ID: 1184751605

View in Genome Browser
Species Human (GRCh38)
Location 22:46489472-46489494
Sequence ACTACGGGACATCCACTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184751594_1184751605 5 Left 1184751594 22:46489444-46489466 CCCCAAACCTCTCCTGGCGCCCC No data
Right 1184751605 22:46489472-46489494 ACTACGGGACATCCACTGCTTGG No data
1184751598_1184751605 -7 Left 1184751598 22:46489456-46489478 CCTGGCGCCCCTCCTAACTACGG No data
Right 1184751605 22:46489472-46489494 ACTACGGGACATCCACTGCTTGG No data
1184751592_1184751605 18 Left 1184751592 22:46489431-46489453 CCAAGCTTGGGGGCCCCAAACCT No data
Right 1184751605 22:46489472-46489494 ACTACGGGACATCCACTGCTTGG No data
1184751595_1184751605 4 Left 1184751595 22:46489445-46489467 CCCAAACCTCTCCTGGCGCCCCT No data
Right 1184751605 22:46489472-46489494 ACTACGGGACATCCACTGCTTGG No data
1184751590_1184751605 20 Left 1184751590 22:46489429-46489451 CCCCAAGCTTGGGGGCCCCAAAC No data
Right 1184751605 22:46489472-46489494 ACTACGGGACATCCACTGCTTGG No data
1184751596_1184751605 3 Left 1184751596 22:46489446-46489468 CCAAACCTCTCCTGGCGCCCCTC No data
Right 1184751605 22:46489472-46489494 ACTACGGGACATCCACTGCTTGG No data
1184751591_1184751605 19 Left 1184751591 22:46489430-46489452 CCCAAGCTTGGGGGCCCCAAACC No data
Right 1184751605 22:46489472-46489494 ACTACGGGACATCCACTGCTTGG No data
1184751597_1184751605 -2 Left 1184751597 22:46489451-46489473 CCTCTCCTGGCGCCCCTCCTAAC No data
Right 1184751605 22:46489472-46489494 ACTACGGGACATCCACTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184751605 Original CRISPR ACTACGGGACATCCACTGCT TGG Intronic