ID: 1184751599 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:46489456-46489478 |
| Sequence | CCTGGCGCCCCTCCTAACTA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1184751590_1184751599 | 4 | Left | 1184751590 | 22:46489429-46489451 | CCCCAAGCTTGGGGGCCCCAAAC | No data | ||
| Right | 1184751599 | 22:46489456-46489478 | CCTGGCGCCCCTCCTAACTACGG | No data | ||||
| 1184751591_1184751599 | 3 | Left | 1184751591 | 22:46489430-46489452 | CCCAAGCTTGGGGGCCCCAAACC | No data | ||
| Right | 1184751599 | 22:46489456-46489478 | CCTGGCGCCCCTCCTAACTACGG | No data | ||||
| 1184751592_1184751599 | 2 | Left | 1184751592 | 22:46489431-46489453 | CCAAGCTTGGGGGCCCCAAACCT | No data | ||
| Right | 1184751599 | 22:46489456-46489478 | CCTGGCGCCCCTCCTAACTACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1184751599 | Original CRISPR | CCTGGCGCCCCTCCTAACTA CGG | Intronic | ||