ID: 1184752331

View in Genome Browser
Species Human (GRCh38)
Location 22:46494284-46494306
Sequence GAATAGCCAAGGCCACTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184752331 Original CRISPR GAATAGCCAAGGCCACTTTG AGG (reversed) Intronic
903535426 1:24063407-24063429 CAATAGCCAAGGCCAGTGTTAGG + Intronic
903600587 1:24535858-24535880 GAAATGCCAAATCCACTTTGAGG + Exonic
905510614 1:38516977-38516999 GAATACCCAAGGCCACACAGCGG - Intergenic
905958389 1:42020823-42020845 GGAAAGGAAAGGCCACTTTGAGG + Intronic
908173845 1:61534389-61534411 GAATGGACAAGGCCAATTGGTGG - Intergenic
909692861 1:78429837-78429859 GGATAGCCATGACCACGTTGTGG + Intronic
910514275 1:88040616-88040638 GAATTGCCAAGGAAACTCTGAGG + Intergenic
917212977 1:172648832-172648854 GACCAGCAAAGGCCTCTTTGAGG + Intergenic
917388453 1:174504391-174504413 GAATAGCCAAAGCAAACTTGAGG + Intronic
917534439 1:175864163-175864185 ACATAGGCAAGGCGACTTTGGGG + Intergenic
918012869 1:180603893-180603915 GACTAGCAGAGGCCAATTTGGGG - Intergenic
918613159 1:186514564-186514586 GAGTAGGAAAGGCCACTGTGGGG - Intergenic
920232939 1:204482268-204482290 GAATAGCCAAGGCCAGGGTTTGG - Intronic
922099111 1:222467698-222467720 GAAAACCCCAGGCCAGTTTGAGG - Intergenic
922401386 1:225260621-225260643 GAATAGCCAAAGCAATCTTGAGG - Intronic
922545083 1:226450643-226450665 GACTGGCCAAGACCACTCTGTGG - Intergenic
923806327 1:237261789-237261811 GAATTGCCAGGGCCTCATTGAGG - Intronic
924285271 1:242479705-242479727 GAATAGCCAAAATAACTTTGAGG + Intronic
924720910 1:246622129-246622151 GATTAGCCAAGGCCAAGATGTGG - Intronic
1063766833 10:9151376-9151398 GAAGAGCCAAGGCTGTTTTGAGG - Intergenic
1064127162 10:12672831-12672853 GAATAGCCAAAGCTATTTTAAGG - Intronic
1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG + Exonic
1069252611 10:66288849-66288871 CAATAGCCCAGGGCATTTTGAGG - Intronic
1070297471 10:75175029-75175051 GTATCCTCAAGGCCACTTTGTGG + Intronic
1071750617 10:88471575-88471597 GAGTTCCCAAGGCCACTTTCAGG + Intronic
1072016358 10:91350375-91350397 GAATATGCAAGTCCATTTTGAGG + Intergenic
1072434682 10:95404225-95404247 GGACAGCCAAGGACACCTTGAGG + Intronic
1073758857 10:106609354-106609376 CAATAGCAAAAGCCATTTTGAGG + Intronic
1074426736 10:113358174-113358196 AAATAGCAATGGCCCCTTTGTGG + Intergenic
1076377070 10:129997669-129997691 GAATAGCCAAAGCTACCCTGAGG + Intergenic
1076471819 10:130724317-130724339 GAATAGCCATGGGCATTTGGTGG + Intergenic
1080609517 11:33891971-33891993 GAATAGCAAAGCCCACTTAACGG + Exonic
1080776497 11:35391868-35391890 GGATATCCAAAGTCACTTTGGGG + Intronic
1081409019 11:42733736-42733758 GAATAGCCAAGACAATTTTAAGG + Intergenic
1081409299 11:42737818-42737840 GAATAGCCAAGACAATTTTAAGG - Intergenic
1082220642 11:49631628-49631650 GAATAGCCAAAGCAATTTTGAGG + Intergenic
1083067318 11:59938625-59938647 TAATAGCCAAGGACACATGGAGG + Intergenic
1085322804 11:75584956-75584978 GATAAGACAAGGCCACATTGAGG - Intergenic
1085951420 11:81337079-81337101 GAATTGCCAAGGGCAATTTGGGG - Intergenic
1086095928 11:83049906-83049928 GAATGGCCAATTCTACTTTGAGG - Intronic
1087453015 11:98348721-98348743 GAATAGACAAGACCTCTTTGTGG + Intergenic
1087678446 11:101189925-101189947 GAAGAGGCAAGGCCACTCTCTGG - Intergenic
1088771803 11:113042880-113042902 GAAAAGTCAAGGACACTTTCTGG - Intronic
1095915587 12:47474946-47474968 GGACAGCCAGGGCCAGTTTGGGG + Intergenic
1102132559 12:110543623-110543645 GAATAGCAAAGGACACTTCTGGG - Intronic
1102196277 12:111027503-111027525 GAACAGCCGAGGCAAGTTTGAGG - Intergenic
1103244145 12:119440744-119440766 GATTGGCCAAGGTCTCTTTGTGG - Intronic
1104068967 12:125328369-125328391 GAATAGCCAGGTCCCATTTGGGG - Intronic
1104190274 12:126475426-126475448 GAAAAAACAAGGACACTTTGAGG + Intergenic
1105334354 13:19451411-19451433 GAGTAGCCAAACACACTTTGTGG - Intronic
1106508611 13:30393374-30393396 GAATGGCCATGGGCATTTTGGGG + Intergenic
1106665705 13:31848105-31848127 CCTTAGCCAAGGCCATTTTGTGG + Intergenic
1107488506 13:40856002-40856024 GAGTAGCCAAATACACTTTGTGG - Intergenic
1108264600 13:48693916-48693938 GAATTGCAATGGCCACCTTGAGG - Intronic
1110024305 13:70514994-70515016 GAATAGCCAAGGTGATATTGAGG + Intergenic
1111010558 13:82308431-82308453 GAATAGCCAAAGCAATCTTGAGG - Intergenic
1113225186 13:108151982-108152004 GATTGGCCAGAGCCACTTTGTGG + Intergenic
1114720101 14:24872559-24872581 GACTAACAAAGGCCACTTTAGGG + Intronic
1114820651 14:26014961-26014983 GAATAGCCAAAGCCATCCTGAGG + Intergenic
1119255895 14:73196445-73196467 GAAGAGACATGACCACTTTGAGG + Intronic
1120426659 14:84356832-84356854 GAATAGCCAAAGCCATTTTGAGG + Intergenic
1125225431 15:37390024-37390046 GAATAGACAAGCCCATTTTCTGG - Intergenic
1125583402 15:40803487-40803509 AAATAGGTAAGGCCTCTTTGAGG + Intronic
1127031441 15:54868729-54868751 GAATAGCCAAAGCAATCTTGAGG + Intergenic
1127151123 15:56076381-56076403 AAAAAGCCAAGGTCAATTTGAGG - Intergenic
1127296225 15:57610897-57610919 GAGAAACCAAGGCCACTTTGGGG + Intronic
1127763159 15:62160691-62160713 GAATAGCCAGAGCAATTTTGAGG + Intergenic
1129176075 15:73840681-73840703 GCAGATCCAAGGCCACTCTGGGG + Intergenic
1130215897 15:81969241-81969263 GAAAGGACAAGGCAACTTTGTGG + Intergenic
1141690840 16:85595386-85595408 GAATGCCCAAGGCCCCTCTGCGG + Intergenic
1142646982 17:1320500-1320522 GAATAGCCAAGATAACTTTGAGG + Intergenic
1144836065 17:18157320-18157342 GACCAGCCCAGGCCACTTTCGGG - Intronic
1145804069 17:27713962-27713984 CAATAGCCCAGGGCATTTTGTGG - Intergenic
1146156575 17:30529466-30529488 GAATAGCCAAGACAACCTTGAGG - Intergenic
1150545507 17:66153681-66153703 GAATAGCCAAGGCAATCTTGAGG + Intronic
1154316618 18:13309311-13309333 GAATTCCCAAGGCCACTTGATGG - Intronic
1155333447 18:24740948-24740970 GAATTGCCATGGCCACTGTAGGG - Intergenic
1155346194 18:24859628-24859650 GTATAGACCAGGCCACCTTGAGG + Intergenic
1155495296 18:26436562-26436584 GAATAGCCAAGTTCCCTGTGGGG - Intergenic
1160288938 18:77572497-77572519 GAATGGCCAAGGTCCCTTTGGGG - Intergenic
1161898264 19:7099031-7099053 GAAAAGCCAAGGCCAATGGGAGG + Intergenic
1163239712 19:16053148-16053170 GAATGGCAAAGGCCATTCTGAGG - Intergenic
1163304448 19:16469088-16469110 GAATGGCCCAGACCACTTTGGGG + Intronic
1163873683 19:19847560-19847582 GAATAGCCAAAGCAAACTTGAGG + Intergenic
1163880527 19:19917174-19917196 GAATAGCCAAAGCAATCTTGAGG - Intronic
1163882366 19:19936605-19936627 GAATAGCCAAAGCAATCTTGAGG + Intergenic
1163917201 19:20251144-20251166 GAATAGCCAAAGCAATCTTGAGG - Intergenic
1163922013 19:20298451-20298473 GAATAGCCAAAGCAATCTTGAGG - Intergenic
1163970950 19:20794403-20794425 GAATAGCCAAAGCAATCTTGAGG - Intronic
1163984765 19:20935567-20935589 GAATAGCCAAAGCAATCTTGAGG - Intronic
1164014759 19:21243967-21243989 GAATAGCCAAAGCAATCTTGAGG + Intronic
1164028419 19:21376504-21376526 GAATAGCCAAAGCAATCTTGAGG - Intronic
1164113391 19:22192482-22192504 GAATAGCCAAAGCAATCTTGAGG + Intronic
1164197788 19:22986772-22986794 GAATAGCCAAGGAAATCTTGAGG + Intronic
1164297111 19:23921356-23921378 GAATAGCCAAAGCAATCTTGAGG - Intronic
1164632232 19:29769260-29769282 GTCTGGTCAAGGCCACTTTGGGG - Intergenic
927454747 2:23239765-23239787 GAAGAGCCAACGCTACTTAGAGG - Intergenic
932269600 2:70398123-70398145 GAATAGCCAGGGGAACTTTTGGG + Intergenic
937248328 2:120508488-120508510 CCACAGCCAAGCCCACTTTGGGG + Intergenic
941387586 2:164872097-164872119 TAATAGCAAAGGCCTCTTAGTGG - Intergenic
944678939 2:202058848-202058870 GAATAGCCAAAGCAATTCTGAGG + Intergenic
944861051 2:203816410-203816432 GAATGGGCAACGCCTCTTTGAGG - Intergenic
945057127 2:205878910-205878932 GAATATCCAAGGCCCTTGTGGGG + Intergenic
948108885 2:235438471-235438493 AAATAGCCATAGACACTTTGCGG + Intergenic
1171376788 20:24699362-24699384 GCATAGCCAAGGGTACTTAGAGG - Intergenic
1172346215 20:34202779-34202801 GAATAGCCAAGGCAATCTTGGGG - Intronic
1173398545 20:42703483-42703505 CCATAGCCAAGACCACTTTTAGG - Intronic
1173468958 20:43307468-43307490 GAAAAGCCAAGCCCACCTTTGGG + Intergenic
1176673322 21:9754017-9754039 GAAGAGGCAAGGCCTCTTGGGGG - Intergenic
1177137749 21:17324382-17324404 GAATAGCCAAAGCCACCCTAAGG + Intergenic
1178757727 21:35368456-35368478 GCAGAGCCAAGGCCAGTATGAGG + Intronic
1182057368 22:27370271-27370293 GAATAGGCAAAGCTACTGTGGGG - Intergenic
1182895606 22:33856808-33856830 AAATAGACAAGGCCCCTTTAAGG + Intronic
1183521614 22:38298952-38298974 GGATAGAGAAGGCCACTGTGAGG + Intronic
1184752331 22:46494284-46494306 GAATAGCCAAGGCCACTTTGAGG - Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
951839316 3:27016723-27016745 GAGTAGACAAGGCCATTTTTGGG - Intergenic
952287641 3:31983503-31983525 GAATAGTCAAGGCCAGGATGGGG + Intronic
952335413 3:32399495-32399517 GAATTGCCCAGGCCTCTTAGAGG - Intronic
952704992 3:36368162-36368184 GACTAGCCAGAGCCACTTGGTGG - Intergenic
953211065 3:40875678-40875700 GAATAGCAAGAGCCACATTGTGG + Intergenic
953268053 3:41412467-41412489 GAATAGCCAAAGCAAATCTGAGG + Intronic
953423700 3:42774614-42774636 GAATAGCCAGGTCTACTTAGAGG + Intronic
956650687 3:71501862-71501884 GAAAAGACAAGGCCATCTTGAGG - Intronic
957744402 3:84320110-84320132 GAATAGGCAAGGACAAATTGGGG + Intergenic
957776222 3:84759629-84759651 GGCTTGCCAAGGCCACTGTGGGG - Intergenic
960662462 3:120075908-120075930 GAACAGCCAAGGCAATTCTGAGG + Intronic
962799558 3:138878673-138878695 GAATGGCCAAGGTCTCTATGAGG - Intergenic
968836568 4:2969198-2969220 GAATTTCAAAGGCAACTTTGAGG - Intronic
968882941 4:3310443-3310465 GAATCACCAAGGCCACTTCCAGG - Intronic
969176622 4:5403670-5403692 GGATGGCCATGGCCATTTTGGGG - Intronic
970027566 4:11639701-11639723 GAATAACCAAGGGCAGTTTGGGG + Intergenic
970163607 4:13213828-13213850 GAATAGCCTGGCCCATTTTGAGG - Intergenic
973931582 4:55798232-55798254 GATTTGCCAGGGCCATTTTGTGG - Intergenic
974129484 4:57735724-57735746 GCATAGCCATGGGCATTTTGTGG + Intergenic
974267649 4:59605463-59605485 GAATAGCCAAGGCCATGCTGAGG + Intergenic
974349683 4:60728697-60728719 AAATAGCCAAAGCAACCTTGAGG - Intergenic
975935379 4:79573188-79573210 GTATAGCCCAGGCCAGTATGAGG - Intergenic
976999318 4:91476582-91476604 AAATAGCCAAAGCAATTTTGAGG + Intronic
977797023 4:101178674-101178696 GAATAGACATGGCCTTTTTGAGG - Intronic
978204156 4:106059674-106059696 GAACACCAAAGGCCATTTTGAGG - Intronic
978365670 4:107978897-107978919 GAAAACCCAAGGCCACATTTGGG + Intergenic
978893706 4:113859467-113859489 AAATAGCCAAGGCAATTTTGAGG - Intergenic
979329239 4:119408038-119408060 GGCTAGGAAAGGCCACTTTGCGG + Intergenic
980919185 4:139065278-139065300 GAATAGCCTAGGCAACATAGGGG + Intronic
983770453 4:171542114-171542136 GACCAGCCAAAGCCAGTTTGTGG - Intergenic
983889786 4:173018810-173018832 GAACAGCAAAGGCCAGATTGTGG + Intronic
986131214 5:4933270-4933292 AAATAGCCAAGACAATTTTGAGG - Intergenic
990445351 5:55888793-55888815 GAAGAGGCAATGACACTTTGGGG - Intronic
992525308 5:77604033-77604055 GAATAGCCAAAGCGATCTTGAGG - Intronic
993070632 5:83158601-83158623 GAATAGACAAAGACAATTTGAGG + Intronic
998559176 5:143155187-143155209 GAATCCCCAAGGGCACTGTGGGG - Intronic
998998702 5:147895589-147895611 TAATAGGCAAGGCCACATGGAGG - Intronic
999274547 5:150320693-150320715 GGAGAGTCAAGGGCACTTTGGGG - Intronic
1001736879 5:174012539-174012561 GAATAGCCAAAACAATTTTGGGG - Intergenic
1003018528 6:2488808-2488830 GACTGGCCAAAGCCACTCTGTGG - Intergenic
1005486317 6:26303620-26303642 CAACAGGCAAGGACACTTTGTGG + Intergenic
1008237421 6:49067036-49067058 GAATAGCCAATGCCATCCTGAGG + Intergenic
1011708772 6:90029797-90029819 GGATAGGCAAGGCGACCTTGAGG - Intronic
1013984654 6:116176052-116176074 GAAGAGGCAAGTCCATTTTGAGG - Intronic
1016127327 6:140420927-140420949 GAATAGAAAAGGCAATTTTGAGG - Intergenic
1020795157 7:12669667-12669689 TATTTGCCAAAGCCACTTTGGGG - Intergenic
1023124522 7:36942224-36942246 GAATAGTAAAGGCCACTGGGAGG + Intronic
1023962280 7:44937025-44937047 GAATAGCCAAGGAAACTTTGTGG + Intergenic
1025717691 7:63977612-63977634 GAATAGCCAAGGCAGTTTTGAGG + Intergenic
1025804362 7:64816158-64816180 GAATAGCCAAAGCAATCTTGAGG - Intronic
1025816613 7:64919124-64919146 GAATAGCCAAAGCAATCTTGAGG - Intronic
1031097191 7:117434425-117434447 GGATAGCCCAGGCCTCTCTGGGG - Intergenic
1031892660 7:127312974-127312996 GAATAGCCAAAGCCATCCTGAGG + Intergenic
1033904650 7:146187417-146187439 GAATATCCTTGGCTACTTTGTGG - Intronic
1034541464 7:151761108-151761130 GAATGACCAAGGACACTTGGAGG - Intronic
1034759186 7:153655207-153655229 GAATTGCAATGGCTACTTTGGGG + Intergenic
1035465883 7:159076201-159076223 GAACTGCCATGGCCACTTTGGGG + Intronic
1035664606 8:1371818-1371840 GAATAGTCAAGCCCACTTCCAGG - Intergenic
1042592396 8:70409241-70409263 GAATAGCCAAGACAAACTTGAGG + Intergenic
1046250469 8:111624275-111624297 GAAGAGCCGGGGCCACTTAGCGG - Intergenic
1048292806 8:133193279-133193301 GAATTGCCAAGAAAACTTTGAGG + Intronic
1049772639 8:144390855-144390877 GAACAGCCCAGGCTACTTGGAGG + Exonic
1050782784 9:9359323-9359345 GAATAGGAAAGGACACTTCGGGG + Intronic
1054837524 9:69693622-69693644 GAATAGCCAAAGCAATTCTGAGG - Intergenic
1057039216 9:91835279-91835301 GAGGAGCCAAGGCTATTTTGGGG - Intronic
1058241337 9:102565244-102565266 GAATAGTCAAGGCCACATTCTGG - Intergenic
1060496501 9:124123216-124123238 TAAGAGCCAGGGCCACTGTGAGG + Intergenic
1186248555 X:7640964-7640986 AAATAGCAAATGACACTTTGAGG + Intergenic
1188531793 X:31149403-31149425 GAATAGTCAAGACAATTTTGAGG - Intronic
1189055769 X:37698151-37698173 GAATAGAGAAGGGCACTGTGAGG - Intronic
1189336947 X:40176083-40176105 GAGTAGCGCACGCCACTTTGGGG + Intronic
1190635090 X:52425476-52425498 GAATATCTTCGGCCACTTTGGGG - Intergenic
1193305106 X:79940384-79940406 GAATAGCCAAAGCAATTATGAGG - Intergenic
1194507815 X:94754576-94754598 CAATAGGCAATGCCACTGTGGGG + Intergenic
1195083063 X:101388793-101388815 GAAAAGCCAAGGTGACATTGAGG + Intronic
1195241226 X:102954223-102954245 AAATAGCCAAGGCAATTCTGAGG - Intergenic
1195701543 X:107709292-107709314 GAATGGCAAAGCCCACATTGGGG - Intergenic
1197014271 X:121604895-121604917 CAAATGCCAAGGCCACTTAGAGG + Intergenic
1197473686 X:126893826-126893848 GAATAACCAAAGCCATCTTGAGG - Intergenic
1199926134 X:152466203-152466225 GAATAGCCAAAGCAATCTTGAGG + Intergenic
1202597452 Y:26556780-26556802 GAGTAGCCAAACACACTTTGTGG + Intergenic