGGTGGCAGCTGGGG + Intronic
1005449213 6:25956656-25956678 GGGACAACTGGAAGCAGCGGAGG + Intergenic
1005497386 6:26399961-26399983 TTGACACAAAGAAGCAGCTGAGG - Intergenic
1005521986 6:26609828-26609850 GTGACAGCTGTAAGCAGCAATGG + Intergenic
1006284859 6:33085068-33085090 TGGACAGGAGGAAACAGCTGGGG + Exonic
1006290041 6:33127935-33127957 TGGACAGGAGGAAACAGCTGGGG + Intergenic
1006388459 6:33745312-33745334 GTGACCCCCGGAAGCAGCAGAGG + Intronic
1007133098 6:39495397-39495419 GGGAGAGCAGGATGCTGCTGAGG - Intronic
1007720047 6:43879412-43879434 GAGACGGCGGGAGGCAGCTGCGG + Intergenic
1008582775 6:52921511-52921533 GTGACAGCGGCAAACAGCAGTGG + Intergenic
1009023933 6:57974970-57974992 GCGACAGCAGCAAACAGCAGTGG - Intergenic
1009836569 6:69008755-69008777 AGGACTACAGGAAGCAGCTGTGG - Intronic
1010319810 6:74492733-74492755 ATGACAGCAGAAAACAGTTGTGG + Intergenic
1010631692 6:78206456-78206478 TTTACAGCAGGAAGCACCTTAGG + Intergenic
1012259456 6:97071118-97071140 GTGAGGGCAAGGAGCAGCTGCGG - Intronic
1013246911 6:108295301-108295323 GTGAAAGCAGGAGACACCTGGGG - Intronic
1013367850 6:109448473-109448495 GGGACAGCAAGCAGCAGCTGGGG + Intronic
1014533196 6:122585150-122585172 GTGACAGCATACAGCAGCAGCGG - Intronic
1015119322 6:129684170-129684192 GTGACAGGAGGAAGTAGGAGAGG + Intronic
1015632766 6:135247951-135247973 GCGACAGCAGCAAACAGCAGTGG - Intergenic
1017034126 6:150251777-150251799 ATTACAGCAGGTGGCAGCTGTGG + Intergenic
1017283660 6:152650264-152650286 GTGAATGAAGGAGGCAGCTGAGG - Intergenic
1017858901 6:158376860-158376882 ATGACCACAGGGAGCAGCTGAGG + Intronic
1018075293 6:160207144-160207166 GTGAAAGCAGGAGGGAGTTGGGG - Intronic
1018906848 6:168080545-168080567 GTGACTCCAGGCAGCGGCTGAGG - Intronic
1018952775 6:168389956-168389978 GTTACAGGAGGAAGCAGCGCAGG + Intergenic
1019275892 7:175436-175458 GCTACAGCAGGAAGCAGCGGTGG - Intergenic
1019288665 7:236435-236457 GTGACAGCAGGAGGCAGCTGTGG - Intronic
1019524106 7:1473033-1473055 GGGGCTGCTGGAAGCAGCTGCGG - Intronic
1019541944 7:1555540-1555562 CCGGCAGCAGGAAGCAGCGGGGG + Intronic
1021788978 7:24180800-24180822 GTGACAGCAGCAAAGAGGTGGGG + Intergenic
1022019621 7:26385757-26385779 GAGACCTCAGAAAGCAGCTGGGG - Intergenic
1022905130 7:34848436-34848458 ATCACAGCAGGTAGCAGTTGAGG - Intronic
1023374806 7:39545311-39545333 GAGGCAGAAGGCAGCAGCTGAGG - Intergenic
1023439001 7:40167815-40167837 GCGACAGCAGCAAACAGCAGTGG + Intronic
1023439773 7:40173361-40173383 GCGACAGCAGCAAACAGCAGTGG + Intronic
1023862809 7:44226046-44226068 CAGACAGCAGGGAGCAGGTGGGG - Intronic
1023871771 7:44267090-44267112 GGGACAGAAGGCAGGAGCTGGGG + Intronic
1024015682 7:45312127-45312149 GAGGCAGCAGGCAGCAGCAGTGG + Intergenic
1024543890 7:50501142-50501164 CTGACAGCAGGAAGCTGGAGGGG - Intronic
1025014012 7:55424260-55424282 GAGACGGCAAGAAGCAGCTGTGG - Intronic
1025878429 7:65509313-65509335 GTGGCAGCAGAAAGCCGCGGCGG + Intergenic
1026728813 7:72893714-72893736 GTGACAGCACGTAGTAGGTGTGG + Intronic
1028502790 7:91537743-91537765 GTGGCAGCAGGAACAGGCTGAGG + Intergenic
1029110897 7:98212518-98212540 GTGACAGCAGCATCCAGCGGCGG + Exonic
1029320188 7:99752023-99752045 GGGACAGGAGGGAGCAGCTTGGG - Intergenic
1029693766 7:102199946-102199968 GTGACACAAGGAGGCAGATGTGG - Intronic
1030875236 7:114805699-114805721 GAGACAGCAGGAAGCTACTTTGG - Intergenic
1031754292 7:125618505-125618527 GTGACAGTAGGCACCAGTTGTGG + Intergenic
1032262794 7:130350400-130350422 GAGACAGGAGGATGTAGCTGGGG + Intronic
1033619946 7:143052955-143052977 GGGTCACCAGGAAGGAGCTGAGG - Exonic
1034241916 7:149617381-149617403 GGGACAGCAGGAGGCGGTTGGGG + Intergenic
1034276331 7:149825445-149825467 CTGGGAGCAGGAGGCAGCTGGGG - Intergenic
1034407202 7:150912667-150912689 CTCACAGCAGGAAGCAGCTCAGG + Intergenic
1034879739 7:154753886-154753908 CTGACCCCAGGAAGCAGCTCAGG - Intronic
1034968635 7:155406121-155406143 GCCCCAGCAGGAAGCGGCTGTGG + Intergenic
1035039634 7:155918179-155918201 GTGCCTGCAGGGAGGAGCTGAGG - Intergenic
1035868598 8:3112130-3112152 TTGAAAGGAGGTAGCAGCTGGGG - Intronic
1036202103 8:6778490-6778512 CTGAGAGCCTGAAGCAGCTGAGG + Intergenic
1037542011 8:19881053-19881075 GTGGCATCAGGAGGAAGCTGTGG - Intergenic
1037551853 8:19982108-19982130 GAGGCAGGAGGAAGCACCTGAGG + Intergenic
1037860861 8:22404740-22404762 GGGTCAGCAGGAGGCAGCTCTGG - Exonic
1037889389 8:22615545-22615567 GTGCCAGCAGAAAGCTGCAGAGG + Exonic
1037910351 8:22740527-22740549 CGGAGAGCAGGAAGCTGCTGTGG - Intronic
1038229949 8:25690505-25690527 ATGACCAGAGGAAGCAGCTGCGG + Intergenic
1039600822 8:38835561-38835583 GTTACAGCAGGAGGTCGCTGCGG + Intronic
1039849020 8:41346336-41346358 GAGACAGGAAGAATCAGCTGTGG - Intergenic
1040746202 8:50645054-50645076 GTTACAACTGAAAGCAGCTGAGG - Intronic
1041230222 8:55742936-55742958 GTGACAGAAGTCAGCAGGTGAGG - Intronic
1041664094 8:60425371-60425393 GTGACAGCAGCAAACAGCAGTGG + Intergenic
1043242217 8:77948825-77948847 GTGATTGGAGTAAGCAGCTGTGG - Intergenic
1043350431 8:79353890-79353912 CCGGCAGCAGGAAGGAGCTGGGG - Intergenic
1043747532 8:83894318-83894340 GTGACAGCAGGAATAAATTGTGG + Intergenic
1045664322 8:104468933-104468955 GTGACGGCAGCAAACAGCAGTGG - Intergenic
1046016828 8:108615424-108615446 TGGACAGGAAGAAGCAGCTGAGG + Intronic
1046798607 8:118399389-118399411 CTGTCAGCAGCAAGCAGCTGGGG - Intronic
1046879347 8:119291070-119291092 ATGACAGCAGGCAGCTTCTGTGG + Intergenic
1047334443 8:123922302-123922324 GTGACAGAAGGTAACATCTGTGG + Intronic
1047441635 8:124884125-124884147 GAGACAGCAGGAAGCAGAATTGG + Intergenic
1047560135 8:125978252-125978274 GTGACAAAAGGAAGCAATTGGGG - Intergenic
1047960778 8:130010270-130010292 GTGAGAGCAGGAGGATGCTGAGG - Intronic
1048259365 8:132932690-132932712 GTGTCCACAGAAAGCAGCTGTGG + Intronic
1048428282 8:134342774-134342796 TTTCCACCAGGAAGCAGCTGAGG + Intergenic
1048491926 8:134902007-134902029 GCCACAGAAGGAAGCAACTGGGG - Intergenic
1049101337 8:140580986-140581008 CTGACACCAGAAAGAAGCTGAGG - Intronic
1050411647 9:5372589-5372611 GTGGCAGGAGGCAGTAGCTGTGG - Intronic
1051800847 9:20932027-20932049 ATGACAGAAGCAAGAAGCTGTGG - Intronic
1051842454 9:21413937-21413959 CTGACAGCAGAAAGCAGCACAGG - Intronic
1052390674 9:27875669-27875691 GTCACAGGAGGAAGCATTTGGGG + Intergenic
1052999624 9:34570815-34570837 GTATCAGCCTGAAGCAGCTGCGG + Intronic
1055431342 9:76247217-76247239 GTGACAGCGGCAAACAGCAGTGG + Intronic
1055818811 9:80238136-80238158 TAGACAGCAGGCAGCAGCAGTGG - Intergenic
1055829147 9:80359477-80359499 CTGGCAGCAGGGAGCAGCCGGGG + Intergenic
1056705013 9:88944276-88944298 GTGACTGCAGCAAACAGCAGTGG + Intergenic
1058787782 9:108407196-108407218 GCGACAGCTGGAACCAGCTGAGG - Intergenic
1059504717 9:114788008-114788030 GTGAGAGCACCAAGCAGCTTTGG - Exonic
1059505886 9:114799612-114799634 CTGACAGCAGCAACAAGCTGGGG - Intronic
1059522653 9:114958045-114958067 GTGAAAGCAGGAGGCGCCTGTGG - Intergenic
1061149556 9:128821091-128821113 GTGACAGCAGGGAGAAGCGGGGG - Exonic
1061352243 9:130074570-130074592 GAGACAGCATCAAGCAGGTGGGG + Intronic
1061593562 9:131614204-131614226 GAGAGAGCAGGGAGCATCTGTGG - Intronic
1062503687 9:136862141-136862163 TTGACAGCAGGAATGGGCTGGGG + Exonic
1187830819 X:23379585-23379607 GTGACAGCAGCATGCAACTGTGG - Exonic
1188619670 X:32204780-32204802 GGGAGAGCAGGAAACAGGTGGGG + Intronic
1189289420 X:39874742-39874764 GCCACAGCTGGAAGCAGCAGAGG + Intergenic
1189413186 X:40791667-40791689 CTGTCAGCAGGAAGTAGCTAAGG - Intergenic
1189927544 X:45972489-45972511 GTGACAGAAGCAAGCAGATGAGG + Intergenic
1190888738 X:54551305-54551327 TTGACTGGATGAAGCAGCTGAGG + Intronic
1190924894 X:54894333-54894355 GTGGCAGCAGCCAGCAGCAGTGG - Intergenic
1190974922 X:55389654-55389676 GTGACAGTAGGCACCAGCTGTGG - Intergenic
1191055299 X:56233834-56233856 GTGAGGCCTGGAAGCAGCTGCGG + Intronic
1192691911 X:73373472-73373494 GCCCCAGCGGGAAGCAGCTGGGG + Intergenic
1193694104 X:84685876-84685898 GTGGCTGCAGGAAGCAATTGTGG - Intergenic
1195160281 X:102163959-102163981 GTGACAGCAGGATGCAGCCAAGG + Intergenic
1196025312 X:111035531-111035553 GTGCCAGCAGGCAGAGGCTGTGG + Intronic
1196240199 X:113334963-113334985 GTGATGTCAGGAAGCAGATGTGG - Intergenic
1197114570 X:122817695-122817717 TGGACAACTGGAAGCAGCTGTGG + Intergenic
1197366778 X:125573105-125573127 GTGCAAGCCGGAAGCAGCTAAGG - Intergenic
1197704300 X:129622908-129622930 GAGGAAGCCGGAAGCAGCTGGGG - Intergenic
1197923978 X:131627211-131627233 GGGGCAGCAAGAAACAGCTGGGG - Intergenic
1199929592 X:152505081-152505103 TAGACACCATGAAGCAGCTGGGG + Intergenic
1200988997 Y:9332328-9332350 GTGACAACAAGAAGCAACTTTGG - Intergenic