ID: 1184751384

View in Genome Browser
Species Human (GRCh38)
Location 22:46488373-46488395
Sequence TAGGCGAGCAGGGAAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184751384_1184751390 -1 Left 1184751384 22:46488373-46488395 CCCGCAGCTTCCCTGCTCGCCTA 0: 1
1: 0
2: 1
3: 21
4: 194
Right 1184751390 22:46488395-46488417 ACAGCCGGCGAGTGCAGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184751384_1184751391 2 Left 1184751384 22:46488373-46488395 CCCGCAGCTTCCCTGCTCGCCTA 0: 1
1: 0
2: 1
3: 21
4: 194
Right 1184751391 22:46488398-46488420 GCCGGCGAGTGCAGCACAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184751384 Original CRISPR TAGGCGAGCAGGGAAGCTGC GGG (reversed) Intronic
900158051 1:1211475-1211497 TGGGCGAGCAGGGCAGGTGCAGG - Exonic
900458140 1:2787221-2787243 TACGCATGCAGGGAAACTGCCGG + Intronic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
902812498 1:18896554-18896576 TAGGTGAGCAGAGAAAGTGCAGG + Intronic
903209951 1:21812343-21812365 CAGGCCAGCAGGGAGGCTGGTGG - Exonic
904237960 1:29125972-29125994 CAGGTGCACAGGGAAGCTGCTGG - Intergenic
905462337 1:38129885-38129907 TGGGTGAGCATGGAAGATGCTGG + Intergenic
906637819 1:47421384-47421406 TAGGGAAGCAGGGAAGGTGGTGG + Intergenic
906650529 1:47509312-47509334 TCAGCGGGCAGGGAAGCTGCAGG - Intergenic
909491292 1:76229398-76229420 TATGGGTGCAGGGAAGCTGTAGG - Intronic
910269350 1:85376759-85376781 TATTTCAGCAGGGAAGCTGCAGG - Intronic
913185024 1:116363055-116363077 TAGGGATGCAGGGAAGCTGGAGG - Intergenic
913292018 1:117282742-117282764 GAGGAGAGTAGGGGAGCTGCAGG - Intergenic
919820052 1:201466965-201466987 TAGGAGAGCAAGGGAGCTGAAGG - Intronic
922154626 1:223031390-223031412 TTTGGGAGCTGGGAAGCTGCAGG + Intergenic
922154640 1:223031469-223031491 TTTGGGAGCTGGGAAGCTGCAGG + Intergenic
922603669 1:226875293-226875315 AAGGTGAGCAGGGAAGCTGTGGG + Intronic
922726673 1:227926030-227926052 CAGGAGTGCTGGGAAGCTGCAGG - Intronic
924954632 1:248914643-248914665 AAGGGGCACAGGGAAGCTGCAGG + Intronic
1062792377 10:316667-316689 GAGGTGAGCAGGAAAGCCGCTGG - Intronic
1063454051 10:6170747-6170769 GAGCAGAGCAGGAAAGCTGCTGG + Intronic
1065249326 10:23794976-23794998 TAGGAGAGCTGGGAAGCCCCAGG + Intronic
1065323803 10:24533067-24533089 CAGGCAAGCAGTGAAGATGCTGG + Exonic
1066307176 10:34156746-34156768 GAGAAGAGCATGGAAGCTGCAGG - Intronic
1067059342 10:43069944-43069966 AAGGAGAGCAGAGAAGCAGCCGG - Intergenic
1067848945 10:49743091-49743113 TTGGAGGGCAGGGATGCTGCAGG + Intronic
1069740043 10:70681675-70681697 TGGGCGCCCTGGGAAGCTGCGGG + Intronic
1070812779 10:79306645-79306667 TAGGAGGGCAGGAAAGTTGCAGG - Intronic
1071544850 10:86521546-86521568 GAGGCGGGGAGGGAAGTTGCGGG - Exonic
1072059517 10:91796479-91796501 GAGGTGAGCAGAGAAGGTGCAGG - Intergenic
1073216861 10:101841212-101841234 CAGGCTTGCAGGGAAGCAGCTGG - Intronic
1074670138 10:115780703-115780725 TGGGCCAGAAGGGAATCTGCTGG + Intronic
1076214001 10:128678471-128678493 TAGGCAGGGAGGGAGGCTGCAGG + Intergenic
1076999503 11:315696-315718 CAGGGGAGCAGGGAAGATGCCGG - Intergenic
1080831081 11:35893963-35893985 TAGGGGAGCAGGGAGGCAGCTGG - Intergenic
1081761290 11:45577929-45577951 TGGGGTATCAGGGAAGCTGCAGG - Intergenic
1083424533 11:62576229-62576251 TGGGCTAGCAGGGAACCTGGAGG + Exonic
1084850920 11:71939415-71939437 TAGGGGTGGAGGGAAGTTGCGGG - Intronic
1088442475 11:109886883-109886905 TAGAAGAGCAGGGAAGCTACTGG + Intergenic
1088704544 11:112450022-112450044 TGGTCGAGCAGGGAACTTGCTGG + Intergenic
1088847781 11:113682314-113682336 GTGGCAACCAGGGAAGCTGCAGG + Intergenic
1089010037 11:115124660-115124682 TAGGCGCCAAAGGAAGCTGCTGG - Intergenic
1091493124 12:949888-949910 AGGGCGCGCAGGGAAGCGGCAGG - Intronic
1091545719 12:1500271-1500293 TAGACGAGCAGGGCAGGTCCAGG + Intergenic
1091736397 12:2925495-2925517 TAGGGGAGCAGGGAAGTAGCTGG + Intronic
1092934782 12:13350652-13350674 TAGCAGAGCAGAGAAGCTGACGG + Intergenic
1094222872 12:28013099-28013121 TGGGTAAGCAGGGAAGCTGTTGG + Intergenic
1100600428 12:96107852-96107874 TGGGCTAGCAGGGAAGATGAAGG + Intergenic
1101970804 12:109310455-109310477 TACGCGAGCTGGGGAGGTGCGGG - Intergenic
1107824300 13:44313634-44313656 TGGAGGAGCAGGGAAGCTTCTGG + Intergenic
1112173186 13:96994465-96994487 TGGGCGAGGCGGGATGCTGCTGG - Intronic
1114936058 14:27538477-27538499 TAGGCTAGCAGGGAGGGAGCTGG - Intergenic
1117342848 14:54806632-54806654 AAGGGGCGCAGGGAAGGTGCGGG - Intergenic
1119708978 14:76807576-76807598 GAGGCCAGGTGGGAAGCTGCTGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1119995436 14:79248484-79248506 TGGGGGAGCAGGAAAGCTGGGGG - Intronic
1120734170 14:88034829-88034851 CAGGTGAGCAGGGAAGCAACAGG + Intergenic
1122289821 14:100674563-100674585 CAGGGGAGCTGGGAGGCTGCTGG + Intergenic
1124400461 15:29343486-29343508 TAGGGCAGCAGGGAGGCTGGAGG - Intronic
1126662672 15:51048036-51048058 GAGTGGAGCAGGGAAGCTGGAGG + Intergenic
1127952679 15:63824936-63824958 TAGGAGAGTAGGGGAGATGCAGG + Intronic
1129676121 15:77633080-77633102 TAAGCGTGCAGGGCAGCGGCTGG - Intronic
1130896529 15:88174432-88174454 GAGGCCAGGAGGGAAGATGCTGG - Intronic
1133451011 16:5904063-5904085 CAGGGGAGCAGGGAACATGCTGG - Intergenic
1134037564 16:11042413-11042435 GAGGACAGGAGGGAAGCTGCTGG + Intronic
1140939465 16:79708012-79708034 GAGGTGCTCAGGGAAGCTGCTGG - Intergenic
1141894915 16:86953225-86953247 TAGGGGAGCTGCCAAGCTGCAGG - Intergenic
1142688855 17:1592850-1592872 TTGGGGAGCAGGGGAGCAGCGGG + Intronic
1145092878 17:20000421-20000443 CAAGGGAGCAGGGGAGCTGCTGG + Intergenic
1146165470 17:30584967-30584989 CAAGGGAGCAGGGGAGCTGCTGG + Intergenic
1146270244 17:31480343-31480365 GAGGCAAGCAGGGAGGCAGCAGG + Intronic
1147584710 17:41647663-41647685 GGGGCCACCAGGGAAGCTGCAGG + Intergenic
1147653872 17:42077675-42077697 GGGCCGAGCAGGGAAGCTGCTGG - Intergenic
1148054862 17:44787876-44787898 GAGGCGAGCAGGGAAGGGGCAGG - Intergenic
1148542293 17:48490390-48490412 TAGACTAGCAGGGAGGCTGCTGG + Intergenic
1148633887 17:49132677-49132699 TCGGCGAGTAGGGCAGGTGCAGG - Intronic
1148966117 17:51437606-51437628 GAGGCGAGCAGGGGAGTGGCGGG - Intergenic
1149302636 17:55318921-55318943 AAAGCGAGCAGGGGAGCTGGAGG - Intronic
1149431847 17:56600474-56600496 GAGGCCTGAAGGGAAGCTGCAGG + Intergenic
1152215301 17:79028340-79028362 CTGGGGAGCAGGGAAGCTGCTGG + Intronic
1152367456 17:79864837-79864859 CAGGCTAGCAGGGAAGGTGCAGG - Intergenic
1153285208 18:3450145-3450167 GAGGCGAGGAGGGAAGGTACAGG - Intronic
1153306402 18:3635556-3635578 CTGGGGACCAGGGAAGCTGCTGG + Intronic
1154356808 18:13627808-13627830 AAGGCCAGCAGAGAGGCTGCTGG - Intronic
1157618309 18:49001039-49001061 TGGGAGAGCAGGGAAGGTGGAGG + Intergenic
1158693676 18:59683942-59683964 TAGGACAGCAGGGTAGCAGCTGG + Intronic
1158904177 18:61995773-61995795 CAGGCCAGCTGGGAGGCTGCTGG + Intergenic
1159861196 18:73651543-73651565 ATGGAGAGCAGGGCAGCTGCCGG + Intergenic
1160348080 18:78151444-78151466 TAGACAAGCAGGGGAGCTGCTGG + Intergenic
1162621467 19:11847678-11847700 GAGGAGAGCAGGGACTCTGCTGG + Intergenic
1162625250 19:11879948-11879970 GAGGAGAGCAGGGACTCTGCTGG + Intronic
1162630488 19:11923714-11923736 GAGGAGAGCAGGGACTCTGCTGG + Intergenic
1162794817 19:13081595-13081617 CAGGAGAGGAGGGGAGCTGCCGG - Intronic
1163438756 19:17310877-17310899 TAGGAGACCAGGGAAGAAGCTGG - Intronic
1165061986 19:33209288-33209310 CAGGTGAGCCGGGCAGCTGCAGG - Exonic
1166357661 19:42236582-42236604 TAGGCCAGCAGGTGGGCTGCTGG - Intronic
1166391714 19:42412262-42412284 TAGGGGAACAGGCAAGGTGCTGG - Intronic
1166749785 19:45159297-45159319 CGGGGGAGCAGGGAAGGTGCAGG + Intronic
1168525876 19:57088507-57088529 TAGGCGAGCAGGTGAGCAGGAGG + Intergenic
924999287 2:392331-392353 TAGGCCAGCAGGGAAGCTCTTGG + Intergenic
932261232 2:70329375-70329397 CAGGTGAGCTGGGAAGCAGCAGG + Intergenic
932795505 2:74692021-74692043 TGGGCCAGGAGGGAAGCTGGTGG + Intergenic
935420667 2:102865817-102865839 TAGGCCCACAGGGTAGCTGCAGG + Intergenic
935755895 2:106276008-106276030 TAGCCGGGCAGGGCAGCTCCCGG + Intergenic
936283010 2:111159166-111159188 TGTGCGAGGAGGGAAGGTGCTGG + Intronic
937103925 2:119293103-119293125 TAGGCCAGCAGGGATGTTTCTGG - Intergenic
937933530 2:127223788-127223810 CAGGAGAGCGGGGGAGCTGCAGG - Intergenic
938500087 2:131827777-131827799 TACGCGAGCTGGCAAGCCGCTGG - Intergenic
942423920 2:175838957-175838979 TAGGTGAGCAGGGCAGCAGTTGG + Intergenic
943476804 2:188367287-188367309 TAGGGGAGCAGGCCAGGTGCTGG + Intronic
944497199 2:200319051-200319073 AAGACCAACAGGGAAGCTGCAGG - Intronic
945042743 2:205755645-205755667 TTGGGGAGAAGGGAAGCAGCTGG + Intronic
946942280 2:224782220-224782242 TGGGGGAGGAGGGAAGGTGCAGG - Intronic
947848151 2:233262385-233262407 TAGGCGTGAAGGGAAGCTGCTGG - Intronic
948423222 2:237873120-237873142 GAGGGGAGCAGGGAGGCTTCAGG + Intronic
948793463 2:240390834-240390856 TGGGACAGCAGGGGAGCTGCTGG - Intergenic
1168924539 20:1568341-1568363 TAGGCTGGCAGGCAAACTGCAGG - Intronic
1169066753 20:2698210-2698232 CAGGTGAGCAGGGCAGCTGCTGG + Intronic
1169126130 20:3128231-3128253 TAGTTGGGCAGGGAAGCTGGGGG - Intronic
1169198702 20:3697255-3697277 AACGTGAGCCGGGAAGCTGCTGG - Exonic
1170600670 20:17839056-17839078 TGGGAGAGCAGAGAGGCTGCAGG - Intergenic
1172119250 20:32588162-32588184 GAGGAGAGGAGGGCAGCTGCAGG + Intronic
1172135761 20:32685611-32685633 AAGGCGAGCTGGAGAGCTGCTGG + Intergenic
1173024898 20:39298764-39298786 CAGGCCAGCTGGGCAGCTGCAGG - Intergenic
1175259303 20:57664576-57664598 GAGGAGCGCAGGGAGGCTGCTGG + Intronic
1175458635 20:59134187-59134209 GAGGGGAGCAGGGGATCTGCTGG - Intergenic
1175734692 20:61377010-61377032 TAGGCAAGCTGGAAAGCTGTAGG + Intronic
1175922706 20:62457528-62457550 GAGGATAGCAGGGAAGCTGAGGG - Intergenic
1180007512 21:45029687-45029709 CAGAAGAGCAGGGAAGCTCCAGG - Intergenic
1183059393 22:35326921-35326943 AAGGCGGGGAGGGACGCTGCAGG - Intronic
1183360414 22:37380266-37380288 GAGGTCAGCAGGGAAGATGCAGG + Intronic
1184729869 22:46366207-46366229 GAGGCGGGGAGGGAAGGTGCGGG + Intronic
1184751384 22:46488373-46488395 TAGGCGAGCAGGGAAGCTGCGGG - Intronic
1184859880 22:47167422-47167444 TATGGGAGCAAAGAAGCTGCTGG - Intronic
950703353 3:14765665-14765687 TAGGTGAGCAGAGCAGGTGCAGG + Intronic
950893918 3:16430943-16430965 TAAGCCAGCAGTGAAGCTGGGGG - Intronic
955810713 3:62785579-62785601 TATGGGAGCAGGGAAGCTGATGG - Intronic
956692543 3:71891330-71891352 TAGGCAAAAAGGGAAGGTGCTGG + Intergenic
956888068 3:73580453-73580475 CAGAAGAGCAGGGAAGATGCTGG - Intronic
961002472 3:123383326-123383348 GAGGCGAGGAGGGCAGCTGTGGG - Intronic
962329467 3:134464746-134464768 TTGGCAAGAAGAGAAGCTGCAGG - Intergenic
965708152 3:171530396-171530418 TCTGCAAGCAGGGAAGCTGGTGG + Intergenic
967973877 3:195020054-195020076 CAGGAGGGCAGGGAAGCTGACGG - Intergenic
968573424 4:1354109-1354131 CAGCCGGGCTGGGAAGCTGCTGG + Intronic
971741609 4:30528485-30528507 GAGGAGAGCAGGCACGCTGCTGG - Intergenic
974817201 4:67020712-67020734 TATGAGATCAGGGAAGCTTCTGG - Intergenic
975994946 4:80302985-80303007 AAGTCGAGCACAGAAGCTGCTGG - Intronic
976139520 4:81976392-81976414 TAGGTGAGCAGGGGGGTTGCAGG + Intronic
976499708 4:85773570-85773592 CAGGAGAGCATGGAAGCAGCAGG - Intronic
978431779 4:108640350-108640372 GAGGAGAGCAGGGAAGGTGGTGG - Intergenic
981080455 4:140634731-140634753 TTGGTGAGCAGGGAAGCAGGGGG - Intronic
986290679 5:6396772-6396794 TAGGAGAACAGGGAGGCTGAGGG + Intergenic
989141365 5:38204700-38204722 TAGGAGAGCAAGGCAGCTGGTGG + Intergenic
992098978 5:73388267-73388289 TGGGGGTGCTGGGAAGCTGCTGG - Intergenic
993338061 5:86686403-86686425 TTGGAGAGCAGGGAAGATCCAGG + Intergenic
993678596 5:90847689-90847711 AAGTCGAGCACGGCAGCTGCTGG + Intronic
994718096 5:103347801-103347823 TCGGGGAACAGGGAAGCTGTGGG + Intergenic
996749660 5:126875748-126875770 TGGGGGAGCAGGGAAGCCGCAGG + Intronic
997528962 5:134570602-134570624 GAGGTGGGCAGGGAGGCTGCAGG - Intronic
1001703960 5:173728545-173728567 TATGCGAGAATGGGAGCTGCAGG - Intergenic
1001739597 5:174041189-174041211 GAGGCCAGGAGAGAAGCTGCAGG - Intergenic
1002591791 5:180295642-180295664 TAGGGGAGAAGGGAAGATGTGGG - Intergenic
1003178486 6:3771782-3771804 TAGTCGAGCACAGCAGCTGCTGG - Intergenic
1004553557 6:16673452-16673474 AAGGTGAGGAGGTAAGCTGCAGG - Intronic
1004703593 6:18102052-18102074 TGTGCCAGCAGGAAAGCTGCAGG + Intergenic
1004923662 6:20399913-20399935 AACAAGAGCAGGGAAGCTGCTGG + Intergenic
1006502463 6:34467207-34467229 TGGGGTATCAGGGAAGCTGCTGG - Intronic
1008308688 6:49937608-49937630 TAGGGGAGCAGGGAAGGTTGGGG - Intergenic
1008781097 6:55106353-55106375 TAGGTTGGCAGGGAAGTTGCTGG - Intergenic
1010044097 6:71420533-71420555 CAGGCGAGCGGCGAAGCGGCTGG - Intergenic
1012196230 6:96344366-96344388 AAGGAGAGCAAGGAAGCTGGTGG + Intergenic
1013247292 6:108298915-108298937 AAGGAGAGCAGGGCAGCTGAGGG + Intronic
1016753686 6:147660395-147660417 TAGGGAAGCAGGGTGGCTGCAGG - Intronic
1017646665 6:156545524-156545546 TCACCGAGCAGGGAAGATGCCGG + Intergenic
1018652208 6:166002078-166002100 TAGGGGAGAAGGGAAACTGCTGG - Intergenic
1019329551 7:455780-455802 TAGGCGAGTCGGGGAGCTGGCGG - Intergenic
1019705016 7:2493469-2493491 TGGGAGAGCAGGGGGGCTGCAGG + Intergenic
1020081429 7:5287991-5288013 TAGGCGTGCGGGCAAGGTGCGGG + Intronic
1021929201 7:25562674-25562696 TAGCCAGGCAGGGAAGCTGTGGG - Intergenic
1022785578 7:33634137-33634159 TGGGAGAGCAGGGAGTCTGCAGG - Intergenic
1022972437 7:35530263-35530285 CAGGCAAGCAGGGGTGCTGCGGG + Intergenic
1023983059 7:45080770-45080792 TGGGGGAGCAGGGAAGTGGCTGG + Intronic
1031530209 7:122866824-122866846 TAGGTGTGCTGGGAAGCTGTTGG - Intronic
1033275795 7:139970923-139970945 TAGGGGAGTAGGGAAGCTAAGGG - Intronic
1033599176 7:142876699-142876721 GAGGGGAGCTGGGATGCTGCAGG - Intronic
1036990228 8:13584224-13584246 GAGCCAAACAGGGAAGCTGCAGG - Intergenic
1037587605 8:20288716-20288738 TAGAGGAGCAGGGAAGCTGTGGG - Intronic
1039593499 8:38770177-38770199 TAGCTCAGCAGGGAAGCCGCGGG - Intronic
1039880842 8:41624583-41624605 TAGGCTGGAAGGGCAGCTGCAGG + Exonic
1041165446 8:55087993-55088015 TGGGGAAGCAGGGAAGCAGCAGG + Intergenic
1041874073 8:62667637-62667659 GTGGCGAGCATGGAAGCTGGAGG - Intronic
1049349244 8:142155166-142155188 CAGGCGAGAAGGGAAGGTGAGGG - Intergenic
1049582676 8:143420026-143420048 GAGGGGAGCAGGGAAGGAGCAGG - Intronic
1049689616 8:143952898-143952920 CAGGCGGGAAGGGAAGCCGCAGG + Intronic
1049735062 8:144200428-144200450 TAGGCGGTCAGGCGAGCTGCAGG - Exonic
1051158662 9:14180847-14180869 TAGGCAAGCAAAGAGGCTGCTGG - Intronic
1051707969 9:19900421-19900443 TAGGCGAGTAGGGAAGAGGGAGG - Intergenic
1052993523 9:34536896-34536918 TAGGTGGGCAGGGAAGCGACAGG - Intergenic
1055922304 9:81473767-81473789 TAGTTGACCAGGGAATCTGCAGG - Intergenic
1056647468 9:88426506-88426528 TAAGTGAGCAGCGGAGCTGCTGG - Exonic
1056779529 9:89538902-89538924 TGAGCGAGCGGGGAAGGTGCAGG + Intergenic
1059859879 9:118447936-118447958 AAGGCAAGAAGGGAAGCAGCAGG - Intergenic
1061573267 9:131490672-131490694 CAGGAGAACAGGGTAGCTGCAGG - Intronic
1061726069 9:132582681-132582703 AAGGCGGGCAGGGAGCCTGCGGG - Exonic
1185761117 X:2690775-2690797 TTCCCGAGCAGGGGAGCTGCTGG + Intergenic
1187662099 X:21560045-21560067 TGGGCAAGGAGGGAAGCTGCAGG + Intronic
1189255703 X:39637296-39637318 CAGCCAAGCAAGGAAGCTGCGGG + Intergenic
1190879634 X:54483319-54483341 TAGGGGAGCAGGGAAGGGGCTGG + Intronic
1191085552 X:56563835-56563857 CAGGCGGGCAGGGAAGGCGCGGG - Exonic
1192237570 X:69305808-69305830 TGTGCGGGCAGGAAAGCTGCTGG - Intergenic
1196857814 X:120000207-120000229 GAGGCGACCAGGGCAGCAGCCGG - Intergenic
1197698565 X:129577590-129577612 TAGACCAGCAGGCAGGCTGCTGG + Intronic
1198202596 X:134436807-134436829 TCTGCGAGCAGGGAAGCAGGTGG - Intergenic
1198862870 X:141089297-141089319 TGGGCCAGAAGGGAACCTGCTGG + Intergenic
1198899823 X:141498092-141498114 TGGGCCAGAAGGGAACCTGCTGG - Intergenic
1199829784 X:151538156-151538178 GAGGGGAGCTGGGGAGCTGCCGG + Intergenic
1200246159 X:154527131-154527153 GAGGCGAGCAGTGAAGCTCTAGG + Intergenic