ID: 1184755322

View in Genome Browser
Species Human (GRCh38)
Location 22:46512613-46512635
Sequence TGACATCTGCTGAAGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184755318_1184755322 -3 Left 1184755318 22:46512593-46512615 CCCAATACTATGCATTGCCTTGA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1184755322 22:46512613-46512635 TGACATCTGCTGAAGCCAGGAGG No data
1184755316_1184755322 25 Left 1184755316 22:46512565-46512587 CCATCTCAACAACAACAAAAAAT 0: 18
1: 190
2: 567
3: 6704
4: 117474
Right 1184755322 22:46512613-46512635 TGACATCTGCTGAAGCCAGGAGG No data
1184755319_1184755322 -4 Left 1184755319 22:46512594-46512616 CCAATACTATGCATTGCCTTGAC No data
Right 1184755322 22:46512613-46512635 TGACATCTGCTGAAGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184755322 Original CRISPR TGACATCTGCTGAAGCCAGG AGG Intronic
No off target data available for this crispr