ID: 1184751600

View in Genome Browser
Species Human (GRCh38)
Location 22:46489457-46489479
Sequence CTGGCGCCCCTCCTAACTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184751594_1184751600 -10 Left 1184751594 22:46489444-46489466 CCCCAAACCTCTCCTGGCGCCCC No data
Right 1184751600 22:46489457-46489479 CTGGCGCCCCTCCTAACTACGGG No data
1184751592_1184751600 3 Left 1184751592 22:46489431-46489453 CCAAGCTTGGGGGCCCCAAACCT No data
Right 1184751600 22:46489457-46489479 CTGGCGCCCCTCCTAACTACGGG No data
1184751590_1184751600 5 Left 1184751590 22:46489429-46489451 CCCCAAGCTTGGGGGCCCCAAAC No data
Right 1184751600 22:46489457-46489479 CTGGCGCCCCTCCTAACTACGGG No data
1184751591_1184751600 4 Left 1184751591 22:46489430-46489452 CCCAAGCTTGGGGGCCCCAAACC No data
Right 1184751600 22:46489457-46489479 CTGGCGCCCCTCCTAACTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184751600 Original CRISPR CTGGCGCCCCTCCTAACTAC GGG Intronic