ID: 1184757324

View in Genome Browser
Species Human (GRCh38)
Location 22:46524426-46524448
Sequence GTTGTCATGGGGATTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184757324_1184757334 3 Left 1184757324 22:46524426-46524448 CCCTGCACAATCCCCATGACAAC 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1184757334 22:46524452-46524474 AAGGGGCGAAGTCGGTGTGTCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1184757324_1184757338 15 Left 1184757324 22:46524426-46524448 CCCTGCACAATCCCCATGACAAC 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1184757338 22:46524464-46524486 CGGTGTGTCGGGCGGCTGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 98
1184757324_1184757335 4 Left 1184757324 22:46524426-46524448 CCCTGCACAATCCCCATGACAAC 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1184757335 22:46524453-46524475 AGGGGCGAAGTCGGTGTGTCGGG 0: 1
1: 0
2: 0
3: 8
4: 57
1184757324_1184757337 11 Left 1184757324 22:46524426-46524448 CCCTGCACAATCCCCATGACAAC 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1184757337 22:46524460-46524482 AAGTCGGTGTGTCGGGCGGCTGG No data
1184757324_1184757336 7 Left 1184757324 22:46524426-46524448 CCCTGCACAATCCCCATGACAAC 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1184757336 22:46524456-46524478 GGCGAAGTCGGTGTGTCGGGCGG No data
1184757324_1184757333 -5 Left 1184757324 22:46524426-46524448 CCCTGCACAATCCCCATGACAAC 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1184757333 22:46524444-46524466 ACAACTGGAAGGGGCGAAGTCGG 0: 1
1: 0
2: 1
3: 11
4: 123
1184757324_1184757339 20 Left 1184757324 22:46524426-46524448 CCCTGCACAATCCCCATGACAAC 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1184757339 22:46524469-46524491 TGTCGGGCGGCTGGAAGGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184757324 Original CRISPR GTTGTCATGGGGATTGTGCA GGG (reversed) Intronic
904200960 1:28818773-28818795 GTTCTCATGGGGATGGTGAGAGG + Intronic
905182563 1:36176104-36176126 CTTGGCATGGGGATGGTGCCTGG + Intronic
906499949 1:46334390-46334412 GTTGTGATGGTTTTTGTGCAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914909833 1:151776003-151776025 GTTGTCAGGGGGATTTGGAAGGG - Intronic
916192704 1:162194644-162194666 GCTGTCCTGGGGATTTGGCAAGG + Intronic
918104749 1:181407167-181407189 GTTGTTATGGTGACTGTTCAAGG - Intergenic
921704168 1:218301964-218301986 GTTGGCATGGAGTTGGTGCAAGG - Intronic
923109696 1:230880631-230880653 GTTCACATGGGCATTGTGGAAGG - Intergenic
923546046 1:234923949-234923971 GTGTTCATGGGGGTGGTGCATGG - Intergenic
1062954142 10:1529287-1529309 TTTGTGTTGGGGATGGTGCATGG - Intronic
1062954149 10:1529323-1529345 TTTGTGTTGGGGATGGTGCATGG - Intronic
1066193469 10:33076938-33076960 GTAATCTTGGGGATTGTGCAAGG - Intergenic
1070780424 10:79134397-79134419 GTTGTCAGGAGGAATTTGCAGGG + Intronic
1073342074 10:102752927-102752949 GTTGTCATGGGTATCTTGCATGG + Intronic
1074105840 10:110389152-110389174 GTTGTCATGAGGAGTGTGAGGGG + Intergenic
1075961159 10:126568639-126568661 TAAGGCATGGGGATTGTGCAGGG + Intronic
1076749302 10:132534429-132534451 GTTGTGATGGTCTTTGTGCACGG - Intergenic
1078470384 11:11581536-11581558 GGTGTCATGGGGAGGGGGCAGGG - Intronic
1079331881 11:19540442-19540464 GTACTCATGGTGATTCTGCAAGG + Intronic
1079365114 11:19802253-19802275 CTTGGCATGGAGCTTGTGCAAGG + Intronic
1080224359 11:29944004-29944026 TTTGTCATGGGGATTAAGCCAGG - Intergenic
1082683448 11:56208454-56208476 GTTGTGATGGCCTTTGTGCAAGG - Intergenic
1084906067 11:72348618-72348640 GCTGTCATGGGGAATGAGGAGGG - Intronic
1086454627 11:86948897-86948919 GGTGTCTTGGGAGTTGTGCAGGG - Exonic
1087464099 11:98483779-98483801 GTTGACATGGCCTTTGTGCAAGG + Intergenic
1089341640 11:117762008-117762030 GTTGTTGTGTGGAATGTGCAGGG - Intronic
1089744624 11:120608018-120608040 GAGGTCATGGGGCTTTTGCAGGG + Intronic
1090246184 11:125217514-125217536 GTTGTTGTGGGGAATGTGCATGG + Intronic
1091829091 12:3536521-3536543 GCTGGCCTGGGCATTGTGCACGG - Intronic
1092993253 12:13923874-13923896 GTTGTCATGGAGACAGTGTAGGG - Intronic
1094595786 12:31865231-31865253 GTTGTCCTGGGGACTGTGCCAGG + Intergenic
1095170536 12:39030005-39030027 GTTGTGATGGCGTTTGTGCGAGG - Intergenic
1096178066 12:49536111-49536133 GGTGACATGGGCATTGTGCCTGG + Intergenic
1096401647 12:51312239-51312261 GTTGTGATGGCCTTTGTGCAAGG - Intronic
1098786340 12:74761518-74761540 GTTGTAATGGCCTTTGTGCAAGG - Intergenic
1101318294 12:103649892-103649914 TTTGTCATGGGGAAGGTGAAAGG - Intronic
1102653511 12:114460861-114460883 GTTGTTATGGGGATTGAACAAGG + Intergenic
1105211084 13:18257509-18257531 GGTGGCATGGGGATAGAGCAGGG + Intergenic
1105403399 13:20114664-20114686 GTTGTCATGGGCAGTCTGCATGG - Intergenic
1109552477 13:63921410-63921432 CTTGTCATGGCCTTTGTGCAAGG + Intergenic
1112596225 13:100809706-100809728 GTTGTGATGGTCTTTGTGCAAGG + Intergenic
1113538588 13:111088027-111088049 GTTGTGATGGCCTTTGTGCAAGG - Intergenic
1113894581 13:113755453-113755475 CCTGGCATGGGGAATGTGCAGGG - Intergenic
1114505095 14:23204794-23204816 ATTTTGATGGGGATTGTGTATGG + Intronic
1116046992 14:39755497-39755519 TTTGTCATGAGGATTATGTAAGG - Intergenic
1118457509 14:65958237-65958259 GTCTTCATGGGGCTTATGCAGGG - Intronic
1119971453 14:78975267-78975289 GTGGTCATGGGGAGTGCTCAGGG + Intronic
1120120061 14:80668103-80668125 ACTGTTGTGGGGATTGTGCAAGG - Intronic
1120897738 14:89549419-89549441 GTTGTAATTGGGATTGTTGAAGG - Intronic
1121497577 14:94405138-94405160 GTTGTGATGGCCTTTGTGCAAGG + Intergenic
1122752764 14:103950863-103950885 GTTGTGATGGCCTTTGTGCAAGG - Intronic
1123831479 15:24143354-24143376 GTTGTCATGTGAATTTTTCATGG + Intergenic
1123845680 15:24299163-24299185 GTTGTCATGTGAATTTTTCATGG + Intergenic
1123864715 15:24506872-24506894 GTTGTCATGTGAATTTTTCATGG + Intergenic
1129003651 15:72354441-72354463 ATTTTCATGGGGCTTCTGCAGGG - Intronic
1131262173 15:90893173-90893195 ATCGTCATGGAGCTTGTGCAGGG + Exonic
1131799107 15:96051575-96051597 GTTGTTATGAGGATTATGCCAGG + Intergenic
1131986053 15:98043807-98043829 GTTTCCATGGTGATTGTGTAAGG - Intergenic
1132350565 15:101137247-101137269 GATGTGATGGGGACTGAGCAGGG + Intergenic
1133649672 16:7799870-7799892 GTTGTCTTGGGTAGTGTGCTAGG - Intergenic
1134609777 16:15598817-15598839 GTTGTCATGGGGATTTTCTTCGG - Intronic
1134843094 16:17416995-17417017 GTAGTCCTGGGAATTGTGAAGGG - Intronic
1141227307 16:82130076-82130098 GTTGTGATGGCCTTTGTGCAAGG - Intergenic
1141378586 16:83554649-83554671 GTTGTGATGGCCTTTGTGCAAGG - Intronic
1141735767 16:85851564-85851586 GTGGTGATGGGGTGTGTGCAAGG - Intergenic
1145714733 17:27009007-27009029 ATTTTCGTGGGCATTGTGCACGG - Intergenic
1148391227 17:47274663-47274685 GCTGTCATGGGGATGTTGCTGGG + Intronic
1150970466 17:70021342-70021364 GTTGTCATGGAGATTACACAAGG - Intergenic
1154404921 18:14081533-14081555 GTTGTGATGGCCTTTGTGCAAGG + Intronic
1156059674 18:33058680-33058702 GATGTCATGGGTTTTGTGAAAGG + Intronic
1156302903 18:35850790-35850812 GTTGTGATGGCCTTTGTGCAAGG + Intergenic
1156616604 18:38793221-38793243 GTTTTCATGGAGATTGTTCCTGG + Intergenic
1156954825 18:42949548-42949570 GTTGTGATGGCCTTTGTGCAAGG + Intronic
1158674941 18:59509893-59509915 GATGTCATGGGGATGGTCTAAGG + Intronic
1158856039 18:61544110-61544132 GATGGCATGGAGACTGTGCAGGG + Intronic
1160570949 18:79817542-79817564 GTTGTCATGTGGTTTGCACATGG + Intergenic
1160757704 19:766322-766344 CTTGGCAGGGGGCTTGTGCAGGG - Intergenic
1162001037 19:7745236-7745258 GTTCTCATGGGGATGGGGGAGGG - Intronic
1165061687 19:33207932-33207954 GTTGTCATGAGGATGGGGCCGGG + Exonic
1166519137 19:43468152-43468174 GTGGTCTTGGGAATGGTGCAAGG - Intergenic
1166545848 19:43634696-43634718 GTCGTCATGGGGATGGTGCTTGG + Intronic
1168246087 19:55113806-55113828 GTTGTCATGGCGATAGGGGAGGG + Intronic
925098082 2:1223565-1223587 GTTGTAATGGGGAGGGTGCCAGG - Intronic
927047311 2:19292250-19292272 GCTGTCGTGGTGATTGTGCATGG - Intergenic
927103293 2:19804473-19804495 GTTATCTGTGGGATTGTGCAGGG - Intergenic
927300890 2:21512929-21512951 GTTGTGATGGCAGTTGTGCAAGG - Intergenic
934553890 2:95277496-95277518 GGTGCCAGGGAGATTGTGCAGGG + Exonic
935802109 2:106708112-106708134 GTTGTGATGGTCTTTGTGCAAGG + Intergenic
936006515 2:108893702-108893724 ATTGTCATGGCCTTTGTGCAAGG - Intergenic
938101032 2:128498382-128498404 GTTCTCATCGGGACTGTGGAGGG - Intergenic
939285197 2:140120744-140120766 GTTGTGATGGTCTTTGTGCAAGG + Intergenic
940195469 2:151089531-151089553 GTTACCATTGGAATTGTGCAGGG - Intergenic
941747738 2:169104876-169104898 GTTGTGATGGCCTTTGTGCAAGG + Intergenic
942307168 2:174619967-174619989 GTTGTCAAGGGTATGGTGAATGG - Intronic
943328579 2:186531549-186531571 GTTCTGAGGTGGATTGTGCAGGG + Intergenic
943587972 2:189762790-189762812 GATGTCATCGGAACTGTGCAAGG + Intronic
944630679 2:201620698-201620720 GTTGTGATGGCCTTTGTGCAAGG + Exonic
949058296 2:241941846-241941868 GCTGTCATGGGCATGGTGCCTGG + Intergenic
1169609181 20:7360208-7360230 CTTGTCATGTGGACTGTTCAAGG + Intergenic
1169628196 20:7596724-7596746 GTTGCCATGGGGATAGGGGAGGG - Intergenic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1172030055 20:31975350-31975372 GTTGTCATGTGGGTAGAGCAGGG - Intronic
1173657003 20:44706380-44706402 GTTGTCATAGGGATCATGCCAGG - Intergenic
1174126239 20:48309110-48309132 TTTGTCATGTGTATTGGGCATGG - Intergenic
1177940733 21:27408437-27408459 GTGGTTCTGGGGATTCTGCAAGG + Intergenic
1178318761 21:31588888-31588910 GTTATCATGGCCATTGTGCTAGG - Intergenic
1179085011 21:38208163-38208185 GTTAACATGCAGATTGTGCAGGG + Intronic
1180210023 21:46289904-46289926 GTTGTCATAGCCTTTGTGCAAGG + Intronic
1180210026 21:46289950-46289972 GTTGTCATAGCCTTTGTGCAAGG + Intronic
1180210029 21:46289998-46290020 GTTGTCATAGCCTTTGTGCAAGG + Intronic
1180765160 22:18341927-18341949 GGTGGCATGGGGATAGAGCAGGG - Intergenic
1180813870 22:18777757-18777779 GGTGGCATGGGGATAGAGCAGGG + Intergenic
1181200055 22:21212092-21212114 GGTGGCATGGGGATAGAGCAGGG + Intronic
1181701680 22:24624867-24624889 GGTGGCATGGGGATAGAGCAGGG - Intronic
1183503344 22:38194428-38194450 GTGGGCATGGGGATTCTGGAAGG + Intronic
1184417905 22:44362901-44362923 TTTGCCATGGGCATTGAGCATGG - Intergenic
1184757324 22:46524426-46524448 GTTGTCATGGGGATTGTGCAGGG - Intronic
1184776764 22:46627271-46627293 GTTGACATGCGGATGGAGCAGGG + Intronic
1185036785 22:48482918-48482940 GTTGTCAATGGGAATGTGCCAGG - Intergenic
1203226781 22_KI270731v1_random:82832-82854 GGTGGCATGGGGATAGAGCAGGG - Intergenic
1203263969 22_KI270734v1_random:3444-3466 GGTGGCATGGGGATAGAGCAGGG + Intergenic
950944329 3:16928993-16929015 GTTGTGAATGGGATTGGGCAGGG + Intronic
952206515 3:31185815-31185837 ATAGTCCTGGGGATTATGCAAGG - Intergenic
952742326 3:36746656-36746678 GTTGTCATGGGGTGTCTGTAGGG - Intergenic
953699914 3:45187522-45187544 GTGGGCATGGGCATGGTGCAGGG + Intergenic
955358638 3:58252988-58253010 CTTGTCAGGGAGAGTGTGCAGGG + Intronic
955651370 3:61197777-61197799 TGTGTCATGGGGATTGTTAAGGG - Intronic
956350878 3:68335035-68335057 CTTGTCAAGGTGATTGTGCATGG + Intronic
956725967 3:72156712-72156734 GCTGCCATGTGGATAGTGCATGG + Intergenic
956841014 3:73140330-73140352 GTTGTCATGGCCTTTGCGCAAGG + Intergenic
957089013 3:75709650-75709672 GTTGTCACGGACTTTGTGCAAGG + Intronic
960071783 3:113439354-113439376 GTTGTGATGGCTTTTGTGCAAGG - Intronic
960935869 3:122901635-122901657 TTTGTCATGGATATTGTACATGG + Intergenic
961179826 3:124867743-124867765 GTTGTCATGAGGAATGTGCCTGG - Intronic
961237249 3:125377585-125377607 GTTGTGATGGCCTTTGTGCAAGG + Intergenic
966716942 3:183022056-183022078 GTTGTCAGGGGGATGGTGGGTGG + Intronic
966725685 3:183106114-183106136 GTTGTGATGGCCTTTGTGCAAGG - Intronic
970073056 4:12184227-12184249 GTGATCATGAGGATTGTGAATGG - Intergenic
970797000 4:19924582-19924604 GTTGTGATGGCCTTTGTGCAAGG - Intergenic
971888603 4:32486177-32486199 GCTGTTTTGGGGACTGTGCAGGG - Intergenic
972762988 4:42124987-42125009 ATTCTCATGGGGATTGTCCATGG + Intronic
974017109 4:56657375-56657397 GTTGTGATGTGGTTTGTGCCTGG + Intronic
978644562 4:110914862-110914884 GTTGTGACGGTGTTTGTGCATGG + Intergenic
979059371 4:116037431-116037453 GTTGTGATGGCCTTTGTGCAAGG - Intergenic
979099125 4:116592931-116592953 GTTGTGATGGTCTTTGTGCAAGG + Intergenic
980294175 4:130888824-130888846 GTTGTGATGGTCTTTGTGCAAGG + Intergenic
980534638 4:134101496-134101518 GTTGTCATGGGTATTTTACTTGG + Intergenic
982185438 4:152792618-152792640 GTTGTCATGGAGACTCTGAAGGG + Intronic
982908436 4:161108271-161108293 CTTGGAATGGGGATTTTGCAGGG + Intergenic
982971941 4:161999819-161999841 GTTTTCATGTGAATTGTCCAAGG - Intronic
984699642 4:182810490-182810512 GTGGTGATAGGGAGTGTGCATGG - Intergenic
985701129 5:1373474-1373496 GTTGTAATGGGGTTTGTGAAGGG + Intergenic
989218692 5:38930969-38930991 GTTGTGATGGCCTTTGTGCAAGG + Intronic
989536809 5:42573522-42573544 GGTGTCAGGGGGATGGTGCTGGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
992321667 5:75619234-75619256 GTTGTGATGGCGTTTGTGCAAGG - Intronic
993870819 5:93252298-93252320 GTTCTCATGGTGATGGTGAAAGG + Intergenic
996400705 5:123059240-123059262 GATGCCATGGGGATTGAGCTGGG - Intergenic
997117392 5:131139749-131139771 GTTGTGATGGCCTTTGTGCAAGG - Intergenic
997250309 5:132383954-132383976 TTTGTCATGGGGAGTGGGGAGGG + Intronic
999410401 5:151345223-151345245 GTTCTCATGGGGAATTTCCAAGG - Intronic
1000744482 5:165016149-165016171 GATCTCATGGGGATTCTGCAGGG - Intergenic
1001852863 5:174984804-174984826 GAAGTCATGAGGATTGTGCTTGG + Intergenic
1001862590 5:175070767-175070789 GTTGTAATGGTCTTTGTGCAAGG - Intergenic
1006130455 6:31865914-31865936 GATGTCCTGGGGCTTGTGGAAGG + Exonic
1010337530 6:74704388-74704410 GTTGGCATGGGGGTTCTGGAAGG + Intergenic
1010762525 6:79739892-79739914 GTTGGCAAAGGCATTGTGCATGG - Intergenic
1011591675 6:88975969-88975991 GTTGTGATGGCCTTTGTGCAAGG - Intergenic
1015262339 6:131252467-131252489 GTTTCCATGGGGAGTGTGAACGG - Intronic
1018122603 6:160650889-160650911 GTGGTCTAGGGAATTGTGCAAGG - Intronic
1018753407 6:166827227-166827249 GTTGTGATGGCCTTTGTGCAAGG - Intronic
1019202128 6:170326592-170326614 GTTGTGACGGGGACTGTGGAAGG - Intronic
1019213774 6:170426839-170426861 GTTGCAATGGCGTTTGTGCAGGG + Intergenic
1021023252 7:15630740-15630762 GTAGGCATAGGGATTGTGGATGG + Intronic
1021276034 7:18652600-18652622 GTTGTCAAGGGGATGGGGCATGG - Intronic
1021893054 7:25206084-25206106 GATTTCATGGAGATTGTGGAGGG + Intergenic
1021971269 7:25967946-25967968 GTTTTCATGCAGATTGTGAATGG - Intergenic
1022280389 7:28902849-28902871 GGTGTGATGAAGATTGTGCAGGG - Intergenic
1024007141 7:45233065-45233087 GTTGTGATGGACTTTGTGCAAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1031599971 7:123695245-123695267 CTTGTGCTGGGCATTGTGCAAGG - Intronic
1032220056 7:129987853-129987875 GTTGTCATGGGGAGGGCGCTAGG - Intergenic
1033200966 7:139369792-139369814 CTTGTCATGGGGATTATGGTGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034272331 7:149809271-149809293 GTGGTCATGGGGACTGCACAAGG - Intergenic
1034546612 7:151793731-151793753 GTGGTTTTGGGGATTGCGCAAGG - Intronic
1037271548 8:17136086-17136108 GTTGTGTTGGAGATTGTGCTAGG - Intergenic
1038353083 8:26798796-26798818 TTTGTCATGGGGATGGTGGTAGG - Intronic
1038416873 8:27403304-27403326 GTTGCCATGTGGACTGTTCAGGG - Intronic
1039704221 8:39990492-39990514 GTTGTGATGGCCTTTGTGCAAGG - Intronic
1040932675 8:52751261-52751283 GTTGTGATGGCCTTTGTGCAAGG + Intergenic
1041905169 8:63025008-63025030 GTTCTCATAGGGATTTTGCAAGG - Intronic
1042353499 8:67801478-67801500 GTTTTCACGGGGTTTGTGCCTGG + Intergenic
1043661487 8:82747921-82747943 GTTGTCATGTGGGCTGGGCACGG + Intergenic
1046536370 8:115517497-115517519 GATGTCATAGGGGTTCTGCAGGG + Intronic
1046590705 8:116202825-116202847 GGTGTCATGGGGATGGTTAACGG - Intergenic
1048212972 8:132471412-132471434 ATTGCCAAGGGGAGTGTGCATGG + Intronic
1050461660 9:5882527-5882549 GTTGTGATGGCCTTTGTGCAAGG - Intronic
1050607622 9:7317779-7317801 GTTTTCATGGGGTTTGAGAAGGG - Intergenic
1052368093 9:27636166-27636188 GTTGTGATGGCCTTTGTGCAAGG - Intergenic
1056262187 9:84860013-84860035 GTTGTCATGATGATTGTTCAAGG - Intronic
1058144961 9:101400358-101400380 GTTGTCCTTGGGATAGTGCCAGG - Intronic
1059978632 9:119744804-119744826 TTTGTCCTGGGCATTGTGCAGGG - Intergenic
1061740209 9:132697924-132697946 GTTGCAATGGAGTTTGTGCAAGG - Intergenic
1061920301 9:133778852-133778874 GTTGCCATGGTAATTCTGCATGG + Exonic
1062652814 9:137587026-137587048 GTTGTCCAGGCGATTGTCCACGG + Exonic
1203488579 Un_GL000224v1:82316-82338 GTTGTCATGGACTTTGTGCAAGG - Intergenic
1203501200 Un_KI270741v1:24212-24234 GTTGTCATGGACTTTGTGCAAGG - Intergenic
1186089075 X:6024700-6024722 GCTGTCATGGTGCTTGTGGAAGG - Intronic
1186927821 X:14354645-14354667 GTTGTCATGGTGACTGGGGAAGG + Intergenic
1189123592 X:38422429-38422451 GGTGTCATATGGATTGTGGAAGG + Intronic
1189526508 X:41828054-41828076 GTCCTCATGGGGCTGGTGCAGGG - Intronic
1191900540 X:66035706-66035728 GTTTTCATGGGGTTTAAGCATGG - Intronic
1193633821 X:83924334-83924356 GCTGTTATGGGGGTAGTGCAAGG + Intergenic
1196798242 X:119519624-119519646 GTTGCAATGGCCATTGTGCAAGG + Intergenic
1196935448 X:120726067-120726089 GTTGTGATGGCCTTTGTGCAAGG + Intergenic
1197085308 X:122466980-122467002 TTTGTCATAGGCATTGTGCTAGG - Intergenic
1197726899 X:129782462-129782484 GTTGTCGTGGGGAGTGAACAAGG - Intronic
1200423699 Y:2999526-2999548 TTTGTGATGGACATTGTGCAAGG - Intergenic