ID: 1184751606

View in Genome Browser
Species Human (GRCh38)
Location 22:46489481-46489503
Sequence CATCCACTGCTTGGATTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184751590_1184751606 29 Left 1184751590 22:46489429-46489451 CCCCAAGCTTGGGGGCCCCAAAC No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data
1184751596_1184751606 12 Left 1184751596 22:46489446-46489468 CCAAACCTCTCCTGGCGCCCCTC No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data
1184751595_1184751606 13 Left 1184751595 22:46489445-46489467 CCCAAACCTCTCCTGGCGCCCCT No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data
1184751594_1184751606 14 Left 1184751594 22:46489444-46489466 CCCCAAACCTCTCCTGGCGCCCC No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data
1184751598_1184751606 2 Left 1184751598 22:46489456-46489478 CCTGGCGCCCCTCCTAACTACGG No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data
1184751601_1184751606 -5 Left 1184751601 22:46489463-46489485 CCCCTCCTAACTACGGGACATCC No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data
1184751592_1184751606 27 Left 1184751592 22:46489431-46489453 CCAAGCTTGGGGGCCCCAAACCT No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data
1184751604_1184751606 -10 Left 1184751604 22:46489468-46489490 CCTAACTACGGGACATCCACTGC No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data
1184751591_1184751606 28 Left 1184751591 22:46489430-46489452 CCCAAGCTTGGGGGCCCCAAACC No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data
1184751603_1184751606 -7 Left 1184751603 22:46489465-46489487 CCTCCTAACTACGGGACATCCAC No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data
1184751597_1184751606 7 Left 1184751597 22:46489451-46489473 CCTCTCCTGGCGCCCCTCCTAAC No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data
1184751602_1184751606 -6 Left 1184751602 22:46489464-46489486 CCCTCCTAACTACGGGACATCCA No data
Right 1184751606 22:46489481-46489503 CATCCACTGCTTGGATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184751606 Original CRISPR CATCCACTGCTTGGATTCTG AGG Intronic