ID: 1184751520

View in Genome Browser
Species Human (GRCh38)
Location 22:46489062-46489084
Sequence CTGGGTGACCAGCAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 389}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184751520 Original CRISPR CTGGGTGACCAGCAGGAAGG TGG (reversed) Intronic
900180669 1:1309648-1309670 CAGGGTGACCGTCAGGAGGGTGG - Intronic
900310033 1:2029189-2029211 CATGGCGACCAGCAGGACGGAGG - Exonic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900552825 1:3265081-3265103 AGGGGAGACCAGCAGGGAGGCGG + Intronic
900780953 1:4616925-4616947 CTGGGTGAGCAGCAAGTTGGAGG - Intergenic
901016665 1:6235834-6235856 CGAGGCGCCCAGCAGGAAGGTGG + Exonic
901089637 1:6632745-6632767 CTGCATCACCAGCAGGAAGGCGG - Intronic
902476528 1:16691458-16691480 CTGGGTTACTAGGAGAAAGGAGG - Intergenic
902608007 1:17580021-17580043 TGGGTTGACCAGCAGGCAGGAGG - Intronic
902840870 1:19073062-19073084 CTCGGAGACCAGCAGAAAGTGGG + Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903012601 1:20342318-20342340 GTGGGGGAGCAGAAGGAAGGAGG + Intronic
903360000 1:22771114-22771136 CTGGGTGATCAGGAGTAAGGTGG + Intronic
904034176 1:27550194-27550216 CTGGGTGTCCAGCAGCGGGGCGG + Exonic
904086667 1:27914285-27914307 GGGGGTCACCCGCAGGAAGGCGG - Intronic
904585431 1:31577206-31577228 CTGGGTGCCCAGCAGGGTCGTGG + Exonic
904855069 1:33491567-33491589 ATGGATGAGCAGGAGGAAGGGGG + Exonic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905746982 1:40426492-40426514 CTGGTTGACCAGCTGGAAATTGG + Intergenic
905910212 1:41648283-41648305 CTCAGTGCCCAGCAGGTAGGAGG - Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906147901 1:43570701-43570723 CTTGGTGCCCAGCAGGAGGAGGG + Intronic
907300127 1:53481841-53481863 GTAGGAGACCAGCAGGCAGGAGG - Intergenic
908268020 1:62397344-62397366 CTTGGGGGCCAGGAGGAAGGAGG + Intergenic
909736005 1:78962494-78962516 CTGGGTCGGCAGGAGGAAGGGGG - Intronic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
910721429 1:90290569-90290591 CGGGGAGAGCAGCAGGGAGGAGG + Intergenic
912438596 1:109680575-109680597 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912441117 1:109699020-109699042 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
913195040 1:116449234-116449256 CTGGGGTACCTGCAGGAAGTGGG - Intergenic
914346945 1:146808073-146808095 CTGGGTGTCCAGCAGGGAGTTGG - Intergenic
915090288 1:153419457-153419479 CTGGGTGACCCACTGGATGGGGG - Exonic
915095205 1:153457634-153457656 CTGGGTGACCCACTGGATGGGGG + Intergenic
915347921 1:155207471-155207493 CTGGGAGAGCAGCCTGAAGGTGG - Intronic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915519560 1:156433869-156433891 CTGGGGGAGAAGCAGGCAGGAGG - Intergenic
915901916 1:159853795-159853817 CTGGGTGAAGTGCAGGAAGGAGG - Intronic
917501580 1:175590648-175590670 GTGGGTGGCCAGCAGTGAGGAGG + Intronic
917959619 1:180131994-180132016 TTGGGGGACCAGCAGCAAAGTGG + Intergenic
919991498 1:202710665-202710687 CTGCTTCCCCAGCAGGAAGGCGG + Intergenic
920365757 1:205447631-205447653 CTGAGTGACAAGCAGGACGGGGG + Intronic
920604179 1:207364062-207364084 GTGGGTGACCAGAAAGTAGGGGG - Intergenic
920917799 1:210272421-210272443 CTGGGTGTCAAACAAGAAGGAGG - Intergenic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921266604 1:213425875-213425897 GATGGTGACCAGCGGGAAGGTGG + Intergenic
921498818 1:215875022-215875044 CTAGCTGACCAGCAGGAACAAGG + Intronic
922100968 1:222476593-222476615 CTGGGAGACAAGCAGGAATCTGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922729494 1:227942341-227942363 CTGGGTGCAGAGCAGGAAGGAGG + Intronic
922762959 1:228143734-228143756 CTGGGTGAGCAGCAGGAGCCAGG + Intronic
922976429 1:229787594-229787616 ATGGGTGAAAAACAGGAAGGGGG - Intergenic
923550498 1:234959382-234959404 CTGGATGAGCAGTAGCAAGGAGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063663106 10:8047210-8047232 CTGGGGAACCGGCAGGTAGGTGG + Intergenic
1064634028 10:17345529-17345551 CTGTTTGAGAAGCAGGAAGGAGG + Intronic
1066053385 10:31658589-31658611 CTGGCTGCCCAACAGGAAAGGGG + Intergenic
1066206147 10:33191201-33191223 CTAGGTGGGTAGCAGGAAGGGGG + Intronic
1067289619 10:44931687-44931709 CCTGGTGACCAGCAGGTAGAAGG + Intronic
1067461542 10:46461970-46461992 CTGGAAGAGGAGCAGGAAGGTGG + Exonic
1067469702 10:46527607-46527629 CTCGGTGGGCAGCAGGGAGGAGG + Intergenic
1067625652 10:47922631-47922653 CTGGAAGAGGAGCAGGAAGGTGG - Intergenic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068423848 10:56830262-56830284 CTGGCTGATCAGCAGGGTGGTGG + Intergenic
1068701501 10:60024710-60024732 CTGGGAGAGCACCTGGAAGGTGG + Intergenic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1071712983 10:88067865-88067887 CTGGAGCACCATCAGGAAGGGGG + Intergenic
1073214090 10:101827105-101827127 CTGGGTGTCAGGCAGGAAGGGGG + Intronic
1073818847 10:107237056-107237078 CTGAGGGACCAGCAGGAAAGGGG + Intergenic
1075030560 10:119021915-119021937 CTTAGTGACCAGAAGGCAGGTGG - Intergenic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1076305337 10:129462101-129462123 CTGGGTCACTAGAAGGAAGTGGG - Intergenic
1076582321 10:131520091-131520113 GTGGGTGCCCAGCAGCAACGTGG + Intergenic
1077147689 11:1053300-1053322 CTGTGGGAACTGCAGGAAGGAGG - Intergenic
1077301609 11:1849826-1849848 CTGGGGGACCGGGAGGAAGGTGG + Intergenic
1077317753 11:1926955-1926977 CTGGGCTGCCAACAGGAAGGTGG + Intronic
1081664245 11:44907202-44907224 GTGGGTCACCAGCAGGTGGGTGG - Intronic
1081674922 11:44963203-44963225 CTTGGGGCCCAGCAGGAAGCTGG - Intergenic
1081724950 11:45321546-45321568 CTGGGGGTCCAGCGAGAAGGTGG - Intergenic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083756057 11:64792232-64792254 CAGGGCGGCCAGCAGGAAGGTGG + Exonic
1083758070 11:64801985-64802007 CCAGATGACCAGCAGGGAGGCGG - Intronic
1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG + Exonic
1084328590 11:68416334-68416356 CTGGCTGAACAGCAAGAAGGTGG - Exonic
1085257161 11:75181659-75181681 CTGGGGGCCCAGCAGACAGGAGG + Intronic
1089170822 11:116510367-116510389 CTGGGACACCAGCAGGCAGTAGG - Intergenic
1089191820 11:116659322-116659344 CTGGGTGACGAGGTGGAGGGTGG - Intergenic
1090402571 11:126458493-126458515 CTTGGGCACCAGCAGGAAGAGGG - Intronic
1090948384 11:131451487-131451509 CTGGGGGTGCAGCTGGAAGGGGG + Intronic
1091048755 11:132349244-132349266 CTGGGTGCAGAGCAGGATGGAGG - Intergenic
1091058195 11:132438557-132438579 TAGGGTGGGCAGCAGGAAGGTGG + Intronic
1091058226 11:132438706-132438728 TAGGGTGTGCAGCAGGAAGGTGG + Intronic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091367139 11:135031730-135031752 CTCAGAGACCAGCAGGCAGGAGG + Intergenic
1091602702 12:1927743-1927765 CTGGCTGCCCAGCAGTCAGGAGG + Intergenic
1091753911 12:3039620-3039642 ATGGGTGGCCAGCAGGAACCGGG - Intronic
1091889886 12:4045041-4045063 CTGGAAGACCAGGAGGAAGGGGG + Intergenic
1092889382 12:12954548-12954570 ATGACTAACCAGCAGGAAGGGGG - Intergenic
1094470494 12:30797063-30797085 CTGGGAGACCAGCAGGCACCTGG + Intergenic
1094663286 12:32493110-32493132 CTGGGTCACAGCCAGGAAGGTGG + Intronic
1096154592 12:49334947-49334969 CTGGATGTCCAGCATGAAGGGGG - Intronic
1101034047 12:100687330-100687352 CAGGACAACCAGCAGGAAGGAGG - Intergenic
1102073627 12:110042709-110042731 CAGGGTGGGCAGCAAGAAGGGGG + Intronic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1103346896 12:120257146-120257168 CTGGGTGAGCTGGAGCAAGGGGG - Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104276828 12:127336728-127336750 CAGGGAGAGCAACAGGAAGGTGG + Intergenic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1104575045 12:129959040-129959062 GTGATTGCCCAGCAGGAAGGGGG + Intergenic
1104610805 12:130226179-130226201 CTGGGGGACCAGCAGGACGTGGG - Intergenic
1104613455 12:130249514-130249536 CTGGCTGAAAAACAGGAAGGAGG + Intergenic
1104684573 12:130776366-130776388 CTGGCTTCCCAGCTGGAAGGAGG + Intergenic
1104971321 12:132532172-132532194 CTGGGTGAGCTGCAGGGTGGTGG + Intronic
1105912093 13:24878687-24878709 CTGGGAGACAGGCAGAAAGGGGG - Intronic
1106304416 13:28496613-28496635 CTGGGGGACCAGCAAGGAGAAGG - Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1112160013 13:96857208-96857230 CAAGGTGACAGGCAGGAAGGAGG - Intergenic
1112544858 13:100357433-100357455 CTGGGCTACCACCTGGAAGGTGG + Intronic
1113350438 13:109524400-109524422 CTGGGTCTCCAGGAGGAATGAGG - Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1115403871 14:32994110-32994132 CTGGGGGAGCTGGAGGAAGGGGG + Intronic
1117454819 14:55886465-55886487 TTGGGTGACCTGCAGGCTGGTGG - Intergenic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1121097147 14:91225459-91225481 CTGGGTGACTGGCAGGCGGGTGG - Intronic
1121431468 14:93891264-93891286 CTGGGGTACCAGGAGGAACGGGG - Intergenic
1124700750 15:31909886-31909908 CTGGGTACCCAGAAGGCAGGGGG + Intergenic
1125386540 15:39142714-39142736 CTGGCAGAGCAGGAGGAAGGAGG - Intergenic
1125514853 15:40312724-40312746 CTGGATGACCAGCGCAAAGGAGG + Intergenic
1126054510 15:44717049-44717071 TTGGGAGAGCATCAGGAAGGTGG + Intronic
1126949882 15:53869211-53869233 CTGGGTGACCTGCAGTTACGTGG + Intergenic
1127572983 15:60262238-60262260 TTGGATGACCAGCAGAAAGAAGG - Intergenic
1127833548 15:62771770-62771792 CTGGGGGACCACCAGGCAGGAGG + Intronic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1127927353 15:63559913-63559935 ATGGGAAAACAGCAGGAAGGCGG + Exonic
1127957579 15:63866213-63866235 CTGCGTGCCCAGCAGAAAGGAGG + Intergenic
1128239810 15:66094256-66094278 CTGTGTGAACATCAGGGAGGAGG - Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1128552887 15:68609606-68609628 CTGGGAGACCAGCAGCAAAGAGG - Intronic
1129190373 15:73933973-73933995 CTGGGTGCCCATCAGCAAGAGGG - Intronic
1129228525 15:74183715-74183737 CTGGGGCAGCAGCAAGAAGGAGG - Intronic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1130097940 15:80870166-80870188 CTCAGTGACTAGCAGGACGGTGG - Intronic
1130146530 15:81278516-81278538 CAGGGAGACAAGGAGGAAGGAGG + Intronic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1131119426 15:89813679-89813701 AGGGGTGACCAGGAGGAAGTGGG - Intronic
1131533483 15:93214446-93214468 CTAGGTGCCCAGCATGCAGGAGG - Intergenic
1132478557 16:154279-154301 CAGGGTGACCAGCAGGCAGTGGG - Exonic
1132480735 16:165035-165057 CAGGGTGACCAGCAGGCAGTGGG - Intronic
1132623725 16:880198-880220 GTTGGGGACCAGCAGGAATGGGG + Intronic
1132906387 16:2284792-2284814 GATGGTGACCATCAGGAAGGTGG + Exonic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1132984274 16:2756175-2756197 TTGGGAGACCAGGAGGATGGTGG + Intronic
1133248597 16:4465386-4465408 CTGAGTGACCAGCAGGACACAGG + Intronic
1133257413 16:4525670-4525692 CTGGGTGATGAGCAGGAAAGAGG + Intronic
1133397756 16:5461981-5462003 CTGGTTGCCCACCAGAAAGGTGG + Intergenic
1135110117 16:19684116-19684138 CTGGGTGCTCTGGAGGAAGGAGG + Intronic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137445363 16:48528312-48528334 GTGAGTGACCAGCAGGGAGCTGG - Intergenic
1137582751 16:49643935-49643957 CTTGGTGACCAGCATGGAGCAGG + Intronic
1138099668 16:54242487-54242509 CTGGGTGCCCAGGAGGAAAAGGG + Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138501113 16:57445587-57445609 CTGGGTGACCAGTACCAAGTGGG + Intronic
1139987037 16:70907197-70907219 CTGGGTGTCCAGCAGGGAGTTGG + Intronic
1140450049 16:75063449-75063471 CTGGATGCCAAGCAGGATGGAGG - Intronic
1140954437 16:79849198-79849220 CTGCAGGACCAGCGGGAAGGTGG - Intergenic
1141336800 16:83163545-83163567 CTGTGTGCCCAGGAGGAACGGGG - Intronic
1141476087 16:84274411-84274433 CTGGGTGACGAATGGGAAGGTGG - Intergenic
1141665105 16:85461901-85461923 CTGGGAGGAGAGCAGGAAGGAGG - Intergenic
1141775956 16:86122647-86122669 ATGGGGGTCCAGCAGGAAGTCGG + Intergenic
1142122847 16:88395692-88395714 CTGTGTGACCAGCAAGGAGAAGG + Intergenic
1142203904 16:88773681-88773703 CTGGGTGACAGGCAGGTCGGGGG + Intronic
1142203912 16:88773723-88773745 CTGGGTGACAGGCAGGTCGGCGG + Intronic
1142478923 17:206115-206137 TTGGTTCCCCAGCAGGAAGGAGG - Intergenic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142967812 17:3592025-3592047 CTGGGCTCCCAGCAGGGAGGGGG + Intronic
1143405577 17:6675202-6675224 CTGGGTTACCAGCAGGAGTCAGG + Intergenic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1145270125 17:21400383-21400405 CTGTGTGACCACCCGGGAGGAGG - Intronic
1145308353 17:21687834-21687856 CTGTGTGACCACCCGGGAGGAGG - Intergenic
1145886268 17:28384488-28384510 CTCCGTGCCCAGCTGGAAGGAGG + Exonic
1147884934 17:43678035-43678057 GTGGGAGACCGGCGGGAAGGCGG - Intergenic
1147888633 17:43701518-43701540 TTGGCTGACAAACAGGAAGGTGG - Intergenic
1147935497 17:44008331-44008353 CTGGGTGCCCAGCATGCAGTAGG + Intronic
1147995215 17:44356402-44356424 CTGGGTGCCCAGCACGGATGGGG - Intronic
1148395408 17:47304230-47304252 CTGGGAGATGAGCAGGGAGGCGG - Intronic
1149258986 17:54858637-54858659 CTGGGGAACCAGCCTGAAGGTGG + Intergenic
1149544315 17:57491805-57491827 TTGAATGAACAGCAGGAAGGAGG - Intronic
1150267068 17:63838542-63838564 CAGGCTGAGCAGCAGGAAAGTGG + Intronic
1151578555 17:74964735-74964757 CTGGGACCCCAGCAGGTAGGGGG - Intronic
1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG + Intronic
1152251827 17:79216431-79216453 CTGGGGGGCAGGCAGGAAGGAGG + Intronic
1152698188 17:81806551-81806573 CTGGCTGCCCGGCTGGAAGGTGG + Intronic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1155474479 18:26224582-26224604 CTTGGTGACCAGCACACAGGAGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG + Intergenic
1158627107 18:59081106-59081128 TTGGGGGCACAGCAGGAAGGTGG - Intergenic
1159001983 18:62982543-62982565 CTGGATTTCCAGCAGGAAGCAGG - Intergenic
1160410833 18:78674410-78674432 CTGGGTGACAACCAGCAAGGTGG + Intergenic
1160694153 19:474522-474544 CTGGGAGCCCAGCAGGAGGCAGG - Intronic
1160701687 19:510595-510617 CTTGGAGACGACCAGGAAGGTGG - Intronic
1160891500 19:1381005-1381027 CTGTGTGACCAACAGAATGGCGG - Intergenic
1161085702 19:2333989-2334011 CTGGTAGAACAGCAGGAAGCAGG - Intronic
1161854388 19:6754933-6754955 CTGGGGGCCCAGCAGGCAGGAGG + Exonic
1161854727 19:6757555-6757577 CTGGGGGATAAGCAGGCAGGAGG - Intronic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1162469562 19:10864381-10864403 ATGGGTGACAAGCAGGAGGTGGG + Intronic
1162741129 19:12774572-12774594 CTGGGTGATGGGCAGGAAGAGGG - Intronic
1163676132 19:18656177-18656199 GTGGGGGACCTGCAGGATGGGGG + Intronic
1163708500 19:18831862-18831884 CCTGGTGCCCAGCAGGAAGACGG - Intergenic
1164399043 19:27890333-27890355 CTGTGTCCCCAGCAGGAATGAGG + Intergenic
1165172984 19:33906518-33906540 CTGGGCGACCTGGAGGCAGGGGG - Intergenic
1165451869 19:35888500-35888522 CTGGCTGTCCCGCAGGACGGTGG + Exonic
1165620395 19:37241277-37241299 CTGGCTGACCTGCAGGTAGCCGG - Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166323828 19:42036974-42036996 CTTTGTGACCTGCAGGCAGGTGG - Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166599589 19:44082223-44082245 CAGGACAACCAGCAGGAAGGAGG - Intronic
1166783480 19:45354202-45354224 CTGGGTGACCAGCAGGACATGGG - Intronic
1166862079 19:45816578-45816600 CTGGGTGGAGAGCAGGAAGGGGG + Intronic
1168056069 19:53866111-53866133 GAGGGGGACCTGCAGGAAGGCGG - Intergenic
1168326623 19:55541865-55541887 CTGGGAGACCAGCTGGGAGTTGG - Intronic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
925169736 2:1743628-1743650 CTGGGGGAGGAGAAGGAAGGGGG + Intronic
925294801 2:2769374-2769396 CTGAGGGACTAGGAGGAAGGAGG - Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
927527430 2:23758482-23758504 CTGGATTTCCACCAGGAAGGTGG + Intronic
928290252 2:30030397-30030419 CTGGGTCTCCAGCAGTAAAGAGG + Intergenic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
929033560 2:37671307-37671329 CTGGGAAACCAGCAGGGAGTCGG - Intronic
929892737 2:45932038-45932060 CTGGGTGACCAGCATCCAGATGG + Intronic
930729065 2:54710002-54710024 CTGGGTGTCCAGGAAGAATGAGG - Intergenic
931291640 2:60879515-60879537 CTGGGGGAACAGCAGGCAGCAGG - Intergenic
932072555 2:68635753-68635775 TTGGGTCCCCATCAGGAAGGAGG + Intergenic
932221169 2:70000026-70000048 CAGGGAGGCCAGCAGGGAGGCGG - Intergenic
932485431 2:72081635-72081657 GTGTGTGACCCGCAGGCAGGGGG + Intergenic
934126203 2:88893170-88893192 CTGGGTGACAAGCAGCTACGTGG + Intergenic
938124145 2:128659665-128659687 CTGGGAGGCCAGCAAGAAGCTGG - Intergenic
938561064 2:132472316-132472338 CTGGAAGGCCAGCAGCAAGGAGG - Intronic
938849413 2:135245298-135245320 CTGGGCAATCAGCAGGAAGTTGG + Intronic
939996503 2:148925649-148925671 CTGTGTGCCCACCAGGAAAGGGG - Intronic
940465981 2:154027010-154027032 CTGGAGGACAAGCAGGAAGCAGG + Intronic
941213915 2:162681317-162681339 CTGGGTGACCTTTAGGAAGAAGG + Intronic
941601733 2:167551176-167551198 CTGTGTGCCCAGGAGGAAAGGGG + Intergenic
942283990 2:174395697-174395719 CTGCGTTTCCAGCAGCAAGGGGG + Exonic
946416985 2:219544632-219544654 CTGGGTCCCCACCAGGATGGGGG - Intronic
947339885 2:229127175-229127197 CTGTGTGTCCAGGAGGAAAGGGG + Intronic
947478446 2:230473548-230473570 CTGGATCACCAACAGGAAGTGGG + Intronic
947933787 2:233985826-233985848 CAGGTTGACCAGCAGGATGTTGG - Exonic
948408325 2:237739743-237739765 CTGAGTGACAAGCAGGATGCAGG - Intronic
1171412212 20:24955268-24955290 CAGTGTTACCATCAGGAAGGAGG - Intronic
1171448106 20:25218751-25218773 CTGGGTGCCCAGCATGCAGCGGG - Intronic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1172598606 20:36168080-36168102 CTGGGTGGCCTGCAGGGAGAGGG - Intronic
1172884557 20:38222509-38222531 CTGGGCCTCCAGCGGGAAGGTGG - Exonic
1174263485 20:49314506-49314528 CTGGGTGGGGAGAAGGAAGGAGG - Intergenic
1174491652 20:50902309-50902331 CTGACTGACCATCAGGAAAGTGG - Intronic
1174703709 20:52634950-52634972 TTTGGTGACCTGCAGGGAGGGGG + Intergenic
1175142537 20:56871824-56871846 ATGGGTGATCAAAAGGAAGGCGG - Intergenic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1176234769 20:64049140-64049162 CTGGGTGAGCGGCGGGAGGGCGG - Exonic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1178838652 21:36120527-36120549 CTGTGTGACCAGCAGACATGGGG + Intergenic
1178910297 21:36668597-36668619 GTGGGTGACAAGCAAGGAGGAGG + Intergenic
1179169555 21:38962414-38962436 CAGGATGCCCAGCAGGAAGTGGG - Intergenic
1179768209 21:43590843-43590865 CAGGGAGAGGAGCAGGAAGGAGG + Intronic
1180167306 21:46036767-46036789 CTGGGTGAGCAGCTGGAGCGAGG + Intergenic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180244806 21:46539818-46539840 CTGGGGGGCCAGCAGGGAAGGGG - Intronic
1180859403 22:19068706-19068728 ATGGGGGACCAGCAGGCAGGGGG - Intronic
1180961818 22:19765744-19765766 CTGCGTGATCTGCAGGGAGGTGG - Exonic
1181119723 22:20657798-20657820 GAGGGTGACAAGCAGGAGGGGGG + Intergenic
1181713597 22:24707322-24707344 CCTGGTGGCCAGCAGGAAGCTGG + Intergenic
1181920155 22:26314408-26314430 CAGTGTGGCCAGCAAGAAGGGGG + Intronic
1182709138 22:32309816-32309838 GGGGGTGACCTGCGGGAAGGAGG + Intergenic
1183528822 22:38341118-38341140 CTCGGTGACGAAAAGGAAGGAGG - Intronic
1183988026 22:41579980-41580002 CTGGCTTTCCAGCAGGTAGGTGG + Intronic
1184372894 22:44093927-44093949 GTGAGTGACCTGCAGGAAGAAGG + Exonic
1184396749 22:44246815-44246837 GGGGGTGACCTGCAGGAAGGAGG + Exonic
1184403265 22:44286118-44286140 CAGGGGCACCTGCAGGAAGGAGG - Intronic
1184466396 22:44670833-44670855 GTGGGTGACGAGAAGGAAAGAGG + Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184765826 22:46571965-46571987 CTGGGTGATAAGCAGGTGGGAGG - Intergenic
1184767392 22:46578748-46578770 AAGGGTGTGCAGCAGGAAGGAGG - Intronic
1184892102 22:47386349-47386371 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
1184892332 22:47387607-47387629 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
1185140824 22:49100391-49100413 CTGGGTGACCCGCAAGAAACAGG - Intergenic
1185393342 22:50574261-50574283 CTTGGTGATGAGCAGGCAGGAGG + Intronic
954659177 3:52217585-52217607 CCGGGTGATCTGCAGGAAGTAGG + Intergenic
956450996 3:69374808-69374830 CTGGATGGCCACCAGGAAAGGGG - Intronic
956718194 3:72096693-72096715 CTGGGTGAACAGGAGCATGGTGG - Intergenic
956805738 3:72809205-72809227 GTGGGTGACCAGCGGCAGGGAGG - Intronic
959121031 3:102232330-102232352 CTGGGTGCCCAGTAGAATGGTGG + Intronic
960971185 3:123141325-123141347 CTGGGTGGCCTCCAGGGAGGTGG - Intronic
961052313 3:123757330-123757352 CTTGGTGAGTAGCAGAAAGGGGG + Intronic
961192092 3:124970527-124970549 CTGAGTGGCAAGCAGGAAGAGGG - Exonic
961318237 3:126055115-126055137 CTGAGTGGCCATTAGGAAGGAGG + Intronic
961822287 3:129581168-129581190 CTGTGTGAACAGCAGGCAGCAGG - Intronic
962022339 3:131513671-131513693 CTGGGGGGCAAGCAGGAAAGTGG - Intergenic
962205051 3:133427562-133427584 CTGGCTGAGGAGCAGGGAGGTGG - Intronic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
962695701 3:137945230-137945252 ATGTGTGACCAACAGGATGGAGG + Intergenic
966351251 3:179034619-179034641 ATGGATGACCAGGAGGAAGCTGG - Intronic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
968588527 4:1446172-1446194 CTGAGGGACCAGCAGGGTGGAGG + Intergenic
968689443 4:1983189-1983211 CTGGGTCAGCAGCAGGGCGGCGG + Exonic
969308432 4:6338710-6338732 CTAGGGGCCCAGCAGGAAGGGGG - Intronic
969443653 4:7232255-7232277 CCTGGTGGCCAGGAGGAAGGGGG + Intronic
969471466 4:7391818-7391840 CTGGGTGAGGGGCTGGAAGGAGG - Intronic
969714819 4:8863382-8863404 CTGGGTGAGCAGCACCAGGGAGG - Intronic
969715910 4:8868008-8868030 CTCGGTGAGCTGCAGGGAGGCGG + Exonic
970309852 4:14770685-14770707 CTAGGTTACCAGCTGGAAAGTGG - Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
978189332 4:105895154-105895176 CAGGGTGCCCAGCAGGAAAGGGG - Intronic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
981663653 4:147196642-147196664 CTAGGTGAGCAGGAGGAAGCAGG - Intergenic
984560636 4:181264984-181265006 CTGAGCGCCCAGCAGGCAGGAGG + Intergenic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
986218758 5:5747187-5747209 CTGGGTTACCAGAATCAAGGTGG + Intergenic
986955494 5:13145359-13145381 ATGAATGGCCAGCAGGAAGGGGG + Intergenic
987075679 5:14379944-14379966 GTGGGTGGCCAGCAGGCGGGAGG - Intronic
992417362 5:76564828-76564850 CTGGGAGAGGAGCAGGAAGGAGG + Intronic
993329421 5:86579457-86579479 CTAGGAGACCAGTAGGAAGGGGG - Intergenic
993708201 5:91195520-91195542 TTTGGGGACCAGCAGGAATGCGG + Intergenic
995726116 5:115181921-115181943 CTGCATTACAAGCAGGAAGGAGG + Intergenic
997309291 5:132866502-132866524 CTGGGTGACCCGTAGGTGGGAGG - Intronic
998177344 5:139910011-139910033 CTAGGTGGCCAGAAAGAAGGGGG + Intronic
999247007 5:150160421-150160443 CTGAGTGTCCAGGAGGTAGGGGG - Intergenic
1001475011 5:172044336-172044358 CTGGGAGAACAGGAGGAATGAGG + Exonic
1001835109 5:174825085-174825107 CAGGGAGACCAGCAAGGAGGTGG - Intergenic
1002201335 5:177530378-177530400 CTTGGTGACCAGCAAGATGGTGG - Intronic
1002898467 6:1392506-1392528 CTGGGAGAGGAGCAGGCAGGCGG - Intronic
1003459355 6:6315861-6315883 CTGGGTGAACTGCATGAAGATGG + Intronic
1004811483 6:19268892-19268914 CTGGGCTCCCAGCAGGTAGGTGG - Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1007397906 6:41587770-41587792 CTGGGAGGACAGCAGGGAGGTGG - Intronic
1007784962 6:44274565-44274587 GCGGGTGAGAAGCAGGAAGGAGG + Intronic
1008136471 6:47783261-47783283 TTGGGTGACCAGTGTGAAGGTGG + Intronic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011368695 6:86609220-86609242 CAGGATGACCAGCAGGTTGGGGG - Intergenic
1012637212 6:101558985-101559007 CTTGGTAACCAAAAGGAAGGTGG - Intronic
1013001550 6:106027618-106027640 GTGGGGGACCAGGAGGAACGGGG + Intergenic
1013463984 6:110400825-110400847 CTGGGTGCCCAGCTGAAAGAAGG - Intronic
1013566953 6:111374960-111374982 GTGGGAGACCAGCAGCGAGGTGG + Exonic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1015029715 6:128580350-128580372 CTTGATGTCCAGCAGGATGGAGG + Intergenic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1017062000 6:150492822-150492844 CTGAGGGGCCAGCAAGAAGGTGG - Intergenic
1017079975 6:150658743-150658765 CAGGGTGAGGAGCAGGGAGGAGG - Intronic
1017360273 6:153560521-153560543 CTGGGTGAGCCTCAGCAAGGAGG - Intergenic
1017743520 6:157427168-157427190 CTGGGAGCACAGGAGGAAGGAGG + Intronic
1018438308 6:163783201-163783223 CTGGGTGGGCTTCAGGAAGGAGG + Intergenic
1018637474 6:165876190-165876212 CTGCAAGACCAGCAAGAAGGGGG + Intronic
1018873868 6:167803479-167803501 CTGGGTAACCCTCAGGCAGGTGG - Intergenic
1018956499 6:168413619-168413641 CTGCTTGTCCAGCAGGAGGGAGG + Intergenic
1019789848 7:3004114-3004136 CATGGTAACCAGCAGGAAGCTGG - Intronic
1020107354 7:5428265-5428287 CGGCGTGAGCAGCGGGAAGGAGG - Intergenic
1020264170 7:6549333-6549355 CTGAGTCACCTGCAGGAAGTAGG - Intronic
1021970873 7:25964805-25964827 CTGCCTCACCAGCAGCAAGGCGG + Intergenic
1022105233 7:27192265-27192287 CTGGCTGAGCCGCAGGGAGGGGG + Intergenic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1022759841 7:33336017-33336039 CTGGCTGAAGACCAGGAAGGAGG - Intronic
1022819858 7:33948868-33948890 CTGTGAGATAAGCAGGAAGGAGG + Intronic
1022965191 7:35465874-35465896 CCGGGTGACCTGCTGGAAGTGGG - Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023872910 7:44272345-44272367 CTGGGTGCCCAGGAGGAGAGGGG - Intronic
1024073729 7:45808028-45808050 CTGGGAGACAGGCAGGAATGTGG - Intergenic
1024307944 7:47943887-47943909 GTGAGTGAGCAGCAGGAATGGGG - Intronic
1024396813 7:48879006-48879028 CTGGGTGAGTAACAGGAAGTAGG - Intergenic
1024723258 7:52162564-52162586 CTGGCTGATCAGCCGGAAGATGG - Intergenic
1025849668 7:65235752-65235774 GGAGGTGAACAGCAGGAAGGTGG - Intergenic
1027793540 7:82662213-82662235 CTGGGTGGCTTACAGGAAGGTGG - Intergenic
1028686329 7:93592320-93592342 CTTGGTGAGCAGGAGGAAGATGG - Intronic
1029534024 7:101145311-101145333 CTGGGTTATCAGGAGGGAGGAGG - Intergenic
1029607750 7:101609307-101609329 CTGAGAGGCCAGGAGGAAGGAGG - Intergenic
1029705058 7:102271687-102271709 CTGGGTCCCTGGCAGGAAGGTGG - Intronic
1030061059 7:105621733-105621755 CTGGGAGGCCTGGAGGAAGGGGG - Intronic
1030667841 7:112300797-112300819 CTGAGTGACCAGGAGAATGGTGG - Intronic
1032166788 7:129551604-129551626 CTGGGTGACCTGCTGGATTGTGG - Intergenic
1034262030 7:149763257-149763279 GTGTGTGCCCAGCAGGAAGGAGG - Intergenic
1035230957 7:157465182-157465204 CTGGGTGACAGGCACGAAGCTGG - Intergenic
1035457246 7:159016592-159016614 CAGGGTGCCAAGCAGGAGGGTGG - Intergenic
1035892500 8:3360483-3360505 CTGGGGAAACAGCAAGAAGGAGG - Intronic
1036238653 8:7064407-7064429 CCTGGTGACCTGCAGGAAGATGG + Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1037928521 8:22864061-22864083 CTGTGTGCCCAGGAGCAAGGCGG - Intronic
1038613783 8:29075280-29075302 CAGGGTGACCAGGATGGAGGAGG - Exonic
1038893671 8:31756325-31756347 CCAGGTGACTAGCAGGAAGCAGG + Intronic
1039058983 8:33558567-33558589 GTGGGAGTCCAGCAGGAGGGAGG - Intronic
1040946767 8:52893043-52893065 CGGGTTGCCCAGCAGGAAGACGG + Intergenic
1043682852 8:83052552-83052574 CAGGGAGACCAACAGGAAGTAGG - Intergenic
1044429745 8:92095281-92095303 AGGGGTGGCCAGGAGGAAGGGGG - Intronic
1047309815 8:123682703-123682725 CTGGGACACGGGCAGGAAGGTGG + Intronic
1047389234 8:124436838-124436860 TGGGGTGACCAGCAGGGAGCAGG - Intergenic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1047823440 8:128547608-128547630 CTGGTTCACCAACAGCAAGGAGG - Intergenic
1048770188 8:137886728-137886750 CTGGGGGACAAGCAGGAAAGAGG + Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049210432 8:141384038-141384060 TTGGGTGATCTGCAGGAAGGAGG + Intergenic
1049249731 8:141581899-141581921 CTGGGTGAGCTGGAGGCAGGAGG + Intergenic
1049569023 8:143359789-143359811 CTGGGTCACCCACAGGAAGAGGG + Intronic
1049799092 8:144509537-144509559 CTGGGTGACGCGCAGCACGGCGG + Exonic
1050151274 9:2621770-2621792 CGGGGTGAGCAGCGGGGAGGGGG - Intergenic
1051889506 9:21927830-21927852 ATGGCTAACCAGAAGGAAGGGGG + Intronic
1052339813 9:27354046-27354068 CTTGGTCTCCAGCAGGGAGGGGG - Intronic
1052969699 9:34369930-34369952 CTGGATGATCTGGAGGAAGGGGG - Exonic
1053543592 9:38999486-38999508 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1053808022 9:41822991-41823013 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1054622570 9:67364437-67364459 CTGGGTAAGCAGCAGGATAGGGG + Intergenic
1055828895 9:80358116-80358138 CGGGGTCCCCAGCAGGAAGCAGG - Intergenic
1056731061 9:89167104-89167126 CTGGGGGTCCAGCAGGAGGGAGG + Intronic
1056769577 9:89467149-89467171 TTGTGTGGCCACCAGGAAGGAGG - Intronic
1057211996 9:93205491-93205513 GGGGCTGACCAGCAGGATGGGGG - Intronic
1057784752 9:98078344-98078366 CTCGGTGAGCAGGAGGGAGGGGG + Exonic
1057840504 9:98482121-98482143 ATGGATGAACTGCAGGAAGGTGG - Intronic
1059506700 9:114805839-114805861 CTGGCTGACAAGCAGGTATGTGG + Exonic
1060547448 9:124469561-124469583 ATGGGGGGCCAGCAGGAAGCAGG + Intronic
1061596703 9:131635174-131635196 CTAGGTGACCAGGAGGCAGTGGG - Intronic
1062599440 9:137313335-137313357 CAGGGTGGCCGGCAGGCAGGAGG - Intronic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1189141539 X:38612218-38612240 CTGAGCGCCCAGCAGGAATGTGG + Intronic
1189261492 X:39682136-39682158 CTTGGTGACCTGCAGGAAGCAGG - Intergenic
1190416351 X:50184032-50184054 CTGGGTGCCCAGTAGGTGGGAGG + Intergenic
1195239546 X:102937479-102937501 CTGGCCGTCCAGCAGGATGGTGG - Exonic
1195298162 X:103500574-103500596 CTGGCCGTCCAGCAGGATGGTGG + Exonic
1195678195 X:107523399-107523421 CTGGGCCACCTGCAGGAAGATGG + Intronic
1197782765 X:130173398-130173420 CAGTTTGACCAGCAAGAAGGAGG - Intronic
1198808370 X:140510327-140510349 CGAGGTGACCTGCAGGAAGCCGG + Intergenic
1199683393 X:150242979-150243001 CTGGGAGACAGGCAGGAGGGAGG + Intergenic
1199988323 X:152968583-152968605 CTGGGCCAGCAGCAGGATGGTGG + Intronic
1200149394 X:153943865-153943887 CTGGGAGATGGGCAGGAAGGGGG + Intronic
1201265181 Y:12199409-12199431 AGGGGTTCCCAGCAGGAAGGTGG + Intergenic
1201412678 Y:13716476-13716498 CTTGGTGGCCAGCAGGATAGTGG - Intergenic
1202333982 Y:23786434-23786456 CTGGGTGACTAGAAGCTAGGAGG - Intergenic
1202536786 Y:25883625-25883647 CTGGGTGACTAGAAGCTAGGAGG + Intergenic