ID: 1184751591

View in Genome Browser
Species Human (GRCh38)
Location 22:46489430-46489452
Sequence GGTTTGGGGCCCCCAAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184751591_1184751605 19 Left 1184751591 22:46489430-46489452 CCCAAGCTTGGGGGCCCCAAACC No data
Right 1184751605 22:46489472-46489494 ACTACGGGACATCCACTGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 43
1184751591_1184751599 3 Left 1184751591 22:46489430-46489452 CCCAAGCTTGGGGGCCCCAAACC No data
Right 1184751599 22:46489456-46489478 CCTGGCGCCCCTCCTAACTACGG 0: 1
1: 0
2: 1
3: 4
4: 47
1184751591_1184751607 29 Left 1184751591 22:46489430-46489452 CCCAAGCTTGGGGGCCCCAAACC No data
Right 1184751607 22:46489482-46489504 ATCCACTGCTTGGATTCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 151
1184751591_1184751600 4 Left 1184751591 22:46489430-46489452 CCCAAGCTTGGGGGCCCCAAACC No data
Right 1184751600 22:46489457-46489479 CTGGCGCCCCTCCTAACTACGGG 0: 1
1: 0
2: 0
3: 6
4: 48
1184751591_1184751606 28 Left 1184751591 22:46489430-46489452 CCCAAGCTTGGGGGCCCCAAACC No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG 0: 1
1: 1
2: 2
3: 22
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184751591 Original CRISPR GGTTTGGGGCCCCCAAGCTT GGG (reversed) Intronic
No off target data available for this crispr