ID: 1184757687

View in Genome Browser
Species Human (GRCh38)
Location 22:46526161-46526183
Sequence ATGGAGGAGCAGGAGGCGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1990
Summary {0: 1, 1: 1, 2: 12, 3: 244, 4: 1732}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184757687_1184757698 25 Left 1184757687 22:46526161-46526183 CCGTCCGCCTCCTGCTCCTCCAT 0: 1
1: 1
2: 12
3: 244
4: 1732
Right 1184757698 22:46526209-46526231 AGAGGCAGAAGTTACTGTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 212
1184757687_1184757697 7 Left 1184757687 22:46526161-46526183 CCGTCCGCCTCCTGCTCCTCCAT 0: 1
1: 1
2: 12
3: 244
4: 1732
Right 1184757697 22:46526191-46526213 AGGTCTGATGACTCAGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184757687 Original CRISPR ATGGAGGAGCAGGAGGCGGA CGG (reversed) Intronic
900038797 1:439841-439863 TCGGAGGAGCAGGAGGAGTAAGG + Intergenic
900100512 1:960276-960298 CCGGAGGAGGAGGAGGAGGAGGG + Intergenic
900113698 1:1019978-1020000 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900204460 1:1426149-1426171 ACGGAGGAGGAGGAGGGGGGAGG + Exonic
900264968 1:1752908-1752930 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900467026 1:2830868-2830890 ATGAAGCAGCAGCAGGCGGCGGG - Intergenic
900522302 1:3111551-3111573 AAGGAAGAGAAGGAGGAGGAAGG + Intronic
900572122 1:3363795-3363817 AAGAAGGAGAAGGAGGAGGAAGG + Intronic
900626363 1:3610473-3610495 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
900725557 1:4214204-4214226 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901060373 1:6469120-6469142 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
901105041 1:6748690-6748712 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901105382 1:6751857-6751879 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
901142003 1:7041048-7041070 GTGTGGGCGCAGGAGGCGGAGGG + Intronic
901160687 1:7174705-7174727 GTGGACGAGCAGGAGGCAGGTGG + Intronic
901241075 1:7693821-7693843 CTGGAGGAGCTGGAGAGGGAGGG - Intronic
901414640 1:9108257-9108279 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
901429130 1:9201780-9201802 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
901458986 1:9380313-9380335 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
901634704 1:10665130-10665152 CTGGAGGAGAAGGATTCGGACGG - Exonic
901751705 1:11413945-11413967 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
901938492 1:12644446-12644468 AGTGAGGTGGAGGAGGCGGAGGG + Intergenic
902054295 1:13587470-13587492 ACGGGGGAGGAGGAGGAGGAGGG + Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902614909 1:17618489-17618511 ACAGAGGAGGAGGAGGAGGAGGG - Intronic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
902711495 1:18243045-18243067 AGGCAGGAGGAGGAGGCTGAGGG + Intronic
902722740 1:18314942-18314964 ATGGAGGTGCAGGAGGGAAAGGG + Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
902985071 1:20149975-20149997 AGGGTGGAGAAGGAGGCAGAAGG + Exonic
903187450 1:21636849-21636871 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903570107 1:24297931-24297953 AAGCAGGAGGAGGAGGAGGAGGG + Intergenic
903831371 1:26177351-26177373 AGGGCCGGGCAGGAGGCGGACGG + Intergenic
903944196 1:26951497-26951519 CTGGATGAGCAGGATGCTGAGGG - Exonic
903947464 1:26972675-26972697 ATGGAAGGGATGGAGGCGGAAGG + Intergenic
904014604 1:27409920-27409942 GTGGTGGAGGAGGAGGTGGAGGG + Exonic
904014641 1:27410046-27410068 TTGGAGGCGGAGGTGGCGGAGGG + Exonic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904295199 1:29515757-29515779 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
904747496 1:32720140-32720162 ATGGAGGAGCCAGAGGCAAAGGG - Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904839617 1:33363995-33364017 GTGGGGGAGCAGGTGGGGGAGGG - Intronic
904855069 1:33491567-33491589 ATGGATGAGCAGGAGGAAGGGGG + Exonic
904909454 1:33922876-33922898 ATGGATGGGCTGGAGGAGGAAGG - Intronic
905205134 1:36339138-36339160 ATTGAGGAGAGGGAGGGGGAGGG + Intergenic
905264044 1:36739043-36739065 CTGGCAGAGCAGGAGGCTGAAGG - Intergenic
905393199 1:37651154-37651176 ATTGTGGAGCAGCAGGTGGAAGG - Intergenic
905470529 1:38188297-38188319 TGGGAGGAGGAGGAGGGGGAGGG + Intergenic
905508855 1:38502735-38502757 ATAGAGGAGGAGGGGGAGGAAGG - Intergenic
905575804 1:39043745-39043767 AAGAAGGAGGAGGAGGCGGCAGG + Intergenic
905602730 1:39268288-39268310 AGGGAGGGCCAGGAGGAGGAGGG - Intronic
905951669 1:41956819-41956841 ATGGAGGAGAAGGAGTTGGAAGG + Intronic
906137358 1:43508712-43508734 ATGGATGGTGAGGAGGCGGATGG - Intergenic
906191961 1:43904724-43904746 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906192290 1:43905932-43905954 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192324 1:43906042-43906064 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906192433 1:43906438-43906460 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192456 1:43906509-43906531 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906192485 1:43906638-43906660 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906656038 1:47549036-47549058 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
906668103 1:47635858-47635880 AGGAAGGAACAGGAGGTGGAGGG - Intergenic
906721181 1:48005930-48005952 AGGGAGGAGCAGGGGTTGGAGGG + Intergenic
906852953 1:49271708-49271730 ATGGAGAAGAAGGAGGGGTAGGG - Intronic
907137976 1:52157288-52157310 TTGGATAAGCAGGAGGCTGAGGG - Intronic
907159773 1:52361538-52361560 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
907261263 1:53220447-53220469 CTGAAGGAGCAGGAGGCAGAAGG - Intronic
907368539 1:53982198-53982220 AAGGAGGAGGAGGAGGTGGGTGG - Intergenic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
908562043 1:65316234-65316256 ATGGAGGTGCAGGCTGGGGAGGG - Intronic
908657145 1:66400505-66400527 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
909320083 1:74274287-74274309 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
909364624 1:74804729-74804751 ATGGATGATCAGGAAGCTGAGGG - Intergenic
909957842 1:81801335-81801357 AAGGAGGAGGAGGAGGCTGGAGG + Intronic
910188606 1:84572747-84572769 GAGGCGGAGCGGGAGGCGGAAGG - Intronic
910333042 1:86097660-86097682 AAGGAGGAGGAGGAGGAGAAGGG - Intronic
910559658 1:88576880-88576902 ATGGATGATCAGGAGGCTGTGGG + Intergenic
910760713 1:90728792-90728814 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
911002209 1:93178585-93178607 ATGGAGGTGGGGGAGACGGAGGG - Intronic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
911474312 1:98357485-98357507 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
912513026 1:110201315-110201337 CTGGAGGAGCAGGAGGTAGCAGG + Exonic
912624674 1:111197318-111197340 ATGAAGGAGCACAAGGCTGAGGG + Intronic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913199427 1:116484058-116484080 ATGTGGGGGCAGGAGGGGGAGGG + Intergenic
913406910 1:118504374-118504396 ATGGGGGAGTAGGGGGTGGAAGG + Intergenic
913963691 1:143357584-143357606 AAGAAGGAGGAGGAGGGGGAAGG - Intergenic
914058050 1:144183173-144183195 GAGGAGGAGGAGGAGGGGGAAGG - Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914121095 1:144783192-144783214 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
914905818 1:151742706-151742728 ATGGATGATTAGGAGGTGGAGGG + Intergenic
915035318 1:152918755-152918777 AGGGAGGAGGAGGAGGAGGGAGG + Intergenic
915049705 1:153055708-153055730 GAGGAGGAGGAGGAGGAGGATGG + Intergenic
915132737 1:153707038-153707060 ATGGAGGGGTAGGAGGGGGTGGG - Intergenic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915935467 1:160087894-160087916 GAGGAGGAGGAGGAGGAGGAAGG + Exonic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916075099 1:161196119-161196141 AGGGAGGAGAAGGTGGGGGAGGG - Intronic
916332076 1:163628341-163628363 ATGGAGGGGGAGGAGGAGGAGGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916924869 1:169507555-169507577 ATTGAGGAGGAGGATGGGGAAGG + Intergenic
917779032 1:178371563-178371585 ATGGAGGAGGAGGAGAAGAAAGG + Intronic
917815543 1:178706202-178706224 GTGGAGGAGCAGTAGGAGAATGG + Intergenic
918023087 1:180714235-180714257 AAGGATGAGAAGGAGGAGGAAGG - Intronic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449335 1:197751870-197751892 AAGGAGGAGGAGGAGGAGGGAGG + Intronic
919449341 1:197751886-197751908 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919775330 1:201190726-201190748 CTGGAGGAGAAGGAGGAGGCGGG + Intergenic
919850363 1:201668238-201668260 AGGGGGTGGCAGGAGGCGGAGGG - Intronic
920036228 1:203067552-203067574 AAGGAGGAGCATGAGGAGGCTGG + Intronic
920351749 1:205342578-205342600 AGGGAGGAAGAGGAGACGGAGGG + Intronic
920375204 1:205504598-205504620 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
920555127 1:206899039-206899061 ATGGAGAAGGAGGAGGTGCAGGG + Intronic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
920666150 1:207964065-207964087 AGGGAGGAGGAGGAGGAGGCAGG + Intergenic
920850279 1:209623756-209623778 GAGGAGGAGCAGGAGGGAGAGGG + Intronic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921383921 1:214551301-214551323 AAGGAGCCGCAGGAGGCGAAAGG + Intronic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921458167 1:215396582-215396604 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
921707976 1:218345803-218345825 AAGGAGGAGCAGGAGAAGGAGGG + Intergenic
921887521 1:220321621-220321643 ATGGAGGAGGAAGAGGAGGAAGG + Intergenic
921974145 1:221182767-221182789 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
922209486 1:223476670-223476692 AAGGAGGAGAAGGAGGAAGATGG + Intergenic
922314840 1:224434034-224434056 GTGGAGGAGGAGGGGGCGGCGGG - Exonic
922564598 1:226593486-226593508 ACAGAGGAGAAGGAGGCTGAGGG - Intronic
922575968 1:226660769-226660791 GGGGAAGAGCACGAGGCGGATGG + Intronic
922800631 1:228363166-228363188 AAGGAGGAGGAGGTGGAGGAGGG + Intronic
922813907 1:228435565-228435587 ATTGAGGGGCAGGAGGGGGTCGG - Intergenic
922936332 1:229425902-229425924 AAGGAGGAGGAAGAGGAGGAGGG + Intergenic
923135998 1:231119759-231119781 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
923265659 1:232311681-232311703 ATGGAGGAGAAGGAGGTTTATGG - Intergenic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923534425 1:234838168-234838190 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
923770801 1:236936163-236936185 ATTGCTGAGCAGGAGGGGGAGGG + Intergenic
923976886 1:239274018-239274040 ATGGAGGAGCAAAAGGCTGAAGG - Intergenic
924481172 1:244435637-244435659 ATGGAGGAGGAAGAGAAGGATGG - Intronic
924481176 1:244435656-244435678 ATGGAGGAGGAAGAGGAGGATGG - Intronic
924556594 1:245124140-245124162 ATGGAGGAGCTGGTGGATGAAGG - Intronic
924608679 1:245556342-245556364 AAGGAGGAGGAGGAGGAGGGAGG - Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1062763404 10:44667-44689 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1062925754 10:1314441-1314463 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063417921 10:5889266-5889288 AAGGAGGAGCTGCAGGCGGCCGG - Exonic
1063453215 10:6164953-6164975 AGGGATGAGCAGGAGACAGAAGG + Intronic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1063621034 10:7649308-7649330 AAGGAGGAGGAGGAGGGGAAGGG - Intronic
1063830354 10:9945531-9945553 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1063866044 10:10366831-10366853 AGTGAGGAGCAGGTGGAGGAAGG - Intergenic
1063916055 10:10883872-10883894 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1063916065 10:10883905-10883927 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1064003528 10:11682675-11682697 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1064035210 10:11908842-11908864 ATGGAGGAGCAGGTGGGGTGAGG - Intergenic
1064272705 10:13879773-13879795 AGGGAGGAGGAGGAGGAAGAAGG - Intronic
1064272711 10:13879793-13879815 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1065188249 10:23189613-23189635 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1065474774 10:26122711-26122733 AAGGAGGAGAAGGAGAAGGAGGG - Intronic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1065965452 10:30766899-30766921 ATGGAGGAGAACGAGGAGGCGGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066262823 10:33745620-33745642 ATGGGAGAGGAGGAGGAGGAGGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067083823 10:43227921-43227943 ATGGCAGAGAAGGAGGAGGAGGG - Intronic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1067302944 10:45031162-45031184 ATGGATGAGCCAGAGGCAGATGG - Intergenic
1067570076 10:47365163-47365185 ATGGAGGGGCAGGGGTAGGAGGG - Intergenic
1067738790 10:48879871-48879893 TTGGGGGAGCGGGAGGCAGAGGG - Intronic
1068122809 10:52801191-52801213 AGGGAGGATCAGGTGGTGGATGG + Intergenic
1068152456 10:53150837-53150859 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1068435735 10:56989022-56989044 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1068766094 10:60765422-60765444 AAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1068948339 10:62752176-62752198 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1069371332 10:67750715-67750737 ATGGAGGAGCTGGTGGATGAGGG + Intergenic
1069409525 10:68139075-68139097 ATGTTGGAGCAGGAGGAAGAAGG - Intronic
1069415475 10:68196791-68196813 AAGGAGGAGGAGGAGGCAAAGGG - Intronic
1069486596 10:68827678-68827700 CTGGAGGCGCAGAAGGCGGCGGG + Exonic
1069486683 10:68828014-68828036 CTGGAGGCGCAGAAGGCGGCGGG + Intronic
1069718510 10:70535551-70535573 AAGGAAGAGAAGGAGGAGGAAGG - Intronic
1070167386 10:73909081-73909103 ACGGGGGAGGAGGGGGCGGAAGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1071195819 10:83158004-83158026 GTGGAGGAACAGGAGGTGAATGG + Intergenic
1071503935 10:86221885-86221907 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1071991018 10:91100932-91100954 ATGGGTTAGCAGGAGGCTGAGGG + Intergenic
1072092093 10:92138422-92138444 GAGGAGCAGCAGGAGGCGGAAGG + Intronic
1072156730 10:92730525-92730547 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1072195728 10:93116018-93116040 AGGCAGGAGGAGGAGGAGGAGGG + Intergenic
1072252687 10:93593959-93593981 ATCGAGGTTCAGGAGGCGGCAGG + Exonic
1072328127 10:94318641-94318663 TGGGAGGAGCAGGAGGCAGTGGG + Intronic
1073048949 10:100655867-100655889 AAGGAGGAGGACGAGGAGGAAGG - Intergenic
1073164172 10:101429523-101429545 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1073257117 10:102159912-102159934 GTGGGGGAGCAGAAGGCGGGGGG - Exonic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073340926 10:102744029-102744051 GCGGAGGAGCAGGAGCAGGAGGG + Exonic
1073340929 10:102744035-102744057 GAGCAGGAGCAGGAGGGGGATGG + Exonic
1073403298 10:103276430-103276452 TTGGAGAAGCAGGAGGCGCTGGG - Intergenic
1073597715 10:104817394-104817416 AAGGGGGAGGAGGAGGGGGAAGG - Intronic
1073707520 10:106001830-106001852 ATGGAGGAGGAGGAGGACCATGG + Intergenic
1073956196 10:108874288-108874310 ATAGAGGTGCTGGAGGGGGAGGG - Intergenic
1074134957 10:110618148-110618170 AAGGAGGAGGAGGAGGAGGTAGG + Intergenic
1074145930 10:110717335-110717357 AGGGAGGAGGAGGGGGAGGAGGG - Intronic
1074651076 10:115525157-115525179 ATGAAGGAACAGGAGACTGAGGG - Intronic
1074765568 10:116697448-116697470 ATAGAGGAGGAGGGGGAGGAGGG + Intronic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1075331556 10:121577851-121577873 GTGGAGGAGGAGGAGGTTGAAGG - Intronic
1075534979 10:123263289-123263311 AAGGAGGAGGAGGAGCTGGAGGG + Intergenic
1075644162 10:124086653-124086675 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1075930662 10:126292570-126292592 ATGGAGGAAGAGGAGGCAGGTGG - Intronic
1076173272 10:128341270-128341292 AAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1076180295 10:128401833-128401855 ATGGAGCAGGAGGAGGGTGAGGG + Intergenic
1076219155 10:128719206-128719228 ATGGTGGAGCTGGAGGAAGATGG - Intergenic
1076318935 10:129564354-129564376 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1076752770 10:132551976-132551998 TTGGTGGAGCAGGAGGCCCAAGG + Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076965005 11:75752-75774 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1077048278 11:555599-555621 CTGGAGGACCAGGGGGCGGCCGG + Intronic
1077143507 11:1035038-1035060 CTGGACGAGCACGAGGCGGCAGG + Intronic
1077150764 11:1072166-1072188 AAGGAGGAGGAGGAAGGGGAAGG - Intergenic
1077165863 11:1137999-1138021 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077278929 11:1733260-1733282 ATGGGAGGGCAGGAGGCGGCGGG - Exonic
1077360371 11:2138070-2138092 GAGGAGGAGGAGGAGGAGGACGG - Intronic
1077407965 11:2391086-2391108 ATGGAGGAGGAGGAGGGGAGGGG + Intronic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1077491712 11:2863857-2863879 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1077548085 11:3185203-3185225 TTGGAGGAGGAGGAGGCTGGGGG - Intergenic
1077923386 11:6657133-6657155 AAGGAGCAGCAGGAGGCTGCAGG + Intergenic
1078022992 11:7670991-7671013 AGGGAGGAGGAGGAGGCAGGAGG + Intronic
1078060685 11:8040703-8040725 AAGGAGCAGTAGGAGGAGGAGGG + Intronic
1078168227 11:8909423-8909445 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1078473955 11:11614375-11614397 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1078976494 11:16484217-16484239 ATGGAGGAGCTGGTGGATGAAGG - Intronic
1079445572 11:20553706-20553728 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079810946 11:24999353-24999375 AAGGAGGAGGAAGAGGAGGAAGG + Intronic
1079810962 11:24999418-24999440 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1080237883 11:30092836-30092858 AGGGAGGAGAGGGAGGGGGAGGG - Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080757536 11:35216495-35216517 ATGGAGGAGCACTAGGAGGTAGG + Intronic
1080806928 11:35662611-35662633 TTGGAGGAGGAGGAGGGAGAAGG - Intergenic
1081029163 11:38056086-38056108 ATGGAGGGGCATAAGGCAGAAGG - Intergenic
1081604262 11:44517564-44517586 ATGGAGGAGGGAGAGGAGGAAGG + Intergenic
1081709409 11:45207318-45207340 ATGGTGGGCCAGGAGGCGAATGG + Intronic
1081801876 11:45865674-45865696 GAGGGGCAGCAGGAGGCGGAGGG + Intronic
1081831782 11:46120995-46121017 AAGCAGGAGGAGGAGGAGGAGGG + Exonic
1082192349 11:49261799-49261821 ATGGAGGAGTAGGTGGAGCACGG - Intergenic
1082669795 11:56020878-56020900 GAGGAAGAGCAGGAGGAGGAGGG + Intergenic
1082762060 11:57136786-57136808 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1082762064 11:57136792-57136814 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1082762088 11:57136891-57136913 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1082790467 11:57343250-57343272 AAGGAGGAGGAGGAGGAGGTAGG + Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083048275 11:59755469-59755491 CTGGAGGCGCAGGCGGCGGCGGG - Exonic
1083271850 11:61576734-61576756 CAGGAGGGGCAGGAGGGGGAGGG + Intronic
1083431112 11:62613890-62613912 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1083616368 11:64028485-64028507 AGGAAGGAGCAGGAGGCAGGAGG + Intronic
1083631075 11:64095841-64095863 ATGGAGGAGCGCGAGGCTGAGGG + Intronic
1083722352 11:64609623-64609645 GAGGAGGACCAGGAGGCTGATGG - Intronic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1083884630 11:65566412-65566434 AAGGAGGAGGGGGAGGGGGAGGG - Intergenic
1084039414 11:66532681-66532703 AAGGGGGTGCAGGAGGCAGAGGG + Exonic
1084104872 11:66974972-66974994 AAGGAGGAGAAGGAGGAGGGGGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084571662 11:69963417-69963439 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
1084617251 11:70244791-70244813 ATGGAGGAGGAGGAGAGGGAAGG + Intergenic
1084637400 11:70400961-70400983 ATGGCAGAGCAGGAGGAGAAAGG - Intronic
1084717292 11:70882162-70882184 ATGGAGGAGGAGGAGGAGGGAGG + Intronic
1084785817 11:71441095-71441117 GTGGAAGAGGAGGAGGGGGATGG - Intronic
1084949618 11:72657468-72657490 ATGGAGGAGTGGGAGGGGCAGGG - Intronic
1085254847 11:75166626-75166648 ATGGATGAGTAGTAGGTGGATGG - Intronic
1085502665 11:77037987-77038009 AGGGAGGAGGAGGGGGAGGAGGG + Intronic
1085502722 11:77038125-77038147 AGGGAGGAGGGGGAGGAGGAGGG + Intronic
1085699033 11:78729820-78729842 AAGCAGGAGGAGGAGGAGGAAGG + Intronic
1086193379 11:84107732-84107754 GTAGAGGAGAAGGAGGCTGAAGG + Intronic
1086308110 11:85503935-85503957 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1086651924 11:89302169-89302191 GTGGAGGAGTGGGAGGAGGATGG + Intergenic
1087306485 11:96495482-96495504 AAGGAGGAGGAGGAGAAGGAGGG - Intronic
1087979272 11:104590931-104590953 ATGGATGACCAGGAGGCTGAGGG + Intergenic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088079550 11:105894644-105894666 AAGGAGGAGGAGGAGGAGGGAGG + Intronic
1088207705 11:107413216-107413238 ATGGAGGGGCAGGAAGTGTATGG + Intronic
1088645450 11:111913216-111913238 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1089070519 11:115696109-115696131 ATGTAGGAGCAGGAGCCAGGGGG + Intergenic
1089317324 11:117600867-117600889 CTGGAGGAGAAGGAGGGGTAGGG + Intronic
1089436983 11:118477214-118477236 ATGAAGGAGCAGGGGAAGGAAGG + Intronic
1089610282 11:119664967-119664989 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
1089634238 11:119802081-119802103 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1089657105 11:119956718-119956740 ACGGAGGAGGAGGACGAGGAGGG + Intergenic
1089690281 11:120182862-120182884 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1089723130 11:120448220-120448242 ATGGTGGAGCTGGAGGAGAAAGG - Exonic
1089945767 11:122471757-122471779 ATGGGGGAGGAGGAGGGGGTTGG - Intergenic
1090007730 11:123017639-123017661 ATGGTGGAGAAGGAGGAGGCTGG + Intergenic
1090042697 11:123304556-123304578 ATGGAGGAGAAGGATGGAGAGGG + Intergenic
1090255185 11:125278934-125278956 GTGGAGGTGCAGGAGGCTGGCGG + Intronic
1090365948 11:126205707-126205729 ATTGTGGAGAAGGAGGCGCAAGG - Exonic
1090452541 11:126819433-126819455 GTGGAGGAGCAGGAGTGGGCAGG + Intronic
1090502966 11:127279720-127279742 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090664992 11:128909019-128909041 ATGAAGGAGCAGGAAGCAGGTGG + Intronic
1090838845 11:130472680-130472702 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1090853348 11:130589736-130589758 TTGGAGGAGGAGGAAGCTGAAGG - Intergenic
1090862449 11:130666130-130666152 AAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1091178402 11:133581552-133581574 ACAGAGGAGCAGGAGGCTGAGGG + Intergenic
1091180864 11:133603350-133603372 GAGGAGGAGCAGGGGGTGGAGGG + Intergenic
1091219466 11:133921402-133921424 AAGGAGGAGCAAGAGCCGGGAGG + Intronic
1091697156 12:2635517-2635539 ATGGAGGAGCTGGGGGTGGTGGG - Intronic
1091779269 12:3203821-3203843 GTGGAGGAGCAGGTGCAGGAGGG + Intronic
1091813793 12:3421091-3421113 ATGGAGGAGGAGGAGTGGGAGGG - Intronic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1091884177 12:4003900-4003922 AAGGAGGAGGAGGAGGGGAACGG - Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092139259 12:6171613-6171635 GTTGAGGAGGAGGAGGAGGAAGG + Intergenic
1092170088 12:6369134-6369156 AGGGAGGGGCAGGAGGCAGAAGG - Intronic
1092219040 12:6700525-6700547 CGGGAGGGGCAGGAGGCGCAGGG + Intronic
1092843337 12:12562943-12562965 CGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1092910939 12:13144480-13144502 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1093084575 12:14852460-14852482 AAGGAGGAGGAGGAGGGGGAGGG - Intronic
1093153579 12:15653429-15653451 GTGGAAGGGCGGGAGGCGGATGG - Intronic
1093242511 12:16695573-16695595 AGGGAGGAGGAGGAGAAGGAAGG + Intergenic
1093315727 12:17647507-17647529 ATGGTGGAGCAGGAGGGGGTGGG - Intergenic
1093547784 12:20368851-20368873 CTGGAGGAGCCGGGGGCGCAGGG - Intergenic
1093569056 12:20644832-20644854 GGGGAGGAGGAGGAGGAGGAGGG - Intronic
1093652069 12:21657535-21657557 GCGGAGGAGCAGAAGGCAGAGGG - Exonic
1093775328 12:23067138-23067160 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1093853522 12:24070213-24070235 ATGGAGGGGGAGGGAGCGGAAGG - Intergenic
1093918317 12:24831099-24831121 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094234393 12:28146899-28146921 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1094480212 12:30875473-30875495 ATGGAGGAGGAGGAGTGGAAAGG + Intergenic
1095290377 12:40472817-40472839 AGGGAGGAGGAGGAAGAGGAGGG - Intronic
1095540129 12:43299925-43299947 AAGGAGGAGGAGGTGGGGGAGGG + Intergenic
1095651776 12:44619647-44619669 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096072351 12:48782412-48782434 GAGGAGGAGCAGGAGGTGGGAGG - Intronic
1096181862 12:49555665-49555687 CTGGAGGAGAAGGAGACAGATGG + Exonic
1096424983 12:51493438-51493460 ATGGAGGAGGAAGAGCCAGATGG + Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096528358 12:52227873-52227895 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096528415 12:52228127-52228149 AAGGAGGAGGGGGAGGGGGAGGG - Intergenic
1096652437 12:53068470-53068492 ATGGAAGAGCAGGATGGGGTGGG + Intronic
1096694123 12:53338117-53338139 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1096708878 12:53441144-53441166 AGGGAGGTGAAGGAGGCAGAGGG + Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096721484 12:53526315-53526337 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1096777093 12:53970881-53970903 CTGGAGGGCCAGGAGGGGGAAGG + Intergenic
1096975364 12:55696691-55696713 CTGGAGGAGGAGGAGGTGCAAGG - Intronic
1097098755 12:56571252-56571274 ATGGAGGAAGAGCAGGAGGAGGG - Intronic
1097098838 12:56571749-56571771 ATGGATGAGCAGGAACTGGAGGG + Exonic
1097251099 12:57632708-57632730 GGGGAGGAGGAGGAGGCGGGAGG - Intronic
1097264841 12:57738792-57738814 ATGGAGATACAGGAGGCGGCGGG + Intronic
1097564258 12:61248717-61248739 GTGGAGGAGAAGGAAGAGGAGGG - Intergenic
1097626636 12:62010163-62010185 ATGGGGGAGAGGGAGGGGGAGGG - Intronic
1097865872 12:64558861-64558883 AAGGAGGGGCAGGAGGCTGAGGG - Intergenic
1097891439 12:64781085-64781107 ACAGAGGAGGAGGAGGCGGCGGG + Intergenic
1097973379 12:65659208-65659230 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1097986172 12:65785509-65785531 ATGAATGATCAGGAGGCTGAGGG - Intergenic
1098116545 12:67184733-67184755 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1098461866 12:70741405-70741427 AGGAAGGAGGAGGAGGCAGAGGG + Intronic
1098588981 12:72187517-72187539 GAGGAGGAGGAGGAGGAGGATGG + Intronic
1098595870 12:72272722-72272744 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
1098730053 12:74024670-74024692 ATGGAGGAGATGGAGGAAGAGGG + Intergenic
1098918459 12:76280868-76280890 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1099304608 12:80937788-80937810 AAGGAGGGGGAGGAGGGGGAAGG + Exonic
1099398453 12:82171015-82171037 GGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1099440023 12:82687485-82687507 TGGGAGGAGAAGGCGGCGGAAGG + Exonic
1099734229 12:86547311-86547333 AAGGAAGAGCAGGAAGAGGAAGG - Intronic
1100201240 12:92299896-92299918 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1100420135 12:94424511-94424533 ATGGATGAGCAGGAACTGGAGGG - Intronic
1100425074 12:94476804-94476826 ATGGAGGGGCAGGAGGCTAAGGG - Intergenic
1100550763 12:95644462-95644484 GAGGAGGAGCAGGAGGAAGAGGG - Intergenic
1100661287 12:96701771-96701793 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1100800561 12:98226190-98226212 ATGGAGGAGCAATGGGGGGAGGG + Intergenic
1101760110 12:107651460-107651482 ACGGGGGAGCGGGAGGGGGAGGG - Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101839894 12:108320598-108320620 ATGGAGGAGGAAGAGGCTGAGGG - Intronic
1101931253 12:109015912-109015934 AAAGAGGAGCAGGTGGAGGACGG + Intronic
1102180134 12:110906325-110906347 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1102232355 12:111272307-111272329 ATGGAGGAGGGAGAGGAGGAGGG - Intronic
1102258398 12:111429049-111429071 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1102471917 12:113164080-113164102 AAGGAGGAGGAGGAGGAGGCGGG - Exonic
1102704865 12:114872256-114872278 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1102746220 12:115251269-115251291 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102749149 12:115277182-115277204 AAGGAGGAGGAGGAGGAGGGAGG + Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102974963 12:117200144-117200166 AAGGAGGAGGAGGAGGGGAAGGG - Intergenic
1103235352 12:119368078-119368100 AAGGAGGAGGGGGAGGAGGAGGG + Intronic
1103245481 12:119453300-119453322 ATGGAAGAAAAGGAGGAGGAGGG - Intronic
1103282518 12:119771689-119771711 AAGGAGAAGCTGGAGGCAGATGG + Intronic
1103401900 12:120649048-120649070 ATGGAGGAGGAGGAGCCTGGGGG - Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103932383 12:124457588-124457610 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1103946754 12:124531491-124531513 AGGGAGGAGAAGGAGGGGTAGGG + Intronic
1103948935 12:124541283-124541305 ATGGGGGAGATGGAGGGGGATGG + Intronic
1104005590 12:124890044-124890066 ATGGTGGAGCAGCAGGAGGTGGG - Intergenic
1104061552 12:125272683-125272705 ATGGGGGAGCTAAAGGCGGAGGG + Intronic
1104316225 12:127704390-127704412 ATGGAAGAGGAGGAGGAGGGAGG + Intergenic
1104616408 12:130273509-130273531 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1104637436 12:130447073-130447095 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1104841805 12:131829206-131829228 GTGGAGGGGAAGGAGGCTGAGGG - Intronic
1104843207 12:131834411-131834433 AGGGAGGACCAGGCGGCGGGTGG + Intronic
1104876922 12:132041364-132041386 GTGGAGGAGGAGGATGCGGCGGG + Intronic
1105446502 13:20461974-20461996 CTGGGGGAGGAGGAGGCGGGAGG + Intronic
1106019524 13:25901074-25901096 AAGGAGGAGCAGGGAGCTGAAGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107058555 13:36131443-36131465 GCGGAGGAGGAGGAGGAGGAGGG - Intergenic
1107084230 13:36408187-36408209 AAGGAGGAGAAGGAGAAGGAGGG + Intergenic
1107373394 13:39776236-39776258 AGGGAGGAGGAGTAGGCAGAAGG + Intronic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1107851682 13:44577480-44577502 CTGGCGGGGCAGGAGGCGGCGGG + Intergenic
1108277671 13:48827456-48827478 ATGGTGGAGCAGGAGAGAGAGGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1108923077 13:55700943-55700965 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1109835482 13:67851265-67851287 ATGGATGACCAGGAGGCTGAGGG - Intergenic
1110041291 13:70762383-70762405 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1110219468 13:73058736-73058758 CTGGCGGAGCCGGGGGCGGAGGG - Intronic
1110367703 13:74706025-74706047 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1110530400 13:76590690-76590712 AAGGAGAAGCAGGAGGCTAAGGG - Intergenic
1110682961 13:78337722-78337744 ATGGGGGAGGGGGAGGGGGAAGG + Intergenic
1110772501 13:79366070-79366092 AGGGTGGAGCAGGAGGAGGCTGG + Exonic
1110860555 13:80341192-80341214 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1111086412 13:83380683-83380705 AGGGAGGGGGAGGAGGAGGAAGG - Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1111798434 13:92953587-92953609 ATGGTGCAGCAGCAGACGGAAGG + Intergenic
1112490766 13:99861234-99861256 GAGGAGGAGGAGGAGGAGGATGG + Intronic
1112724505 13:102286978-102287000 ATGGGGGAGGGGGAGGGGGAGGG + Intronic
1113200930 13:107867123-107867145 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1113274974 13:108718525-108718547 ATGCAGCAGCAGGAAGCAGAAGG + Intronic
1113556594 13:111240534-111240556 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1113692789 13:112323635-112323657 CTGCAGGGGCAGGAAGCGGAGGG - Intergenic
1113742973 13:112724108-112724130 ATGGGGGAGAAGGGGGCGAAGGG - Intronic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1113747721 13:112756553-112756575 ATGGCGGGGCAGGTGGGGGACGG + Intronic
1114038128 14:18648832-18648854 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
1114120485 14:19666204-19666226 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114127288 14:19743704-19743726 ACAGAGGAGCAGGAAGGGGAGGG - Intronic
1114187352 14:20413149-20413171 AAGGAGGAGGAGAAGGCTGAAGG - Intronic
1114201219 14:20522569-20522591 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114253948 14:20985824-20985846 AAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1114354021 14:21887770-21887792 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1114458490 14:22872314-22872336 AAGGAGGAGGAGGAGGAGGGTGG - Exonic
1114554115 14:23551685-23551707 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1114614842 14:24062852-24062874 AAGGAGGAGCAGGGAGCGGGGGG - Intronic
1114653373 14:24300650-24300672 GAGGAGGAGGAGGAGGAGGATGG + Exonic
1115018535 14:28646398-28646420 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1115167462 14:30464876-30464898 AAGGAGGGGCAGGAGGCAGGAGG + Intergenic
1115659130 14:35474595-35474617 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1116097229 14:40386268-40386290 ATGGAAGAGGAGGAGCTGGAAGG + Intergenic
1116233925 14:42253634-42253656 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116416962 14:44689796-44689818 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116416968 14:44689811-44689833 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416974 14:44689826-44689848 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416980 14:44689841-44689863 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416992 14:44689868-44689890 AAGGAGGGGGAGGAGGAGGAGGG + Intergenic
1116524776 14:45891124-45891146 ATGGAGGAGCAGGAGAGAGAGGG - Intergenic
1116658225 14:47675992-47676014 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116947995 14:50853989-50854011 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1117182260 14:53202791-53202813 AGGGAGGATCAGGAGGTGGGTGG - Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117458011 14:55917213-55917235 GAGGAGGAGAAGGAGGCTGAGGG + Intergenic
1117581048 14:57152086-57152108 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
1117581482 14:57155909-57155931 ATGGAGGAGCAGGAGGGGAAAGG + Intergenic
1117667837 14:58076070-58076092 AAGGAGGAGAAAGAGGAGGAAGG + Intronic
1117761636 14:59035328-59035350 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117785640 14:59281532-59281554 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1117983538 14:61364959-61364981 ATAGAAGGGCAGGAGGCGGTAGG + Intronic
1118388175 14:65274076-65274098 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1118394082 14:65321006-65321028 GAGGAGGAGCGGGAGGAGGATGG + Intergenic
1118557767 14:67044736-67044758 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1118715677 14:68558167-68558189 ATGGAAGAGCAGGAGGTTTAGGG + Intronic
1118750950 14:68807573-68807595 AGGAAGGAGCAGGAGGCTGCTGG + Intergenic
1118766759 14:68915240-68915262 AAGAAGGAGCAGGGGGAGGAGGG - Intronic
1118825015 14:69372094-69372116 ATGGATGAGCAGGATGAGTAGGG + Intergenic
1118860073 14:69656109-69656131 ATGGAGGAAGAGGAAGAGGAAGG - Intronic
1118866723 14:69710213-69710235 ATGGAAGAGGAGGAAGAGGAGGG - Intronic
1118908954 14:70045622-70045644 ATGGAATAGAAGGAGGCGAAAGG + Exonic
1119004360 14:70910031-70910053 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1119004373 14:70910064-70910086 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1119004415 14:70910154-70910176 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1119067409 14:71542662-71542684 AAGGAGGAGGAGGAGGAGGGAGG - Intronic
1119067410 14:71542665-71542687 AGGAAGGAGGAGGAGGAGGAGGG - Intronic
1119067422 14:71542704-71542726 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1119071869 14:71594057-71594079 ATGGAGGAGGAGGAGAAGGAAGG - Intronic
1119180354 14:72600960-72600982 AAGGAGGAGGAGGAGGAGCAGGG + Intergenic
1119555140 14:75547246-75547268 AAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1119565121 14:75622241-75622263 ATGGGGTAGCAGGGGGCGAAGGG + Intronic
1119657178 14:76425520-76425542 AGGGAGGAGGAGGGGGAGGAAGG - Intronic
1119812191 14:77531475-77531497 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1119812195 14:77531481-77531503 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1120831440 14:89000891-89000913 ATGAAGGAGTAGGAGGGGGAAGG - Intergenic
1120899878 14:89566755-89566777 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1121170971 14:91854397-91854419 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1121170975 14:91854403-91854425 GAGGAGGAGGAGGAGGGGGAGGG + Intronic
1121171015 14:91854516-91854538 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121692721 14:95889462-95889484 GCGGAGGAGGAGGAGGGGGAGGG - Intergenic
1121692725 14:95889468-95889490 GTGGAGGCGGAGGAGGAGGAGGG - Intergenic
1121729584 14:96176949-96176971 ACAGAGGAGCAGGAGGAAGAGGG + Intergenic
1121734944 14:96211666-96211688 AAGGAGGAGCGGGAGGAGGAGGG - Intronic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1121735723 14:96216730-96216752 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1121735729 14:96216749-96216771 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1121766788 14:96494720-96494742 ATGGGGGAGCAGCAGGTAGAGGG - Intergenic
1121777129 14:96598308-96598330 ATGGGGGAATAGGAGGGGGAAGG - Intergenic
1121777151 14:96598361-96598383 AGGGAGGAGGAGGAGGAAGACGG - Intergenic
1122016785 14:98803276-98803298 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1122033098 14:98927875-98927897 AAGGAGGAGGAGCAGGCTGAGGG - Intergenic
1122092451 14:99349331-99349353 ATGAAAGAGGAAGAGGCGGAAGG + Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122366524 14:101197896-101197918 ATGGAGGAGGAGGCAGCTGAGGG - Intergenic
1122688526 14:103521145-103521167 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1122782640 14:104150140-104150162 GGGGAGGAGGAGGAGGGGGAGGG - Intronic
1122782672 14:104150206-104150228 GGGGAGGAGGAGGAGGAGGAGGG - Intronic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1123392896 15:19895234-19895256 AAGGAGGAGGAGGGGGAGGAAGG - Intergenic
1123570744 15:21605343-21605365 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123606857 15:22040696-22040718 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123694851 15:22871502-22871524 ATGGAGGAGTGGGAGGCAGAAGG + Intronic
1123773031 15:23548288-23548310 AGGGACAAGCAGGAGGCAGAGGG - Intergenic
1124090924 15:26599282-26599304 CTGGAGGAGCTGGATGCTGATGG - Intronic
1124171097 15:27374745-27374767 ATGGAGGACGAGGATGCTGAGGG + Intronic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124395692 15:29299862-29299884 ATGGATGAGTAGGTGGGGGATGG + Intronic
1124621569 15:31276957-31276979 ATGGACGACCAGGAGGCTGAGGG - Intergenic
1124688777 15:31804478-31804500 ATGGAGGAGAAAGGGGAGGAGGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124701147 15:31913355-31913377 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1124816784 15:33001703-33001725 GAGGAGGAGGAGGAGGGGGAAGG - Intronic
1125024800 15:35019487-35019509 AGGGAGGGGGAGGAGGAGGAAGG - Intergenic
1125024808 15:35019506-35019528 AGGGAGGGGGAGGAGGAGGAGGG - Intergenic
1125381304 15:39090389-39090411 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1125506090 15:40268484-40268506 GTGGTGGAGGAGGAGGAGGAAGG - Intronic
1125521459 15:40350155-40350177 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1125657654 15:41371192-41371214 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1125891958 15:43273705-43273727 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1126161633 15:45619433-45619455 TTGGAGGAGCAAGAGGCTGAGGG + Intronic
1126584024 15:50265653-50265675 ATGGACACGCAGGAGGTGGAAGG + Exonic
1126837352 15:52679815-52679837 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1127173070 15:56323757-56323779 AAGGAGGAGAAGGAGAGGGAGGG + Intronic
1128304164 15:66587049-66587071 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1128304189 15:66587127-66587149 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128389790 15:67175110-67175132 ATGGAGGGGAAGGAGGAGGCAGG + Intronic
1128704580 15:69829227-69829249 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129145885 15:73646811-73646833 ATGGAGGAGGGGGAGGGGGAGGG + Intergenic
1129232253 15:74203315-74203337 CAGGAGGAGCAGGAGGCAGGCGG - Intronic
1129360171 15:75019552-75019574 ATGAGGGAGGAGGAGGCTGAAGG - Exonic
1129665294 15:77576226-77576248 AGGGAGGAGCAGGGGGAGGCTGG + Intergenic
1129665308 15:77576313-77576335 ATGCTGGAGGAGGAGGAGGAGGG + Intergenic
1129665324 15:77576353-77576375 GGGGAGGAGAAGGAGGAGGAGGG + Intergenic
1129834407 15:78692930-78692952 GAGGAGGAGCAAGAGGAGGAAGG + Intronic
1129906803 15:79193461-79193483 GGGGATGAGCAGGAGGCTGATGG + Intergenic
1130536149 15:84786395-84786417 TTGGAGGAGTAGGAGGGGCAAGG + Intronic
1130721091 15:86386238-86386260 AGGGAGGAGGAGGGGGAGGAGGG - Intronic
1130721103 15:86386264-86386286 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1130744357 15:86635256-86635278 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1130744380 15:86635300-86635322 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1130825577 15:87542058-87542080 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1130959836 15:88652411-88652433 AAGGAGGAGGGGGAGGAGGAGGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130959861 15:88652472-88652494 AAGGAGGAGGGGGAGGAGGAGGG - Intronic
1131014180 15:89043625-89043647 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131035606 15:89220045-89220067 ATGCAGGAGCAGGATGGTGAAGG - Intronic
1131158578 15:90090083-90090105 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1131340857 15:91599260-91599282 ATGGAAGGGCAGGGGGTGGAGGG + Intergenic
1131430162 15:92380888-92380910 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1131498561 15:92936958-92936980 AAGGAGGCTGAGGAGGCGGAAGG - Intronic
1131514479 15:93067930-93067952 AGGCAGGACCAGGAGGAGGAAGG + Intronic
1131562302 15:93455151-93455173 TGGGAGGAGAGGGAGGCGGAGGG + Intergenic
1131901065 15:97088523-97088545 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901098 15:97088639-97088661 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901103 15:97088655-97088677 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901108 15:97088671-97088693 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1131901113 15:97088690-97088712 AAGGAGGAGGAGGAAGAGGAAGG - Intergenic
1131901118 15:97088709-97088731 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132053775 15:98633958-98633980 AAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132092444 15:98957257-98957279 AGGGAGGACGAGGAGGCCGAGGG - Exonic
1132207101 15:99993692-99993714 AAGGAGGAGGAGGCGGCAGAAGG + Intronic
1132412831 15:101597556-101597578 AGGGAGGATCAGGAGGTGGGTGG + Intergenic
1132443117 15:101887764-101887786 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1202979097 15_KI270727v1_random:332466-332488 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1132475959 16:138309-138331 AGGACGGAGCCGGAGGCGGAGGG + Exonic
1132475971 16:138341-138363 AGGACGGAGCCGGAGGCGGAGGG + Exonic
1132490115 16:223913-223935 GAGGAGGAGGAGGAGGCGGGTGG - Intronic
1132546481 16:535637-535659 CTGGAGGGGCAGGGTGCGGAGGG - Intronic
1132560758 16:592531-592553 GTGCAGGACCAGGAGGCGGCAGG - Intronic
1132664633 16:1075973-1075995 AGGGAGGGGGAGGAGGGGGAGGG - Intergenic
1132744964 16:1432714-1432736 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132807088 16:1779856-1779878 CTGCAGGAGCTGGAGGCGGGCGG + Intronic
1132885841 16:2181624-2181646 CAGGTGGACCAGGAGGCGGAGGG + Intronic
1132986097 16:2768407-2768429 ATGCTGGGGCAGGGGGCGGAGGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133307641 16:4820917-4820939 ATGGTGGGGCAGGTGGGGGAAGG - Intronic
1133392416 16:5420982-5421004 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1133417290 16:5616550-5616572 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133417302 16:5616588-5616610 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133460735 16:5984148-5984170 GGGGAGGAGGAGGAGGGGGAGGG - Intergenic
1133582618 16:7160834-7160856 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1133742288 16:8660809-8660831 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133901395 16:9978554-9978576 AAGGAGGAGTAAGAGGAGGATGG - Intronic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1134066585 16:11232443-11232465 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1134066599 16:11232468-11232490 AGGGGGGAGGAGGAGGGGGAGGG + Intergenic
1134602646 16:15545562-15545584 ATGGGGGCTCAGGAGTCGGAAGG + Intronic
1134657306 16:15956803-15956825 AAGGAGGAGGAGGAAGGGGAGGG + Intronic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1134997410 16:18750660-18750682 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1135066575 16:19315004-19315026 GTGGAGGGGGAGGAGGAGGAGGG + Intronic
1135114519 16:19713563-19713585 ATGGAGGTGGAGGAGGAGGATGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135536881 16:23301799-23301821 GTGGAGGTGGAAGAGGCGGAGGG + Intronic
1135597434 16:23755029-23755051 ATGGCCGAGCTGGAGGCGGAAGG - Exonic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136081345 16:27854325-27854347 AAGGGGGAGGAGGAGGGGGACGG + Intronic
1136136024 16:28257464-28257486 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1136230176 16:28881080-28881102 ATGGAGGAGGAGGAGACTGGAGG - Intronic
1136403532 16:30030840-30030862 CAGGAGGAGGAGGATGCGGATGG + Exonic
1136458477 16:30395552-30395574 GTGGCGGAGCCGGAGGCGGCCGG + Exonic
1136459980 16:30404182-30404204 ATGGAGGAGAGGTAGGCAGAGGG - Intergenic
1136498887 16:30659843-30659865 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
1136539095 16:30918701-30918723 AAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1136539905 16:30923521-30923543 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
1136556126 16:31009041-31009063 AAGGAGGAGCTGGTGGCTGAGGG - Intronic
1136587352 16:31195680-31195702 ATTCAGGAGCCCGAGGCGGAAGG - Intergenic
1136621009 16:31428245-31428267 ACGGAGGAGCAGGAGGTGAGTGG - Exonic
1136685944 16:31995021-31995043 ATGTAGGAGCGGGATGCGGACGG - Intergenic
1136716394 16:32286878-32286900 ATGGAGGAGATGGAGGAGAAGGG - Intergenic
1136786554 16:32938554-32938576 ATGTAGGAGCGGGATGGGGACGG - Intergenic
1136834780 16:33493156-33493178 ATGGAGGAGATGGAGGAGAAGGG - Intergenic
1136883214 16:33915240-33915262 ATGTAGGAGCGGGATGGGGACGG + Intergenic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137557030 16:49477239-49477261 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1137557041 16:49477263-49477285 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1137591062 16:49694191-49694213 AAGGGGGAGCAGGAGGGAGAGGG + Intronic
1137617498 16:49856230-49856252 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1137627186 16:49916618-49916640 ATGGAGAACCAGGAGGCTGCTGG - Intergenic
1137979258 16:53055665-53055687 CTGGAGGAATAGGAGGAGGAGGG - Intronic
1138070649 16:53989833-53989855 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1138126165 16:54440468-54440490 ATGGAGGAGGAGGAGGAAGGAGG - Intergenic
1138153974 16:54685892-54685914 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1138395351 16:56700030-56700052 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1138541602 16:57691055-57691077 AAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1138541608 16:57691080-57691102 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1138541623 16:57691135-57691157 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1138773026 16:59687513-59687535 ATGGTGGAGCAGGAGGAAGAGGG + Intergenic
1138830882 16:60373515-60373537 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139228776 16:65260269-65260291 ATGGAGGAACAGGAGGCAGCAGG - Intergenic
1139346278 16:66305922-66305944 ATGGTGGAGCAGGAGAGAGAGGG - Intergenic
1139531712 16:67545763-67545785 ATGGACGAGCAGGGAGCTGAGGG - Exonic
1139946330 16:70644909-70644931 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
1139946339 16:70644944-70644966 AAGGAGGAAGAGGAGGAGGAAGG + Intronic
1140394383 16:74614419-74614441 ATGGAGGAACAGGAGGCTAAGGG - Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141148375 16:81547617-81547639 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1141202813 16:81910732-81910754 AGGGTGGAGCAGGAGGCAGGCGG + Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141530509 16:84643395-84643417 TGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1141535576 16:84677564-84677586 ATGCAGCAGCAGGAGGCAGCAGG + Intergenic
1141660430 16:85438358-85438380 GGGGAGGGACAGGAGGCGGAGGG + Intergenic
1141703586 16:85653211-85653233 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1141703590 16:85653217-85653239 AGGGGGGAGGAGGAGGAGGAGGG - Intronic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1141703609 16:85653261-85653283 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1141713932 16:85716343-85716365 AGGGAGGAGGAAGAGGAGGAAGG + Intronic
1141729465 16:85812096-85812118 TTGGTGCAGCAGGACGCGGAGGG + Intergenic
1141775671 16:86121465-86121487 AGGGAGGAGGAGGAGGAGGGAGG - Intergenic
1141775761 16:86121756-86121778 AGGCAGGAGGAGGAGGAGGAGGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141810737 16:86373717-86373739 AGGGAGGAGCAGGCGGCACAGGG + Intergenic
1141845133 16:86603444-86603466 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845144 16:86603501-86603523 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845155 16:86603558-86603580 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845166 16:86603615-86603637 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845177 16:86603672-86603694 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845188 16:86603729-86603751 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141891759 16:86930884-86930906 GAGGAGGAGGAAGAGGCGGAGGG - Intergenic
1142125966 16:88410896-88410918 CTGGAGGAGGAGGAGGTGGGAGG - Intergenic
1142126259 16:88412064-88412086 AGGGAGGTGCAGGGGGCGGGGGG + Intergenic
1142138480 16:88462142-88462164 ACGGAGGCACAGGAGGCTGAGGG - Intronic
1142155814 16:88532463-88532485 AAGGCGGAGGAGGAGGAGGAGGG + Intronic
1142283462 16:89161098-89161120 GTGGAGGACTCGGAGGCGGAGGG + Intergenic
1142399197 16:89850472-89850494 GAGGAGGAGGAGGAGGCCGAGGG + Exonic
1203010023 16_KI270728v1_random:230876-230898 ATGGAGGAGATGGAGGAGAAGGG + Intergenic
1203088789 16_KI270728v1_random:1200220-1200242 ATGTAGGAGCGGGATGGGGACGG - Intergenic
1203141786 16_KI270728v1_random:1771705-1771727 ATGATGGAGGAGGAGGAGGAGGG - Intergenic
1203144950 16_KI270728v1_random:1793444-1793466 ATGGAGGAGATGGAGGAGAAGGG - Intergenic
1142475019 17:183533-183555 AAGGAGGAGGAAGAGGAGGACGG + Intergenic
1142863420 17:2776837-2776859 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143193778 17:5059801-5059823 AAGGAGGAGGAGGAGGAGGGGGG - Intergenic
1143284923 17:5781800-5781822 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284929 17:5781834-5781856 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284946 17:5781924-5781946 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143331875 17:6143371-6143393 ATGGAGGAGCTAGAGATGGATGG - Intergenic
1143370649 17:6436884-6436906 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1143391459 17:6561410-6561432 AAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1143410849 17:6707504-6707526 AAGGAGGAGAAGGAGGAGGAGGG + Intronic
1143583207 17:7838324-7838346 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1143583866 17:7841888-7841910 CTGGGGGAGGGGGAGGCGGAGGG - Intronic
1143622178 17:8087009-8087031 ATGAAGGAGCAGGATGGAGAAGG + Intronic
1143875100 17:9985456-9985478 ATGGGGGAGCAGGAGGCGGCAGG - Intronic
1143976207 17:10831795-10831817 ATGGAGGAGCAGGAGAAGCCTGG + Intronic
1144215349 17:13050346-13050368 ATGGGTGAGAAGGAGGGGGAAGG - Intergenic
1144576336 17:16432043-16432065 ATGGAGGGACAGGAGGACGAGGG + Exonic
1144764109 17:17723690-17723712 AGGGAGGAGGAGGAGGGGGCAGG - Intronic
1145014539 17:19387671-19387693 CTGGGGGAGCAGAAGGCTGAGGG + Intergenic
1145080390 17:19890148-19890170 ATGGTGGTGCAGGATACGGAAGG + Intergenic
1145265128 17:21376421-21376443 ATGGAGGGCGAGGAGGCGGCGGG - Exonic
1145774261 17:27516512-27516534 GGGGAGGAGGAGGAGGGGGAGGG - Intronic
1145839345 17:27981148-27981170 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1146453704 17:32993815-32993837 AAGGAGGAGCAGGAGGGGAACGG + Intronic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1146714047 17:35068789-35068811 ATGGAGGAGGAGGAGGAGAAAGG + Intronic
1146915607 17:36676444-36676466 GTAGAGGAGGAGGAGGAGGAGGG + Intergenic
1146987349 17:37232897-37232919 ATGGAGGAGGAGGAGGACAAGGG - Intronic
1147242379 17:39099015-39099037 AAGGAGGAACAGGAGACAGAGGG + Intronic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147331082 17:39699999-39700021 AAGGAGGAGGTGGAGGAGGAGGG + Intronic
1147635716 17:41962631-41962653 ATGGAGGACATGGAGGCAGAGGG + Intronic
1147945548 17:44078245-44078267 GTAGAGGAGCAGGAGGGGCAAGG + Exonic
1147953726 17:44121149-44121171 AGGGAGGAGGCGGAGGCAGAGGG + Intronic
1147971199 17:44219792-44219814 AGGGAGGAGGAGGAGCGGGAGGG + Intronic
1148126798 17:45241487-45241509 GTGGAGGAGCTGGAGGAGAAGGG + Exonic
1148342492 17:46881652-46881674 ATTGAGCAGCTGGAGGTGGAGGG - Intronic
1148556232 17:48580437-48580459 AGGGAGGAGGAAGAGGCGGCTGG + Intronic
1148562046 17:48611878-48611900 TTGGGGGAGCAGGAGGAGAAGGG - Intronic
1148573060 17:48685968-48685990 GTGGAGGAGGAGGAAGAGGATGG + Intergenic
1148574541 17:48700161-48700183 GAGGAGGAGGAGGAGGCGGAAGG + Intergenic
1148690195 17:49522731-49522753 AGGGAGGCCCAGGAGGCAGAGGG + Intergenic
1148698775 17:49576139-49576161 CTGAAGGAGCAGGAAGGGGAAGG + Exonic
1148854403 17:50570816-50570838 ATGGGGTAGGAGGAGGGGGAGGG + Intronic
1149107066 17:52982544-52982566 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1149107105 17:52982651-52982673 AAGGAAGAGGAGGAGGGGGAGGG - Intergenic
1149273173 17:55004752-55004774 GAGGAGGAGAAGGAGACGGAGGG + Intronic
1149563777 17:57627738-57627760 AGGACGGAGCAGGAGGAGGAGGG - Intronic
1149594153 17:57853959-57853981 TTGAAGGAGCAGGAGAGGGACGG - Intergenic
1149657729 17:58319122-58319144 ATGGAGCAGCAGCAGGGGGGTGG + Exonic
1149659907 17:58328830-58328852 GGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1149785804 17:59433926-59433948 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1149797916 17:59538476-59538498 AAGGAGGAGAAGGAGGAGAAGGG - Intergenic
1150364827 17:64573141-64573163 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1150364843 17:64573177-64573199 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
1150364876 17:64573254-64573276 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1150747375 17:67826151-67826173 GAGGAGGAGGAGGAGGAGGACGG + Exonic
1150890545 17:69144248-69144270 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1150964019 17:69947219-69947241 CAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1151158736 17:72146754-72146776 AAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151351383 17:73534080-73534102 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1151355771 17:73557636-73557658 AGAGAGGAGGAGGAGGAGGATGG - Intronic
1151362078 17:73595202-73595224 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1151569537 17:74919406-74919428 ATGGAGGAGCAGGAGTTGGAAGG - Intronic
1151852191 17:76697649-76697671 ATGGAGGAGGTGGAGGCGGGAGG + Intronic
1151965468 17:77429037-77429059 AACCAGGAGCAGGGGGCGGAGGG - Intronic
1151993924 17:77596763-77596785 ATGAAGGTGCAGGCTGCGGAAGG - Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152055582 17:78023400-78023422 GAGGAGGAGCAGGAGAAGGAAGG - Intronic
1152124550 17:78438425-78438447 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1152232014 17:79118435-79118457 ATGAGGGAGGAGGAGGGGGAAGG + Intronic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152277624 17:79367345-79367367 GAGGAGGAGTAGGAGGAGGAGGG - Intronic
1152315945 17:79580260-79580282 ATGGGGGGGGAGGAGGAGGACGG - Intergenic
1152315955 17:79580279-79580301 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1152401640 17:80070101-80070123 ATGGAGGAGGAAGGAGCGGAAGG + Intronic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152609183 17:81307363-81307385 AAGGAGGAGGGGGAGGGGGAGGG - Intergenic
1152956313 18:44998-45020 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1153797498 18:8637929-8637951 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1153950494 18:10054126-10054148 ATGGAGGAGCAGGTAGGGGAGGG + Intergenic
1154279178 18:12986925-12986947 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
1154991112 18:21599699-21599721 AGGGAGGAAGAGGAGGAGGAAGG - Intronic
1155000506 18:21681524-21681546 ATGGAGGGGAAGGAGGCTGGAGG - Intronic
1155063228 18:22247039-22247061 AGGGAGGAGGAGGAGCAGGAGGG + Intergenic
1155066493 18:22273660-22273682 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155066536 18:22273762-22273784 ATGGAGGAGGAGGAGGGAGGAGG - Intergenic
1155066544 18:22273785-22273807 ATGGAGGAGGAGGAGGGAGGAGG - Intergenic
1155348234 18:24879764-24879786 ATGGAGGAGGAGGAGAGGAAGGG - Intergenic
1155365836 18:25048157-25048179 ATAGAGGAGCTGGAGGAGGATGG + Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156315449 18:35965087-35965109 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1156337368 18:36183628-36183650 CTGGAGGAGGAGGTGGGGGAAGG - Intergenic
1156361420 18:36387726-36387748 GTGGAGGAGCAGCAGGGAGATGG - Intronic
1156736078 18:40261811-40261833 GAGCAGGAGCAGGAGACGGAGGG - Intergenic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157589683 18:48828908-48828930 GAGGAGGAGCAGGCGGGGGAAGG - Intronic
1157656326 18:49393030-49393052 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1157711359 18:49851987-49852009 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1157768665 18:50325138-50325160 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1157775827 18:50395326-50395348 AAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1157837119 18:50915089-50915111 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1158257323 18:55566310-55566332 GTAGAGGGGCAGGAGGCGGGTGG + Intronic
1158646731 18:59254964-59254986 GAGGGGGAGCGGGAGGCGGAGGG - Intergenic
1159079793 18:63724254-63724276 ACAGAGGAGGAGGAGGAGGAAGG - Intronic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159517671 18:69478395-69478417 AAGGAGGAGAAGGAAGGGGAGGG - Intronic
1159734441 18:72076464-72076486 ATGGCGGAGCAGGAGAGAGAGGG + Intergenic
1159740950 18:72169446-72169468 ATACAGGAGCAGGAGGAAGATGG - Intergenic
1159877391 18:73827645-73827667 AGGGAGGAGCAAGAGAAGGATGG + Intergenic
1160007179 18:75076037-75076059 AGGGAGGAGGAGGAGGAAGAGGG + Intergenic
1160133583 18:76251852-76251874 GTGGAGGAAGAGGAGGCGGGTGG - Intergenic
1160254226 18:77233865-77233887 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1160337731 18:78057528-78057550 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1160406145 18:78647453-78647475 CCGCAGGAGCAGGAGGCGGAGGG + Intergenic
1160448681 18:78947133-78947155 AGGGAGGAGGAGGGGGAGGAAGG + Intergenic
1160641810 19:145382-145404 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1160701824 19:511237-511259 AGGGAGGAGGAGGAAGAGGAAGG - Intronic
1160819711 19:1052344-1052366 CTTGAGGAGGAGGAGGGGGAGGG + Intronic
1160845623 19:1164806-1164828 GAGGAGGAGCAGGAGGAGGGAGG + Intronic
1160965783 19:1746329-1746351 ATGGAGGAGGAGGGGGAGGAAGG + Intergenic
1160983427 19:1827029-1827051 GAGGAGGAGGAGGAGGAGGATGG + Exonic
1161050993 19:2164077-2164099 AGGGAGGGGCGGGAGGCTGAGGG - Intronic
1161266613 19:3367251-3367273 TTGGAGGCCCAGGAGGGGGAAGG + Intronic
1161370603 19:3908843-3908865 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1161381041 19:3965014-3965036 GTGGGGGTGGAGGAGGCGGAGGG + Intronic
1161415624 19:4145138-4145160 AAGGAGGAGGAGGAGGAGGGAGG + Intergenic
1161513210 19:4683093-4683115 GAGGAGGAGGAGGAGGCAGACGG - Intronic
1161535649 19:4817279-4817301 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
1161648716 19:5470818-5470840 AAGGAGGGGAAGGAGGGGGAGGG + Intergenic
1161727664 19:5939591-5939613 AAGGAGGTGCAGGCGGGGGAGGG + Intronic
1161768309 19:6218617-6218639 CTGCAGGAGGAGGAGGCGGGTGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161864293 19:6822258-6822280 GTGGAGAATGAGGAGGCGGAAGG + Exonic
1161865971 19:6832474-6832496 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1162053054 19:8046701-8046723 GAGGAGGAGAAGGAGGAGGAAGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162076586 19:8191965-8191987 AAGGAGGAGGAGGAGAAGGAGGG + Intronic
1162181460 19:8871895-8871917 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1162346246 19:10119653-10119675 GTGGAGGAGGAGGGGGAGGACGG - Exonic
1162721627 19:12666269-12666291 TTGGAGGGGCAGGAGGTGGCAGG - Intronic
1162744754 19:12792124-12792146 GTGGAGGTGCAGGGGGCGCAGGG + Exonic
1162918138 19:13885166-13885188 GGGGAGGAGAAGGAGGAGGAGGG + Intronic
1163146191 19:15380372-15380394 AAGGAGCAGGAGGAGGCTGAGGG - Exonic
1163153015 19:15425796-15425818 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1163160277 19:15460135-15460157 ATGCAGGAGGTGGAGGAGGAGGG + Intronic
1163171187 19:15532344-15532366 GTGGAGGAGGAGGAGGGGGATGG - Intronic
1163463080 19:17450702-17450724 AAGGAAGAGGAGGAGGAGGAGGG - Intronic
1163463092 19:17450740-17450762 AAGGAGGAGGAGGAGAAGGAAGG - Intronic
1163545042 19:17936368-17936390 ATGGGGGAGCAGGGGCCGGAGGG - Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1163818068 19:19479762-19479784 ATGGTGGAGCAGGGGAAGGAGGG - Intronic
1164081136 19:21862346-21862368 ATGGAGGTGAAGGATGTGGAAGG - Intergenic
1164145490 19:22510196-22510218 AGGGTGGGGCAGGAGGTGGAGGG + Intronic
1164412925 19:28020715-28020737 AAGCAGGAGCGGGAGGAGGAGGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164558861 19:29274755-29274777 GTGGAGGGACAGGAGGTGGAAGG + Intergenic
1164567673 19:29339512-29339534 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1165069753 19:33248494-33248516 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1165169871 19:33884386-33884408 CTGGAGGAGCAGGCGGGGAAGGG - Intergenic
1165307997 19:35013818-35013840 ATGGAGGAACAGGACAGGGAGGG + Intronic
1165361939 19:35342091-35342113 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1165363346 19:35350190-35350212 AGGAAGGAGCGGGAGGAGGAAGG - Intergenic
1165411696 19:35666241-35666263 GTGGAGGAGTTGGAGGTGGAGGG - Intergenic
1165416021 19:35694056-35694078 AGGGAGGAGGAGGAGGGAGAAGG - Intergenic
1165416072 19:35694257-35694279 AAGGAGGAGGAGGAGGAAGAAGG - Intergenic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165773638 19:38392223-38392245 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
1165925623 19:39324392-39324414 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166234635 19:41446599-41446621 GGGGAGGCACAGGAGGCGGAGGG + Intergenic
1166328273 19:42064510-42064532 ATGGAGGGTGAGGAGGCAGATGG - Intronic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1166626547 19:44362219-44362241 ATGGAGGAGAAGGGGGAGGAAGG + Intronic
1166635995 19:44452402-44452424 AGAGAGGAGCAGGAGGAGCACGG + Intergenic
1166700220 19:44878044-44878066 ATGGAGGAGGAGGAGGAGGGGGG - Intronic
1166714061 19:44955399-44955421 GCGGCGGCGCAGGAGGCGGACGG + Exonic
1166737422 19:45094314-45094336 TTGGAGGAGGAGGCGGCGGTAGG - Intronic
1166888478 19:45975372-45975394 AGGGAGGAGCAGGGGGGGGTTGG - Intergenic
1166960290 19:46492917-46492939 AAAGAGGAGGAGGAGGGGGAGGG - Exonic
1167019176 19:46861312-46861334 ATGGAGGAGCTGGAGGGGGAGGG + Intergenic
1167056047 19:47112300-47112322 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1167058850 19:47130931-47130953 ATGGTGGAGAAGGAGGAGGCTGG + Exonic
1167104573 19:47422389-47422411 AAGGAGGATGAGGAGGAGGACGG - Intergenic
1167130493 19:47582177-47582199 AAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1167134493 19:47608840-47608862 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1167139215 19:47638113-47638135 AAGAAAGAGCAGGAGGAGGAGGG - Intronic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167249768 19:48393714-48393736 TTGGAGGAGCTGGAGCGGGAGGG - Intergenic
1167419686 19:49395585-49395607 ATGGAAAAGCAGGAGGGGCAAGG - Intronic
1167554191 19:50183043-50183065 AAGGAGGGGAAGGAGGAGGAAGG - Intergenic
1167608486 19:50494359-50494381 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167622036 19:50566072-50566094 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1167637348 19:50662518-50662540 GTGGAGGAGGAGGAGGCTGAGGG + Exonic
1167698782 19:51030238-51030260 ATGGAGGAGGGGGAGGGGCAGGG - Intronic
1167775643 19:51553004-51553026 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1167775656 19:51553039-51553061 GGGGAGGAGAAGGAGGAGGAGGG + Intergenic
1167824581 19:51960727-51960749 AAGGACGAGCAGGAGACAGATGG + Intergenic
1167827051 19:51983443-51983465 AGGGAGGAGCAGGAGACAGATGG - Intronic
1168063268 19:53906041-53906063 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168240323 19:55085975-55085997 TTAGAGGAGCGGGAGGCTGAGGG + Intronic
1168357719 19:55712862-55712884 AAGGAGGGGGAGGAGGAGGAGGG + Intronic
1168418216 19:56183001-56183023 AGGGTGGAGCAGGGGGAGGAGGG - Intronic
1168510984 19:56973395-56973417 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1168694324 19:58396204-58396226 GAGGAGGAGGAGGAGGAGGAAGG + Exonic
924968581 2:101345-101367 ATGGAGGAGGAGGAAAGGGAGGG - Intergenic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925034238 2:673732-673754 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925358552 2:3261341-3261363 ATGAATGAGCAGAAGGCTGAGGG + Intronic
925545461 2:5011229-5011251 AAGGAGGAGAGGGAGGGGGAAGG - Intergenic
925894416 2:8460322-8460344 ATGGAGCAGCGGGGGGTGGAGGG - Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926146127 2:10398092-10398114 ATGCAGGAGCAGGTGGGGCAGGG - Intronic
926166483 2:10524433-10524455 GTGGAGGAGCAGCAGCTGGAGGG + Intergenic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
926401482 2:12501606-12501628 GTGGAGGGGCAGGAAGGGGAAGG - Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926619471 2:15034043-15034065 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927209347 2:20629301-20629323 ATGGAGGAGGAGGAGGACCAGGG - Intronic
927521880 2:23703897-23703919 ACGGAGGAGTGGGAGGAGGAGGG + Intronic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927705634 2:25294873-25294895 AGGGAGGAGGAGGAGGGGGCTGG - Intronic
927868685 2:26609515-26609537 ATGCAGGAGACGGAGGCAGAGGG + Intronic
927992445 2:27457739-27457761 CTGCAGGAGCTGGAGGCTGAAGG - Exonic
928090937 2:28374746-28374768 CTGGTGCAGCACGAGGCGGAGGG + Intergenic
928108444 2:28488178-28488200 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
928437038 2:31261429-31261451 AAGTAGGAGCAGGAGGAGGCGGG + Intronic
928904558 2:36356043-36356065 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
929094086 2:38247429-38247451 ATGGACCATCAGGAGGCTGAGGG + Intergenic
929388730 2:41442904-41442926 CTGGAGGGGCTGGAGGTGGAGGG - Intergenic
929484069 2:42339310-42339332 ATGGAGGAGCAAGAGCCGCTGGG - Intronic
929581667 2:43085395-43085417 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
929979900 2:46668650-46668672 GTGGAGAAGCAGGAGTCGCAAGG - Intergenic
930098714 2:47586801-47586823 ATGGTGGTGCAGGATACGGAAGG + Intergenic
930155809 2:48106737-48106759 ATGGAGGAGGGGGGGCCGGATGG - Intergenic
930362162 2:50394845-50394867 CTGGAGGAGCATGAGCAGGAAGG - Intronic
930364689 2:50424310-50424332 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
930374745 2:50551084-50551106 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
930411621 2:51032161-51032183 GAGGAGGAGAAGGAGGAGGAGGG + Exonic
930928194 2:56847180-56847202 ATGGAGGAGCAAGAGGGTGTGGG + Intergenic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931205343 2:60140846-60140868 GAGGAGGAGAAGGAGGGGGAGGG - Intergenic
931513152 2:63022297-63022319 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
931902759 2:66807550-66807572 GAGGAGGAGGAGGAGGGGGAAGG + Intergenic
932208165 2:69902298-69902320 AAGGAGGAGGAGGAGGAAGAAGG - Intronic
932404605 2:71504850-71504872 AAGGAGCAGGAGGAGGCGAAGGG - Intronic
932435174 2:71699197-71699219 ATGGAGGAGAAGGAGGGGTGAGG - Intergenic
932624106 2:73284395-73284417 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
932993129 2:76812788-76812810 AAGGAGGAGGAGGGGGGGGAGGG - Intronic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
933441113 2:82315418-82315440 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
933772104 2:85751166-85751188 ATGGGGCAGGAGGAGGCGAAGGG - Intergenic
933938754 2:87228102-87228124 AGAGAGAAGCAGGAGGCGGCTGG - Intergenic
934653187 2:96104025-96104047 ATGGAGGGGGAAGAGGAGGAGGG - Intergenic
934653221 2:96104131-96104153 AAGGAGGAGGAGGAGGGGGTAGG - Intergenic
934753575 2:96809973-96809995 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
935157631 2:100497275-100497297 GTGGAGGAGAGGGAGGCGGTGGG - Intergenic
935217828 2:100988729-100988751 CTGGAGGAGCAGGGGGCGCCTGG - Intronic
935217906 2:100988951-100988973 CTGGAGGAGCAGGGGGCGCCTGG - Intronic
935531665 2:104240362-104240384 AGGGAGGAGGATGAGGAGGAGGG + Intergenic
935672735 2:105569849-105569871 AGTGAGGAGCAGGATGCAGAAGG + Intergenic
935718628 2:105960420-105960442 ATGGAGGTCAAGGAGACGGAGGG - Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
935761292 2:106322959-106322981 GGGGAGGGGCAGGAGGAGGAGGG + Intergenic
936031874 2:109079152-109079174 GGGGAGGAGGAGGAGGAGGAGGG - Intergenic
936087717 2:109480625-109480647 TGGGAGGAGGAGGAGGAGGATGG + Intronic
936350227 2:111706893-111706915 ATGGAGGCTCAGGAGGCACAAGG - Intergenic
936354382 2:111737673-111737695 AGAGAGAAGCAGGAGGCGGCTGG + Intergenic
936379399 2:111970725-111970747 AGGGAGGAGTAGGGGGAGGAAGG - Intronic
936379409 2:111970751-111970773 AGGGAGGAGGAGGAGGAGAAGGG - Intronic
936379414 2:111970767-111970789 AGGGAGGAGGAGGAGGAGGGAGG - Intronic
936379426 2:111970799-111970821 AGGGAGGAGGAGGAGGAGGGGGG - Intronic
936379438 2:111970825-111970847 AAGGAGGAGAAGGAGGAGGGAGG - Intronic
936386028 2:112030125-112030147 ATGCAGGAGCAGGAGCAAGAGGG + Intergenic
936714006 2:115162915-115162937 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
936962265 2:118088480-118088502 GTGGAGGAGGAAGAGGCGGTAGG + Exonic
937030110 2:118731910-118731932 AGGGAGGAGAAAGAGGCAGAAGG - Intergenic
937217330 2:120321169-120321191 AGGGAGGAGGAGGAGGAGGGAGG - Intergenic
937217336 2:120321185-120321207 AGGGAGGAGGAGGAGGAGGGAGG - Intergenic
937217342 2:120321201-120321223 AGGGAGGAGGAGGAGGAGGGAGG - Intergenic
937217353 2:120321230-120321252 AGGGAGGAGGAGGAGGAGGGAGG - Intergenic
937217359 2:120321246-120321268 AGGGAGGAGGAGGAGGAGGGAGG - Intergenic
937217365 2:120321262-120321284 AGGGAGGAGGAGGAGGAGGGAGG - Intergenic
937217371 2:120321278-120321300 AGGGAGGAGGAGGAGGAGGGAGG - Intergenic
937341444 2:121093612-121093634 AAGGAGGAGGAGGAGGAGAAGGG + Intergenic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
937490257 2:122359548-122359570 AAGGAGGAGGAGTAGGAGGATGG - Intergenic
937878821 2:126849933-126849955 AAGGAGGAGGAGGAGCAGGAAGG + Intergenic
937901161 2:127020159-127020181 AAGGAGGAGCAAGTGTCGGAGGG + Intergenic
937917268 2:127105467-127105489 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
937969413 2:127537723-127537745 AAGGAGGAGGAGGAGAAGGAAGG + Intronic
937977462 2:127590261-127590283 AGGGAGGAGGAGGAGGCTGATGG + Intronic
938212322 2:129478980-129479002 ATGGAGGAAGCGGAGGAGGAAGG - Intergenic
938272825 2:129990256-129990278 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
938443405 2:131355852-131355874 AAGGAAGAGAAGGAGGAGGAGGG - Intergenic
938546940 2:132342165-132342187 ATGGAGGAGAAGTGGGTGGAAGG - Intergenic
938673889 2:133611268-133611290 ATGGAGGAGGTGGTGGCGGGTGG - Intergenic
938736611 2:134191731-134191753 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
938836046 2:135105219-135105241 AGGGGGGAGCGGGAGGGGGAAGG - Intronic
938875945 2:135531604-135531626 ACTGAGGAGGAGGAGGCGGTTGG - Intronic
939004004 2:136765479-136765501 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
939054835 2:137352160-137352182 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939969653 2:148644928-148644950 AAGGAGGTGGAGGAGGCGGCGGG + Intronic
939983241 2:148805691-148805713 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940011537 2:149060025-149060047 AAGGAGGAGGAGGAGGGGGCAGG + Intronic
940216131 2:151305396-151305418 AAGGAGGAGGAGGAGGGGAAGGG + Intergenic
940344966 2:152619585-152619607 CTGGGAGAGGAGGAGGCGGAGGG - Exonic
940463887 2:154003810-154003832 AAGGAGGAAGAGGAGGGGGAAGG - Intronic
940696375 2:156984666-156984688 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
940719349 2:157264739-157264761 CTGGAGGAGGAAGAGGAGGAGGG + Intronic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
940945697 2:159615620-159615642 AAAGGGCAGCAGGAGGCGGACGG + Intronic
941016417 2:160362489-160362511 ATGGAGGAGAAGGAGACAGAAGG + Intronic
941208325 2:162602895-162602917 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
941357916 2:164515174-164515196 AAGGAGGATCAGGTGGTGGATGG - Intronic
942043230 2:172084660-172084682 AGGGAGGGGGAGGAGGAGGAAGG + Intergenic
942266644 2:174234113-174234135 GAGGAGGAGAAGGAGGTGGAGGG - Intronic
942507326 2:176656932-176656954 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
942524809 2:176841808-176841830 AGAGAGGAGGAGGAGGAGGAAGG - Intergenic
942686955 2:178542836-178542858 AGGAAGCAGCAGGAGGTGGACGG + Exonic
942812233 2:180013051-180013073 ATGGATGAACAGGGGGCTGAGGG - Intergenic
942965861 2:181891919-181891941 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
943806218 2:192130281-192130303 ACAGAGGAGAAGGAGGAGGAAGG - Intronic
943820663 2:192315725-192315747 ATGGGGCAGCAAGAGGCAGATGG - Intergenic
944100374 2:196019937-196019959 AAGGGGGAGGAGGAGGGGGAGGG - Intronic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945599340 2:211839173-211839195 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
945699235 2:213150455-213150477 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
946027198 2:216679080-216679102 CTGCAGGAGAAGGAGCCGGAGGG + Intronic
946185828 2:217979871-217979893 ATCCAGGAGAAGGAGGTGGATGG - Intronic
946269470 2:218578651-218578673 AAGAAGGAGCGGGAGGCGGGGGG - Intronic
946307932 2:218866400-218866422 ATGGAGGAGGAGGAGACACAGGG + Intronic
946339777 2:219059815-219059837 CTGGAGGCGCAGGAGGCAGCCGG + Intronic
946370788 2:219280149-219280171 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
946501830 2:220257323-220257345 GAGGAGGAGGAGGAGACGGAGGG + Intergenic
946662808 2:222019276-222019298 ATGGATGGCCAGGAGGCTGAGGG + Intergenic
947598804 2:231431789-231431811 ATGGTGGAGCAGGATATGGAAGG + Intergenic
947715405 2:232336580-232336602 AAGGAGGAGGAGGAGTCTGACGG + Exonic
947760945 2:232603411-232603433 GAGGAGGAGGAGGAGGTGGAAGG + Intergenic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
948237744 2:236403119-236403141 AAGGAAGAGGAGGAGGGGGAGGG + Intronic
948558582 2:238835312-238835334 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
948686967 2:239675879-239675901 CTGGAGGGGCAGGAGGCGGGGGG - Intergenic
948838299 2:240636796-240636818 ATGCAGGAACAGAAGGGGGAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1169214413 20:3785177-3785199 GGGGAGGAGGAGGAGGAGGAAGG - Exonic
1169765574 20:9144661-9144683 AAGGAGGAGGAGGAGGGGGAAGG + Intronic
1169884794 20:10387261-10387283 AGTGAGGAGCAGGATGCTGATGG + Intergenic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170024268 20:11872005-11872027 AAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170687684 20:18584326-18584348 ATGGTGGAGCAGGATGCTGCAGG + Intronic
1171038648 20:21739470-21739492 AGGGAGGATCAGGTGGTGGATGG + Intergenic
1171817917 20:29804908-29804930 AGGGACGAGCAGGAGACAGATGG - Intergenic
1171868152 20:30505616-30505638 AGGGGGGAGCAGGGGGAGGAAGG - Intergenic
1171875805 20:30574898-30574920 ATGGAGGAGAAGTGGGTGGAAGG - Intergenic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172193337 20:33075473-33075495 AAGGATGGGCAGGAGGGGGATGG - Intergenic
1172228772 20:33323158-33323180 AAGAAGGGGCAGGAGGAGGAAGG + Intergenic
1172347346 20:34213157-34213179 ATGGAGGAGAAGGAGCAAGAAGG - Intronic
1172530345 20:35626646-35626668 ATGGAGCAGCTGGACGCTGATGG - Exonic
1172644585 20:36461701-36461723 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1172978905 20:38926548-38926570 CTGGAGGAGCTGGTGGCGGGCGG + Exonic
1173344285 20:42184499-42184521 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1173666909 20:44769621-44769643 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1173775128 20:45698985-45699007 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
1173918247 20:46725572-46725594 AGGGAGGAAGAGGAGGCTGAGGG - Exonic
1174110631 20:48195556-48195578 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1174291839 20:49514354-49514376 AAGGAAGAGCAGGAGCCAGAAGG + Exonic
1174400901 20:50275272-50275294 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1174569690 20:51492686-51492708 CTTGGGGAGCAGGAGGCGGCCGG + Intronic
1174639341 20:52029783-52029805 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1174898565 20:54475573-54475595 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1174960495 20:55151666-55151688 AGGAAGGAGGAGGAGGCGGAAGG - Intergenic
1175102232 20:56587480-56587502 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1175134798 20:56815151-56815173 AGAGAGGAGGAGGAGGGGGAGGG + Intergenic
1175199272 20:57266664-57266686 GAGGAGGAGGAGGAGGAGGACGG + Intergenic
1175339936 20:58222234-58222256 GTGGAGGAGGAGGAGCGGGAGGG + Intronic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1175385473 20:58592260-58592282 CTGGAGGAGCAGTAGGCGTGAGG + Intergenic
1175429383 20:58891271-58891293 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1175652345 20:60736254-60736276 ATGGAGGAACAGGAGGCAGGAGG - Intergenic
1175794928 20:61765574-61765596 GAGGAGGAGGAGGAGGAGGACGG + Intronic
1175893370 20:62325082-62325104 ATGGAGGGGCAGGCGGATGAGGG + Intronic
1175937279 20:62519594-62519616 TTGGAGGAAGTGGAGGCGGAGGG + Intergenic
1175954837 20:62603895-62603917 AGGAAGGGGCGGGAGGCGGATGG + Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1176218163 20:63957882-63957904 CTGGAGGAGCCGGAGGTGGAGGG - Exonic
1176362066 21:6006183-6006205 AAGGAGGAGGAGGAGGGGGGGGG + Intergenic
1176520195 21:7818475-7818497 AGGGAGGAGTGGAAGGCGGAAGG + Exonic
1176720411 21:10388120-10388142 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177431609 21:20997869-20997891 ATGGGGGATCTGGAGGCGGGCGG - Intergenic
1177507230 21:22034750-22034772 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1177969762 21:27775656-27775678 AAGGAAGAGCAGGAAGAGGAAGG - Intergenic
1178219696 21:30642302-30642324 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1178375539 21:32064598-32064620 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1178397119 21:32252417-32252439 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1178486088 21:33020868-33020890 ATGGGGGAGCTGGAGGCGGGTGG + Intergenic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178654221 21:34448487-34448509 AGGGAGGAGTGGAAGGCGGAAGG + Intergenic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1178710151 21:34909923-34909945 GAGGAGGAGGAAGAGGCGGAAGG - Intronic
1178723052 21:35027131-35027153 GTGGAGGGGCAGGGGGCGAAGGG + Intronic
1179182917 21:39061051-39061073 ATGGATGAGCAGGAGGCTCGGGG - Intergenic
1179250149 21:39665254-39665276 GTGGAGGGGCAGGAGGTGGTTGG - Exonic
1179623628 21:42634577-42634599 ATGGAGGAATAGGAGGATGATGG - Intergenic
1179761452 21:43532362-43532384 AAGGAGGAGGAGGAGGGGGGGGG - Intronic
1179885426 21:44312273-44312295 CTGGAGGAGCTGGTGGCGGAAGG + Exonic
1179941468 21:44641294-44641316 AAGGAGGAGGAAGAGGAGGAAGG + Intronic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1180059106 21:45375545-45375567 ATGGAGGAGGGGGAGGAGCAGGG + Intergenic
1180188008 21:46150006-46150028 ATGAAGGGGGAGGAGGGGGAGGG + Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301620 22:11040960-11040982 AAGGAGGAGGAGGAAGGGGAAGG + Intergenic
1180872536 22:19154647-19154669 AAGAAGGAGGAGGAGGGGGAGGG - Intergenic
1180960183 22:19759003-19759025 AGGGAGGAGGTGGAGGCGGGAGG + Intronic
1180974360 22:19839120-19839142 ATGGATCAGAAGGAGGGGGAGGG + Intronic
1181057696 22:20267866-20267888 AGGGCGGAGCCGGAGGCGGCAGG - Intronic
1181170112 22:21003362-21003384 AAGGAGGAGAAGGAGGAAGAAGG - Intergenic
1181284011 22:21739282-21739304 CCGGAGGTGCAGCAGGCGGAGGG - Intergenic
1181813626 22:25420851-25420873 GAGGAGAAGGAGGAGGCGGAGGG + Intergenic
1181813630 22:25420857-25420879 AAGGAGGAGGCGGAGGGGGAGGG + Intergenic
1181860332 22:25813127-25813149 AAGGAGGAGGAGGAGGGAGAGGG - Intronic
1181883399 22:25999576-25999598 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1181886074 22:26023476-26023498 GTAGAGGAGGAGGAGGAGGAGGG - Intronic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1181977198 22:26738428-26738450 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1182009009 22:26984881-26984903 ATGGAGGATCAGTAGGCTGGAGG + Intergenic
1182043666 22:27258021-27258043 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1182044384 22:27262827-27262849 ATGGAAGAGGGGGAGGCGGAGGG + Intergenic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182466786 22:30521911-30521933 AAGGAGGAGGAGGAGAGGGAGGG - Intergenic
1182512936 22:30832007-30832029 AAAGAGGAGCAGGAGGAGAAAGG - Intronic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182755876 22:32678530-32678552 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183252443 22:36739677-36739699 ATTGTGGAGTAGGAGGGGGAGGG - Intergenic
1183359434 22:37375836-37375858 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
1183385433 22:37511460-37511482 AAGGAGAAGGAGGAGGCGGGAGG + Intronic
1183496504 22:38147975-38147997 ATAGGGAAGGAGGAGGCGGAAGG + Intronic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183720158 22:39557844-39557866 CGGGAGGAGGAGGAGGCGGCGGG - Intergenic
1183737014 22:39649761-39649783 GAGGAGGAGGAGCAGGCGGATGG + Exonic
1183929872 22:41229864-41229886 ATGGAGGAGGAGGAGGGGCCGGG - Intronic
1184047211 22:41978910-41978932 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1184092484 22:42299829-42299851 AAGGGGGAGAAGGAAGCGGAGGG + Intronic
1184121191 22:42451653-42451675 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1184243727 22:43225190-43225212 ATGGAGGGGCAGGAGTGGGGGGG - Intronic
1184420979 22:44382782-44382804 GTGGAGGAGCAGGAGGGGCCTGG - Intergenic
1184479111 22:44736867-44736889 GTGCAGGAGCACGAGGCGGAGGG + Exonic
1184525263 22:45019049-45019071 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184789261 22:46689242-46689264 AGGGAGGGGCAGGAGGCAGCAGG - Intronic
1184908619 22:47510123-47510145 TGGGAGGAGCAAGAGGCAGAGGG + Intergenic
1185016788 22:48348044-48348066 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1185181380 22:49365459-49365481 CTGGAGGAGCAGGAGGATGGTGG - Intergenic
1185201284 22:49507074-49507096 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1185325360 22:50222882-50222904 AGGGGTGAGCAGGAGGCCGAGGG + Intronic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
1185398204 22:50603340-50603362 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
949094318 3:67739-67761 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949631019 3:5926628-5926650 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
949758638 3:7443030-7443052 AAAGAGGAGGAGGAGGAGGATGG - Intronic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
949952155 3:9238224-9238246 ATGGAGGAGATGGAGAAGGAAGG + Intronic
950126474 3:10512953-10512975 ATGGAGAAGCAGGAAGCACATGG - Intronic
950130054 3:10536466-10536488 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950704725 3:14772756-14772778 ATAGAGGGCCGGGAGGCGGAAGG - Intronic
951080335 3:18444869-18444891 AAGGAAGAGAAGGAGGGGGAGGG + Intronic
951080626 3:18445870-18445892 AGTGAGGAGCACGTGGCGGAAGG + Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951940904 3:28077803-28077825 ATGGAACAGCAGGGGGCGAAGGG + Intergenic
952107540 3:30087596-30087618 GGGGAGGAGGAGGAGGGGGAGGG - Intergenic
952107560 3:30087630-30087652 GGGGAGGAGGAGGAGGTGGAGGG - Intergenic
952107585 3:30087736-30087758 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
952343296 3:32462990-32463012 ATGGAGGTGCAGGATATGGAAGG + Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952892458 3:38052774-38052796 GAGGGGGAGGAGGAGGCGGAGGG - Intronic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953350278 3:42210096-42210118 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
953355744 3:42254919-42254941 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
953365403 3:42340420-42340442 AAGGAGGAGAAGGAGGAGGGGGG + Intergenic
953592211 3:44269348-44269370 AGGGAGGAGAAGGAGGAGGAGGG - Intronic
953616245 3:44493217-44493239 ATGGGGGAGCAGGGGGATGATGG - Intergenic
953866295 3:46586012-46586034 AAGGAGGAGAAGGAAGAGGAGGG + Intronic
954005625 3:47588232-47588254 GGCCAGGAGCAGGAGGCGGAGGG + Exonic
954649660 3:52153485-52153507 AGGGAGGAGCAGCTGGGGGAGGG + Intronic
954813464 3:53262397-53262419 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
954876441 3:53805868-53805890 ATGCGGGAGGAGGAGGAGGAGGG - Intronic
955087823 3:55720098-55720120 GAGGAGGAGGAGGAGGGGGATGG - Intronic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955232351 3:57110257-57110279 CTGGAGGAGCTGAAGTCGGAGGG - Exonic
955406976 3:58631665-58631687 GTGGAGGAGCAGGATGGGAAAGG + Intergenic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955740391 3:62084709-62084731 ATGGTGGGGAAGGAGGGGGAAGG - Intronic
955855516 3:63268663-63268685 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
955988575 3:64601008-64601030 ATGGAACTGCAGGAGGGGGAGGG - Intronic
956049761 3:65235373-65235395 ATGGAGTAGGAGGTGGAGGATGG - Intergenic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956348404 3:68306600-68306622 ATCCAGGAGGTGGAGGCGGAGGG - Intronic
956989308 3:74745077-74745099 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
957788353 3:84908984-84909006 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
957899926 3:86476169-86476191 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
958154594 3:89740352-89740374 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
958506134 3:94979316-94979338 ATGGTGGAGCAGGTGGAAGAGGG - Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959795881 3:110427863-110427885 ATGGAGAAGAAGGAGGCTGAGGG - Intergenic
959963814 3:112332219-112332241 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
959963832 3:112332291-112332313 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960044872 3:113186899-113186921 ATGGAGGAGCAGGAGGCTGAGGG + Intergenic
960051361 3:113241918-113241940 AGGGAGGAGGAGGAGGCTGGAGG + Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960836438 3:121911456-121911478 ATGGAGGAGGAGGAGGAGGGAGG - Intronic
961006690 3:123410309-123410331 GGGGAGGAGGAGGAGGGGGATGG - Intronic
961234825 3:125357263-125357285 GAGGAGGAGGAGGAGGCGGAGGG - Intronic
961371557 3:126434777-126434799 CTGGAGGGGCTGGAGGCTGAGGG + Intronic
961487512 3:127227270-127227292 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
961487516 3:127227276-127227298 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961726340 3:128933389-128933411 ATAGAGGAGAAGGAGGAGGCTGG + Intronic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
961817778 3:129560170-129560192 CTGGAGGGGCAAGAGGCTGAAGG - Intronic
961941034 3:130637102-130637124 TTGGAGGAGGGGGAGGGGGAGGG - Intronic
962054410 3:131854793-131854815 AAGGAGGAGGAGGAGGAGGGTGG - Intronic
963043428 3:141085393-141085415 AAGGTGGAGCAGCAGGCAGAAGG - Intronic
963320084 3:143801844-143801866 ATGGTGGTGCAGGATGTGGAAGG - Intronic
963335720 3:143972022-143972044 ATAGAGGAGCGGGAGGGGGAGGG - Exonic
963600949 3:147378431-147378453 AAAGAGGAGGAGGAGGAGGATGG + Intergenic
963652927 3:148006931-148006953 ACGGAGGAGGAGGAGAGGGAGGG - Intergenic
963711817 3:148755212-148755234 ATGGGGGAGCAGGAGAAGAAAGG - Intergenic
963742977 3:149097961-149097983 AGGGAGGGGGAGGAGGGGGAGGG + Intergenic
963828074 3:149977057-149977079 ATTGTGGAGCAGGAGGGGAAAGG + Intronic
963836831 3:150066696-150066718 GAGGAGGAGGAGGAGGGGGAAGG + Intergenic
963928198 3:150974050-150974072 AAGGAGGAGGAGGAGGAGAAAGG + Intergenic
963987807 3:151617335-151617357 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
964374428 3:156035578-156035600 AGGGGGGAGGAGGAGGAGGAAGG - Intergenic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964564344 3:158033209-158033231 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964568139 3:158080881-158080903 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965451576 3:168845384-168845406 GAGGAGGAGTAGGAGGAGGATGG - Intergenic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966908546 3:184544673-184544695 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
967019252 3:185508078-185508100 ATGGAGGAGCTGGAGGAGATGGG - Exonic
967188291 3:186963977-186963999 TTGCAGGGGCAGGAGGCAGAGGG + Intronic
967375604 3:188797115-188797137 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
967469766 3:189848212-189848234 GAGGAGGAGGAGGAGGCAGAGGG - Intronic
967858216 3:194134158-194134180 AGGGAGGCGGAGGAGGCGGCCGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967880552 3:194298480-194298502 AGGCAGGAGCAGGGGGCGCACGG - Intergenic
967915150 3:194573053-194573075 ATGGAGGTGGAGGAGTGGGAGGG - Intergenic
967977971 3:195045968-195045990 ATGGAGGTGGAGGAGGAGAACGG - Intergenic
967987742 3:195107636-195107658 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
968161612 3:196431965-196431987 ATGAAGGAGGAGGAGGAGGGCGG + Intronic
968293294 3:197555247-197555269 CCGGAGGAGGAGGAGGAGGAGGG + Intronic
968432285 4:566088-566110 ACGGAGGAGAGGGAGGTGGAGGG - Intergenic
968565554 4:1310802-1310824 AAGCAGGGGCAGGAGGCGGGTGG - Intronic
968762310 4:2449130-2449152 ATGAAGGAGCAGGAGGGGGCCGG - Intronic
968914165 4:3489913-3489935 ATGAATGAGCAGGAGACAGAAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969156689 4:5217372-5217394 ATGAAGGTGAAGGAGGCGGTGGG + Intronic
969233889 4:5851694-5851716 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
969235930 4:5865065-5865087 ATGGAGGAGGAGGAGGAGGCTGG - Intronic
969346731 4:6575041-6575063 AAGGAGGAGCTGGAGGCGCGGGG - Intergenic
969454702 4:7294667-7294689 GGGGAGGAGGAGGAGGAGGAGGG - Intronic
969509950 4:7612103-7612125 GTGGAGGTGCTGGAGGCTGACGG + Intronic
969511386 4:7620017-7620039 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969511391 4:7620033-7620055 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969617125 4:8260183-8260205 GAGGAGGAGCAGGAGAGGGAAGG - Intergenic
969838137 4:9860165-9860187 AGGGAGGAGAAGGAGGAGGAAGG - Intronic
970099156 4:12501382-12501404 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
970219706 4:13798049-13798071 CTGGAGGAGCAGGTGTCAGAAGG + Intergenic
970309644 4:14768536-14768558 ATGGTGGAGCAGGAGTGAGAGGG + Intergenic
970341852 4:15115683-15115705 AGGGAGGAGGAGGAGAAGGAAGG - Intergenic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971025233 4:22582833-22582855 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
971574540 4:28256593-28256615 AGGGAGGAGGAGGAGGAGGAGGG - Intergenic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
973180112 4:47256671-47256693 ATGGTGGAGCAGGAGAGAGAGGG + Intronic
973673654 4:53241755-53241777 ATGGTGGTGCAGCAGGAGGAGGG - Intronic
973966670 4:56170088-56170110 ATGGAGGAGGAAGAGGAGGAAGG - Intergenic
973978731 4:56288210-56288232 AAAGAAGAGCAGGAGGAGGAAGG - Intronic
973981893 4:56314583-56314605 CAGGAGGAGGAGGAGGCTGAGGG + Exonic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974229244 4:59088853-59088875 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975495415 4:75030890-75030912 ATGTAAGAGGAGGAGGAGGAGGG + Intronic
975504449 4:75122849-75122871 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
975645501 4:76542043-76542065 GAGGAGGAGGAGGAGGAGGATGG + Intronic
975864011 4:78707387-78707409 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976478386 4:85510799-85510821 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
976695800 4:87918705-87918727 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
976704692 4:88008025-88008047 GAGGAGGAGGAGGAGGTGGAAGG + Exonic
976777169 4:88719513-88719535 AAGGAGGAGAAGGAGGAGAAGGG - Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
977790262 4:101091871-101091893 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
978074567 4:104512773-104512795 ATGGAAGATGAGGAGGCTGAGGG + Intergenic
978264727 4:106810197-106810219 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
978268543 4:106859006-106859028 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
978350300 4:107814044-107814066 ATGCAGGAGGATGAGGTGGAAGG + Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978702307 4:111662589-111662611 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
978702311 4:111662595-111662617 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
978741818 4:112145647-112145669 CTGGCGGAGCGGGAGGCGGCAGG + Exonic
978838603 4:113183227-113183249 ATGGAGGTGGAGGAGGGAGAAGG + Intronic
979049785 4:115916221-115916243 AAGGAGGAGCTGGAGGAGGCTGG - Intergenic
979364907 4:119809863-119809885 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
979404893 4:120297623-120297645 ATGGAGGAGTGGGAGTGGGATGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980018917 4:127684624-127684646 AAGGAGGAGGAGGAAGAGGAAGG - Intronic
980190662 4:129520370-129520392 ATAGAGGAGAAGGAGAAGGAAGG + Intergenic
980420066 4:132547401-132547423 AAGGAGGAGGAAGAGGAGGAAGG - Intergenic
980884957 4:138752352-138752374 ATGGAGGAGCAGGAGAGAGAGGG - Intergenic
980910789 4:138992510-138992532 AGGGAGGAGGAGGAGGAAGAAGG + Intergenic
980969550 4:139556097-139556119 ATGGTGGAGGAGGCGGTGGAAGG - Exonic
980992329 4:139748524-139748546 CTGAAGGAGCAGGAGGCTGCTGG + Intronic
981025035 4:140069399-140069421 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981048909 4:140292045-140292067 ACAGAGGAGCAGGAGGCAGAGGG - Intronic
981412555 4:144449970-144449992 ATGGAAGAACATGATGCGGAAGG + Intergenic
981514027 4:145587770-145587792 GTGGAGGAGGAGGAGAAGGAAGG + Intergenic
981809662 4:148759493-148759515 GAGGAGGAGCAAGAGGAGGAGGG + Intergenic
982196939 4:152925876-152925898 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982373979 4:154667304-154667326 AAGGAGGAGGAGGAGGAGAATGG + Intronic
982416581 4:155140405-155140427 AAGGAGGATGAGGAGGAGGAGGG - Intergenic
982772384 4:159408797-159408819 ATGGGAGAGCAGGTGGGGGAAGG - Intergenic
982946446 4:161630119-161630141 ACGGAGGGGCAGGAAGGGGAGGG - Intronic
983660700 4:170128050-170128072 ATGGTGCAGCAGCAGGCTGAAGG + Intergenic
983913872 4:173269722-173269744 GTTGAGGAGGAGGAGGAGGAGGG - Intronic
983919821 4:173333856-173333878 CGGGAGGAGGAGGAGGAGGAGGG - Intronic
983928932 4:173432393-173432415 AGGGAGGAGAAGGAGGAGTAAGG - Intergenic
984070387 4:175103526-175103548 AGGGAGGAGTGGGAGGGGGAGGG + Intergenic
984714865 4:182916759-182916781 AGGGAAGAGCAGGAGAGGGAAGG + Intronic
984888884 4:184474077-184474099 AGGGAGGAGGAGGAGGAGGTTGG - Intronic
985011637 4:185588603-185588625 AAGGAGGAGGAGGAGGAGGGAGG - Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985085884 4:186312025-186312047 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
985140940 4:186840379-186840401 AAGGAGGAGAAGGAGGGGGAGGG - Intergenic
985140971 4:186840502-186840524 GGGGAGGAGAAGGAGGCGGGAGG - Intergenic
985140990 4:186840558-186840580 AGGGAGGAGAAGGAGGGGAAGGG - Intergenic
985382515 4:189409901-189409923 GGGAAAGAGCAGGAGGCGGAAGG - Intergenic
985440433 4:189979843-189979865 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
985892004 5:2723409-2723431 AAGAAGGAGCACGAGGCTGAAGG + Intergenic
985957986 5:3278805-3278827 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
985965065 5:3333263-3333285 ATGGAGGAGCAGGACGTGCATGG - Intergenic
986066614 5:4240611-4240633 ACGGAGGGGCAGAAGGCAGAAGG - Intergenic
986320841 5:6631906-6631928 TTGGAGGACCTGGAGGTGGACGG - Exonic
986879105 5:12147877-12147899 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
987292358 5:16520858-16520880 AAAGAGGAGCAGGAGGTGGCAGG + Intronic
987322450 5:16783132-16783154 ATGAAGGGGCAGGAGGCAGAAGG + Intronic
987353221 5:17039920-17039942 GAGGAGGAGAAGGAGGAGGATGG - Intergenic
987678358 5:21104775-21104797 ATAGAGGAGCAGGAAGATGAAGG + Intergenic
987985795 5:25144179-25144201 AAGGAGGAGGAGGAGGAAGAGGG + Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988255767 5:28818379-28818401 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
988497723 5:31758975-31758997 ATGGAGGTGGAAGAGGAGGAGGG - Intronic
988660462 5:33261582-33261604 TTGGAGGAGGAGGAGGAGGTGGG + Intergenic
988813367 5:34806713-34806735 AGGGAGGAGCAGGTGGGGCACGG + Intronic
989043342 5:37250524-37250546 ATAGAGGAGGAGGAAGAGGAGGG - Intergenic
989100132 5:37815485-37815507 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
989100565 5:37818922-37818944 ATGGTGGAGGGGGAGGCGCAGGG - Intronic
989122895 5:38021760-38021782 ATAGAGGAGAAGGAAGGGGAAGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
990311488 5:54543229-54543251 ATGGAGGTGCAGAAGGCTGACGG + Intronic
990449232 5:55919411-55919433 ATGAAGGAGCAGGGGCCAGAGGG - Intronic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
991524142 5:67537618-67537640 ATGAAGGGGCAGGAGGCAGACGG + Intergenic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992090672 5:73313080-73313102 AAGGAGGAGGAAGAGGAGGAAGG - Intergenic
992199329 5:74368331-74368353 AAGGAGGAGGAGGAGGCAGGGGG + Intergenic
992214909 5:74516431-74516453 AAAGAGGAGGAGGAGGAGGATGG - Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992375147 5:76181585-76181607 ATGGTGGAGCAGGAGAGAGAGGG + Intronic
993076778 5:83241968-83241990 GAGGAGGAGGAGGAGGCGGAAGG + Intronic
993558490 5:89372672-89372694 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
993569182 5:89515018-89515040 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
993739324 5:91518326-91518348 AAGGAGGAGGAGGAGGAGAAGGG + Intergenic
993955575 5:94228475-94228497 ATGGAGGAACAGGAGGTGGGAGG - Intronic
994043596 5:95284600-95284622 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
994104086 5:95926230-95926252 GTGGAGGAGTAGGAAGGGGAGGG + Intronic
994192914 5:96888301-96888323 ATGGATGTGCAGGAGGTGAATGG + Intronic
994322939 5:98414284-98414306 ATGGAAGAGCAGGAGGCTGCAGG - Intergenic
994541294 5:101101637-101101659 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
994541298 5:101101643-101101665 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
994738581 5:103589999-103590021 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
994825405 5:104707667-104707689 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
994850269 5:105046311-105046333 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
994850273 5:105046317-105046339 GTCGAGGAGGAGGAGGAGGAGGG - Intergenic
995830564 5:116350420-116350442 AAGGAGGAGGAAGAGGAGGAGGG + Intronic
997262307 5:132474612-132474634 ATGAAGAAGGAGGAGGCAGAAGG - Intronic
997297225 5:132776152-132776174 AAGGAGGAGGAGGAGGAGGGAGG - Intronic
997896650 5:137724687-137724709 ATGGAGGAGCAGGGGAAGAAAGG - Intronic
998028011 5:138837495-138837517 AGGGAGGAGGGGGAGGGGGAAGG - Intronic
998157653 5:139795760-139795782 CTGGAGGAGGAGGAGGAGGGAGG - Intergenic
998200150 5:140113019-140113041 AAGGAGGAGGGGGAGGCGGGCGG + Intronic
998384448 5:141748434-141748456 AGGGAGGAGCAGGGGAGGGAAGG - Intergenic
998400294 5:141845322-141845344 GTGGAGGAGGAGCAGGGGGAGGG - Intergenic
998465674 5:142341889-142341911 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
998513422 5:142732496-142732518 CTGAAGGAGCAGGAGACTGAGGG - Intergenic
998583442 5:143403586-143403608 ATGGAGGAGGCGGCGGCGGAGGG + Exonic
998610784 5:143685856-143685878 TTAGAGGAGTAGGAGGAGGATGG + Intergenic
998783491 5:145684104-145684126 GGGGAAGAGCAGGAGGGGGAAGG + Intronic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
999147612 5:149406522-149406544 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
999195033 5:149776038-149776060 ATGGCAGAGAAGGAGGTGGAGGG - Intronic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999892385 5:155993167-155993189 ATGGCGGGGCAAGAGGCAGAAGG - Intronic
999980048 5:156949418-156949440 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
999993882 5:157073311-157073333 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1000294496 5:159901386-159901408 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1000607214 5:163338028-163338050 ATGGTGGTGCAGGAGATGGAAGG - Intergenic
1000627426 5:163555216-163555238 AAGGATGAGCAGGAGGTGAAGGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001044666 5:168362751-168362773 ATGGAGGTGAAGGAAGGGGATGG + Intronic
1001086196 5:168701636-168701658 AAGGAGAAGCAGGAGCCAGAAGG - Intronic
1001132897 5:169079510-169079532 AAGGAGGAGAGGGAGGAGGAAGG + Intronic
1001132958 5:169079713-169079735 AGGGAAGAGGAGGAGGAGGAGGG + Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001333924 5:170782671-170782693 ATGGAGGGGCAGGAAGGGGAGGG - Exonic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600113 5:172923131-172923153 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600127 5:172923190-172923212 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001706056 5:173741782-173741804 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1001879672 5:175232457-175232479 GTGGAGGAGCATGAGACAGAAGG + Intergenic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002001657 5:176199599-176199621 GGGCAGGAGCAGGACGCGGAGGG + Intergenic
1002123359 5:177022814-177022836 CTGGAGGGCCAGGAGCCGGACGG + Exonic
1002288981 5:178187076-178187098 AGGGAGGAGCATGAGGAGGAGGG - Intergenic
1002466591 5:179411838-179411860 CTGGCGGAGCAGGAGGAGGCTGG - Intergenic
1002715486 5:181224180-181224202 CGGGAGGAGGAGGAGGAGGACGG + Exonic
1002735050 5:181379102-181379124 TCGGAGGAGCAGGAGGAGTAAGG - Intergenic
1002749476 6:95020-95042 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1002904698 6:1438868-1438890 AGGGAGGAGCAGGAGAAGGGAGG - Intergenic
1002916770 6:1535421-1535443 AGGGTGGGGCAGGAAGCGGAGGG + Intergenic
1002926310 6:1607704-1607726 AGGGAAGAGCAGGAGGCGACAGG + Intergenic
1003037752 6:2659855-2659877 ATGGAGAAGAAGGAGCCAGACGG + Intergenic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003313288 6:4987558-4987580 GTGGTGGAGCAGGATGTGGAGGG - Intergenic
1003406748 6:5832545-5832567 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1003515159 6:6811688-6811710 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004044257 6:12011279-12011301 ATGGGGGAGGGGGAGGCGGGGGG - Intronic
1004052406 6:12099148-12099170 GTGAAGGAGCAGGAGCCAGAGGG + Intronic
1004086741 6:12457086-12457108 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1004119672 6:12808828-12808850 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004167124 6:13266677-13266699 TTGGAGGAGCAGGAGCAAGAGGG + Exonic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004690139 6:17986869-17986891 ATGGAGGAGAAGGGGGGCGAGGG + Intronic
1004945583 6:20609260-20609282 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1005829230 6:29657253-29657275 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
1005836263 6:29711706-29711728 ATTGATGAGCAGGGGGCTGAGGG + Intergenic
1005844906 6:29769635-29769657 ATTGAGGAGCAGGAGACTGAGGG + Intergenic
1005857029 6:29870435-29870457 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005859902 6:29892300-29892322 ATTGAGGAGCAGGAGACTGAGGG + Intergenic
1005862848 6:29914586-29914608 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005874351 6:29999784-29999806 ATTGAGGAGCAGGAGGGTGAAGG + Intergenic
1005987642 6:30884441-30884463 AGCGAGGAGCGGGAGGAGGAAGG + Intronic
1006056307 6:31387071-31387093 ATTGAGGAGCAGGAGGCTGAGGG - Intergenic
1006066433 6:31465630-31465652 ATGGATGAGTAAGAGGAGGAAGG - Intergenic
1006066659 6:31467103-31467125 ATTGAGGAGCAGGAGGCTGAGGG - Intergenic
1006375172 6:33667984-33668006 AGGGAGGAGCAGGCGCCGGCCGG - Intronic
1006599056 6:35213838-35213860 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1007107738 6:39295235-39295257 ATGGGGAAGCAGGGGGCAGAGGG + Intergenic
1007134481 6:39507958-39507980 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1007143771 6:39606124-39606146 ATATAGGAGAAGGAGGAGGAGGG - Intronic
1007228548 6:40331835-40331857 CTTGGGGAGCAGGAGGGGGAGGG - Intergenic
1007412484 6:41673105-41673127 GTGGGGGAGCGGGAGGCAGATGG - Intergenic
1007509846 6:42366515-42366537 ATGCAGGTGCAGGAAGAGGAGGG - Intronic
1007582870 6:42969594-42969616 CTGGAGGAGCAGCAGCCAGATGG - Intronic
1007812338 6:44495477-44495499 AAGGAGGAGCAGGAAGGGAAAGG - Intergenic
1008073381 6:47119956-47119978 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1008137249 6:47791011-47791033 TTGGAGGAGGATGAGGTGGAAGG + Intronic
1008266744 6:49436948-49436970 GTAGAGGAGCAGGAGGAGGGAGG + Intronic
1008306320 6:49905586-49905608 ATGCAGGAGCAGGAGGCTGCAGG - Intergenic
1008582581 6:52920414-52920436 ATGGAGGAGATAGAGACGGAGGG - Intergenic
1008648975 6:53544653-53544675 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
1008711008 6:54227126-54227148 ATGGCGGAGCAGGAGAGTGAAGG - Intronic
1010032859 6:71288702-71288724 GGGGAGGAGAAGGAGCCGGATGG + Intergenic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1010863008 6:80937296-80937318 AGGGAGGATCAGGTGGCGGGTGG + Intergenic
1010887374 6:81261575-81261597 ATGGAGGTTTAGGAGGAGGAGGG + Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1010985136 6:82414855-82414877 CTGGAGGAGCAGCAGTGGGAGGG + Intergenic
1011214907 6:84995250-84995272 AAGAAGGAGAAGGAGGGGGAGGG + Intergenic
1011287806 6:85743763-85743785 ATGGTGGAGCAGGAGAATGAAGG - Intergenic
1011484783 6:87830104-87830126 AAGGAGGAGGAGGAGGAAGAAGG - Intergenic
1011484791 6:87830136-87830158 AAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011484802 6:87830171-87830193 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1011707842 6:90020781-90020803 ATGGAGGAGTGGGGGGCGGAGGG - Intronic
1011888420 6:92126674-92126696 GAGGAGGAGCAGGAGGAAGAGGG + Intergenic
1012320571 6:97839890-97839912 GTGGAGGGGAAGGAGGAGGAAGG - Intergenic
1012325973 6:97917969-97917991 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1012754331 6:103205784-103205806 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1012809209 6:103936565-103936587 GCGGAGGAGGAGGAGGAGGAAGG + Intergenic
1013033821 6:106361109-106361131 AAGGAGGAGGAGGAGGAGGTGGG - Intergenic
1013056583 6:106589170-106589192 GTGGAGGAGGAGGAGGAGGGAGG + Intronic
1013267152 6:108511130-108511152 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1013325238 6:109039097-109039119 AGGGAGGAGAAGGAGAAGGAAGG + Intronic
1013414008 6:109908617-109908639 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1013523333 6:110952646-110952668 AGGGAGGAGAAGGAGAGGGAGGG - Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014869951 6:126581901-126581923 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1014913316 6:127118621-127118643 ATAGGGGAGGAGGAGGAGGAGGG - Exonic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015341098 6:132101826-132101848 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1016391315 6:143578646-143578668 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017041864 6:150314416-150314438 AGGGAGGAGGAGGAGGAGAAAGG + Intergenic
1017192208 6:151666690-151666712 GAGGAGGAGGAGGAGGGGGATGG - Intronic
1017192211 6:151666696-151666718 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1017587444 6:155942789-155942811 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1017770101 6:157638298-157638320 AGGAAGGAGTAGGAGGAGGACGG - Intronic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1017870381 6:158481699-158481721 AGGGAGGGGTAGGAGGCTGAAGG - Intronic
1018038080 6:159898665-159898687 AGGGAGGAGGAGGAAGAGGAAGG - Intergenic
1018220202 6:161570495-161570517 GAGGAGGAGGAGGAGGGGGAAGG - Intronic
1018434950 6:163751403-163751425 AGGGAGGAGGAGGAGGTGGGAGG - Intergenic
1018727814 6:166627219-166627241 GAGGCGGAGAAGGAGGCGGAGGG - Intronic
1018740152 6:166722380-166722402 ATGGAGGAGCCGCAGGGGGTGGG + Intronic
1018861770 6:167715652-167715674 GTGGAGGAGGAGGAAGAGGAGGG + Intergenic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1018928786 6:168225898-168225920 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1019080050 6:169424333-169424355 AAGCAGGAGGAGGAGGCGGGGGG + Intergenic
1019239309 6:170651419-170651441 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1019389789 7:779600-779622 ATCTGGGAGCAGGAGGTGGAGGG + Intronic
1019473227 7:1232240-1232262 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1019531752 7:1506697-1506719 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1019721651 7:2575861-2575883 AAGGTGGAGAAGGAGGCGGATGG - Intronic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1019979022 7:4607305-4607327 AAGCAAGAGGAGGAGGCGGACGG - Intergenic
1020125794 7:5531866-5531888 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1020279353 7:6642563-6642585 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1020410710 7:7888864-7888886 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1020410714 7:7888870-7888892 GAGGAGGAGGAGGAGGGGGAGGG + Intronic
1020577357 7:9949908-9949930 GGGGAGGAGGAGGAGGGGGAGGG + Intergenic
1020954836 7:14728253-14728275 ATGAAGGAGAATGAGGCTGACGG - Intronic
1020970246 7:14928815-14928837 ATGAGGGAGTAGGAGGGGGATGG - Intronic
1021116115 7:16748099-16748121 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1021622445 7:22562209-22562231 GGGGAGGAAGAGGAGGCGGAAGG - Intronic
1021807970 7:24375515-24375537 AGGGTGGATCAGGAGGCAGAGGG - Intergenic
1021827931 7:24573311-24573333 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1022665930 7:32410442-32410464 GTGGAGGAGGAGGAAGAGGAAGG + Intergenic
1023003735 7:35840173-35840195 AAGGGGGAGGAGGAGGGGGAGGG - Intronic
1023214507 7:37847577-37847599 ACGGAGGAGGAGGAGAAGGAGGG + Intronic
1023737594 7:43248670-43248692 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1023809687 7:43902159-43902181 ATGGTGGAGAGGGAGGAGGAGGG + Intronic
1024171405 7:46791300-46791322 ATGGAGGGGCAGCAAGGGGAAGG + Intergenic
1024196446 7:47063966-47063988 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024196455 7:47064001-47064023 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024196559 7:47064898-47064920 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024233104 7:47377770-47377792 ATGGGGGAGAAGGAGAAGGAGGG - Intronic
1024346708 7:48321451-48321473 ATGGAGGAGCTGCAAGCTGAGGG + Intronic
1024576267 7:50767270-50767292 CTGGAGGATCAGGAGCCAGAGGG - Intronic
1024599020 7:50963311-50963333 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1024599024 7:50963317-50963339 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024846255 7:53646173-53646195 AAGGAGGAGAAGGAGGAAGAAGG - Intergenic
1024957082 7:54933416-54933438 GTGGAGGAGGAGGCGGCGGCGGG + Intergenic
1024999552 7:55303671-55303693 AAGGAGGAGGAGGAGGAGCAGGG + Intergenic
1025058040 7:55780956-55780978 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1025207917 7:57004097-57004119 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1025829668 7:65038327-65038349 AGGGAGGCGGTGGAGGCGGAGGG + Intergenic
1026159067 7:67852840-67852862 AAGGAGGAGGAGGAGGGGAAGGG + Intergenic
1026191905 7:68136490-68136512 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1026205700 7:68255486-68255508 AAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1026238030 7:68545772-68545794 AAGGAGGAGAAGGAGAAGGAGGG - Intergenic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026638634 7:72105769-72105791 AAGGAGGAGGAGGAGGAGGGGGG + Intronic
1026638649 7:72105800-72105822 AGGGAGGAGGAGGAGGGGGAGGG + Intronic
1026684923 7:72501457-72501479 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026804067 7:73418579-73418601 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1026806122 7:73430444-73430466 ATGGAGGGGGAGGAGGGGAAGGG - Intergenic
1026819478 7:73537264-73537286 AGGCAGGGCCAGGAGGCGGAGGG + Exonic
1026849707 7:73717200-73717222 AGGGAGGAGGAGGAGGAAGAGGG + Intronic
1026979788 7:74519539-74519561 ATGGAGGAGGAGGTGGCGGTTGG - Exonic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027192619 7:76005902-76005924 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1027253501 7:76414676-76414698 AAGGAGGAGGAGGAGGGGAAGGG - Intronic
1027254138 7:76419769-76419791 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1027254217 7:76420169-76420191 AAGGAGGAGGTGGAGGAGGAGGG - Intronic
1027354639 7:77343404-77343426 ATGGAGGTGCAGGATATGGAAGG - Intronic
1027452960 7:78353821-78353843 ATGTGGGAGCAAGAGGCGTAGGG + Intronic
1027544013 7:79503733-79503755 AAGGGGGAGGAGGAGGCGGAGGG + Intergenic
1027572759 7:79891458-79891480 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1027645313 7:80790311-80790333 AAGGAGGAGGAGGAGGAGAAAGG + Intronic
1027814704 7:82953695-82953717 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1027814708 7:82953701-82953723 GAGGAGGAGGAGGAGGGGGAGGG + Exonic
1027941736 7:84691065-84691087 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1028070828 7:86448038-86448060 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1029094874 7:98077190-98077212 GAGGAGGAGCAGGAGGAGAAGGG + Intergenic
1029167473 7:98603092-98603114 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1029494823 7:100891000-100891022 GTGGAGGAGGAGGAGGGGCAGGG + Exonic
1029520157 7:101055110-101055132 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1029548292 7:101222784-101222806 ATGGAGGAGGAAGCGGGGGATGG + Intronic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029630680 7:101748192-101748214 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1029927000 7:104328752-104328774 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
1030005267 7:105112391-105112413 AAGGAGGTGGAGGAGGTGGAGGG - Exonic
1030034449 7:105396695-105396717 AAGGAGGAGGAGGAAGGGGAGGG + Intronic
1030568564 7:111191938-111191960 AAGCAGGAGCAGGAGTAGGAGGG + Intronic
1030781856 7:113610699-113610721 GGGGAGGAGGAGGAGGAGGAGGG + Intergenic
1030884651 7:114922584-114922606 GAGGAGGAGGAGGAGGAGGAAGG + Exonic
1031165927 7:118226636-118226658 ATGGAGGAGGAGGAAGAAGAGGG + Intronic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1031780784 7:125961458-125961480 ATGGAACAGCAGGAGGAGGGAGG - Intergenic
1031854629 7:126907299-126907321 AGGGAGGAGGAGGAAGAGGAAGG + Intronic
1031942430 7:127803116-127803138 ATGCAGGAGCGGGAGGCAGCAGG - Intronic
1032082764 7:128868346-128868368 AGCGGGGAGCAGGAGGCCGAAGG + Intronic
1032256257 7:130299419-130299441 ATGCAAGAGCAGGAGGCAGGAGG - Intronic
1032344692 7:131107243-131107265 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1032439768 7:131933426-131933448 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1032441639 7:131946643-131946665 ACGGAGGAGGAGGAGGCAGGGGG + Intergenic
1032466824 7:132151371-132151393 AAGGAGGAGGAGGAGGAGAAAGG + Intronic
1032466830 7:132151390-132151412 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1032466837 7:132151412-132151434 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1032466847 7:132151453-132151475 AAGGAGGAGGAGGAGGAGAAAGG + Intronic
1032466857 7:132151494-132151516 AAGGAGGAGGAGGAGGAGAAAGG + Intronic
1032523110 7:132561274-132561296 AAGGAGGAGGAGGAGGAAGAGGG - Intronic
1032523515 7:132562972-132562994 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032523545 7:132563110-132563132 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032523617 7:132563412-132563434 AGGAAGGAGAAGGAGGAGGAGGG - Intronic
1032719143 7:134536653-134536675 ATGGAGGAGCTGGTGGATGAGGG + Exonic
1032724113 7:134575423-134575445 ATGGAGGAGCTGGTGGACGAGGG + Exonic
1032908121 7:136396137-136396159 AGGGAGGAGGAGGAGAGGGAAGG + Intergenic
1033155992 7:138957443-138957465 AAGAAGGAGAAGGAGGGGGAGGG - Intronic
1033409974 7:141108572-141108594 ATGGGGGAGCAGGTGATGGAGGG + Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033596696 7:142864293-142864315 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
1033614850 7:143004234-143004256 CTGGAGGAGGAGGAGGGGGTTGG + Intergenic
1033832593 7:145271494-145271516 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1033890427 7:146006388-146006410 ATGGGGGAGGAGGAGGGAGAAGG - Intergenic
1033983964 7:147200057-147200079 AAGGAGGAGGGGGAGGGGGAGGG - Intronic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1034411709 7:150945552-150945574 ATGGAGGAGGAGGAAGGGGAGGG + Intronic
1034534907 7:151720659-151720681 ATGGAGGGGATGGAGGGGGATGG + Intronic
1034978910 7:155463435-155463457 AAGGAGGAGCAGGAGGAAGGAGG - Exonic
1035114952 7:156516808-156516830 GAGGAGGAGCAGGAGGCAGAAGG - Intergenic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035160337 7:156945188-156945210 TTGGAGGAGGAGGAGGGGGAGGG - Intergenic
1035508461 8:155189-155211 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1035570170 8:667410-667432 GTGGAGGAGCGGGAAGAGGAGGG - Intronic
1035674338 8:1444599-1444621 ATGATGGAGAAGGAGGTGGAGGG - Intergenic
1035722041 8:1799282-1799304 GGGGAGGAGGAGGAGGGGGACGG - Intergenic
1035722044 8:1799288-1799310 AAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035958333 8:4108106-4108128 ACGGAGGAGGAGGAGGAGGAGGG + Intronic
1036137424 8:6174938-6174960 ATGGATGGGCAGGATGGGGAAGG - Intergenic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036454113 8:8893130-8893152 AGGCAGGGGCAGGAGCCGGAGGG - Exonic
1036756987 8:11477310-11477332 AGGGAGGAGCAAGTGGCTGAAGG + Intergenic
1037691283 8:21183452-21183474 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1037714019 8:21381743-21381765 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1038039037 8:23708576-23708598 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1038161364 8:25042162-25042184 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1038284960 8:26198484-26198506 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1038547928 8:28440345-28440367 ATGGAGGAGGCCGAGGTGGAAGG - Intronic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1038882228 8:31627661-31627683 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1039436179 8:37560894-37560916 AGAGAGGAGAAGGAGGAGGAGGG - Intergenic
1039466620 8:37789241-37789263 GGGGAGGAACAGGAGGAGGAAGG + Intronic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1039630267 8:39103658-39103680 AAGGAGGTGCAGGAGCAGGACGG - Exonic
1039691292 8:39867639-39867661 AAGGAGGGGGAGGAGGAGGAAGG - Intergenic
1039729094 8:40255432-40255454 ACGGAGGGGCAGAAGGCAGAAGG + Intergenic
1039827274 8:41185198-41185220 AAGGAGGAGGAGGAGGGAGAAGG + Intergenic
1039884400 8:41646960-41646982 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1040071928 8:43195630-43195652 GTGGAGGAAGAGGAGGAGGAGGG + Intronic
1040071937 8:43195654-43195676 CTGGAGGAGGAGGAGGGTGAGGG + Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1041000602 8:53446669-53446691 ATGGAGTAGGGGGAGGGGGAGGG + Intergenic
1041108383 8:54463306-54463328 AAAGAGGAACAGGAGGAGGAAGG - Intergenic
1041284844 8:56249570-56249592 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1041291170 8:56310133-56310155 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041291181 8:56310165-56310187 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041291190 8:56310194-56310216 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291195 8:56310210-56310232 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291200 8:56310226-56310248 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291205 8:56310242-56310264 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291210 8:56310258-56310280 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291215 8:56310274-56310296 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291220 8:56310290-56310312 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291229 8:56310319-56310341 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041377279 8:57217061-57217083 ACTGAGGGGCATGAGGCGGAGGG + Intergenic
1041401360 8:57448738-57448760 AAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1041441015 8:57896998-57897020 AAGCAGGAGAAGGAGGAGGATGG - Intergenic
1041535696 8:58923200-58923222 ATGGAGGAACAGGAGTCAGGAGG + Intronic
1041570112 8:59328378-59328400 AAGGAGGGGAAGGAGGAGGAAGG - Intergenic
1041687347 8:60656671-60656693 ATGGAGGAGCATGAGGGTGATGG - Intergenic
1042215275 8:66424952-66424974 CTAGAGGAGCAGGAGGAAGATGG + Intergenic
1042312076 8:67388798-67388820 TGGCAGGAGCAGGAGGAGGAGGG - Intergenic
1042591816 8:70403847-70403869 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042836012 8:73079638-73079660 TTGGGGGAGAAGGAGGAGGAGGG - Intronic
1042962861 8:74321479-74321501 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043161479 8:76852933-76852955 AGGGAGGAGGAGGAGGTGGCGGG - Exonic
1043185089 8:77138233-77138255 AAGGTGGAGAAGGAGGTGGAGGG - Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044422933 8:92019406-92019428 AAGGAAGAGCAGGAGGGGGAGGG + Intronic
1044932023 8:97260139-97260161 AAGGAGGAGGGGGAGGGGGAAGG + Intergenic
1044953159 8:97452940-97452962 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1044972143 8:97630112-97630134 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1044983244 8:97736375-97736397 AGGGAGGGGGAGGAGGGGGAGGG + Intergenic
1045130012 8:99140624-99140646 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1045281001 8:100749702-100749724 ATGGAGGAAGAGGAGGAGAACGG + Intergenic
1045294883 8:100864023-100864045 ATGGAGGATGAGGAAGAGGAAGG - Intergenic
1045410181 8:101909417-101909439 ATGAAGGTGGAGGAGGCTGAAGG - Intronic
1045411973 8:101929234-101929256 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1045423885 8:102043718-102043740 AGGGAGGGGGAGGAGGAGGATGG + Intronic
1045891594 8:107164398-107164420 ATGGAGGGACAGGTGGCAGAGGG - Intergenic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1046632531 8:116635587-116635609 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1046776007 8:118164096-118164118 AGGGAGGAGTAGGAAGAGGAGGG + Intergenic
1047191901 8:122685987-122686009 ATGGTGGAGCAGAAAGCGTAAGG + Intergenic
1047216916 8:122883325-122883347 ATGGAGGAGATGGAGGTGGGCGG + Intronic
1047351156 8:124075863-124075885 ATGCCGGACCAGGAGGCAGAAGG - Intronic
1047388245 8:124429283-124429305 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1047698422 8:127426800-127426822 AGGGAGGAGCTGGGGGAGGAGGG - Intergenic
1047958990 8:129997119-129997141 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1048007653 8:130432066-130432088 AAGGAGGAGGGGGAGGGGGAAGG + Intronic
1048219048 8:132524788-132524810 AGGGATGAAGAGGAGGCGGAGGG - Intergenic
1048224470 8:132571467-132571489 ATAGAGGAGAAGGAGTGGGATGG + Intergenic
1048417597 8:134243792-134243814 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1048752660 8:137697634-137697656 ATTGAGGAGCAGGAGGTCGGGGG - Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048942656 8:139415260-139415282 AAGGAGGAGCAAGAAGCAGAAGG - Intergenic
1048989707 8:139754145-139754167 ATGGAGCAGCAGCAGGCTGGGGG - Intronic
1049027606 8:140005926-140005948 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049102219 8:140588009-140588031 ATGGAGGAGATGGGGGAGGATGG - Intronic
1049122041 8:140747695-140747717 AGGGAGGAGGAGGGGGAGGAAGG + Intronic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049365708 8:142235902-142235924 ATGGCGGGGCAGGAGGAGGTGGG + Intronic
1049386068 8:142343775-142343797 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1049681565 8:143920912-143920934 GTGGAGGAGCAGGAGCAGAAGGG - Exonic
1049761749 8:144334775-144334797 ATGGAGGAGCAGGGAGGGCAGGG - Intronic
1050077018 9:1875996-1876018 ATGGGAGGGCAGGAGGCCGAGGG + Intergenic
1050472383 9:6007435-6007457 GCGGAGGAGGAGGTGGCGGAAGG - Exonic
1050475942 9:6041107-6041129 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1050714654 9:8509173-8509195 ATTGAGAAGCAAGAGGCAGAGGG + Intronic
1051106583 9:13587667-13587689 ATGGAGCAGAAGGGGGTGGATGG - Intergenic
1051247521 9:15126702-15126724 AGGAAGGAGAAGGAGGGGGAAGG + Intergenic
1051513629 9:17906519-17906541 GGGGAGGAGCAGGAGCTGGAGGG + Intergenic
1051518073 9:17952917-17952939 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1051560624 9:18436897-18436919 AGGCAGGAGCAGTAGGTGGAGGG + Intergenic
1051613087 9:18980565-18980587 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1051860114 9:21615138-21615160 ATAGAGGAAGAGGAGGGGGAGGG + Intergenic
1051873406 9:21765384-21765406 AGGGTGGAGAAGGAGGAGGAAGG + Intergenic
1052531180 9:29686289-29686311 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053037798 9:34840410-34840432 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1053233805 9:36434297-36434319 GGAGAGGAGCAGGAGGGGGAGGG + Intronic
1053481501 9:38419863-38419885 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1053832152 9:42094725-42094747 AGGAAGGAGAAGGAGGAGGAAGG + Intronic
1054130776 9:61362147-61362169 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1054598393 9:67092699-67092721 AGGAAGGAGAAGGAGGAGGAAGG - Intergenic
1054850668 9:69843505-69843527 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055030516 9:71768573-71768595 GAGGAGGAGGCGGAGGCGGAGGG - Exonic
1055080270 9:72261818-72261840 AAGAAGGAGGAGGAGGGGGAGGG - Intergenic
1055107035 9:72523680-72523702 GTAGAGGTGCAGGAGGTGGAAGG + Intronic
1055565851 9:77568004-77568026 AGGGAGGAAGAGGAGGAGGAAGG + Intronic
1055611898 9:78031989-78032011 GAGGAGGAGGAAGAGGCGGAGGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056040517 9:82660698-82660720 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1056342694 9:85653229-85653251 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1057039283 9:91835727-91835749 TTGCAGCTGCAGGAGGCGGAAGG + Intronic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057226666 9:93296479-93296501 ATGGAGGGGGAGGAGGGAGAAGG - Intronic
1057372110 9:94483363-94483385 AGGGAGGAGCAGGAGGCATATGG - Intergenic
1057995961 9:99821927-99821949 GAGGAGGAGCAGGAGCTGGAGGG - Exonic
1058148468 9:101437542-101437564 ATGGAGGAACAAGAGGTGGATGG + Intergenic
1058444577 9:105043431-105043453 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1058444581 9:105043437-105043459 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1058561481 9:106233369-106233391 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1059072427 9:111152831-111152853 AGGGAGGAGGAGGAAGAGGAAGG + Intergenic
1059072451 9:111152917-111152939 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072463 9:111152959-111152981 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072476 9:111153001-111153023 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059172322 9:112137271-112137293 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1059431205 9:114251406-114251428 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059712408 9:116881125-116881147 GTGGAAGAGGAGGAGGAGGAAGG + Intronic
1059767093 9:117393865-117393887 ATGGAGGAGGAGGAGGAGATGGG + Intronic
1059823221 9:117997235-117997257 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059823226 9:117997251-117997273 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1060018060 9:120104421-120104443 ATGGAGGAGAAGGATTGGGATGG + Intergenic
1060077379 9:120604541-120604563 ATTGGGGAGCAGGAGGCTGATGG - Exonic
1060279588 9:122206857-122206879 ATGGAGGAGCTTGGGCCGGAGGG - Intronic
1060629563 9:125143434-125143456 GCGGCGGAGCAGGAGCCGGATGG - Exonic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061251412 9:129428644-129428666 GTGGAGGAGGAGGTGGCAGAAGG - Intergenic
1061256184 9:129455080-129455102 GAGGAGGAGGAGGAGGCAGAAGG - Intergenic
1061275781 9:129568857-129568879 AGGGAGGAGGAGGGGGAGGAGGG + Intergenic
1061321614 9:129834671-129834693 GGGGAGGAGGAGGAGGCGGCGGG - Intronic
1061390487 9:130314953-130314975 CTGGGGGAGCAGCAGGCGCAGGG + Intronic
1061500604 9:130999438-130999460 AAGGAGGAGAAGGAGAGGGAGGG - Intergenic
1061582300 9:131545629-131545651 CTGGAGGGGCAGGTGCCGGAGGG + Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061865684 9:133490830-133490852 AAGGAGGTGCTGGAGGAGGAGGG + Intergenic
1061865695 9:133490862-133490884 AAGGAGGAGTTGGAGGAGGATGG + Intergenic
1061899679 9:133666503-133666525 AAGGAGGAGGAGGAGGGAGAGGG - Intronic
1061899691 9:133666542-133666564 AAGGAGGAGAAGGAGGGGGAAGG - Intronic
1061967579 9:134025050-134025072 ATGGAGGAGGAGGGGCTGGATGG - Intergenic
1062022004 9:134324183-134324205 AAGGAGCAGCAGGCCGCGGACGG - Intronic
1062029988 9:134357931-134357953 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1062033105 9:134370964-134370986 AGGGAGTGGCAGGAGCCGGAGGG + Intronic
1062061667 9:134500059-134500081 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1062064215 9:134517634-134517656 ATGGAGGTCAGGGAGGCGGATGG + Intergenic
1062074714 9:134579690-134579712 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1062074727 9:134579744-134579766 AAGAAGGAGGAGGAGGGGGAGGG + Intergenic
1062086028 9:134648952-134648974 ACGGAGGTCCAGGAGGTGGATGG + Intronic
1062165347 9:135104808-135104830 CTGGAGGAGCAGGAGGCAGGAGG - Intronic
1062332819 9:136051918-136051940 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1062388995 9:136326758-136326780 GAGGAGGAGGAGGAGGCGGTAGG + Intergenic
1062394914 9:136348915-136348937 ATGGGTGAGCAGGTGGCAGATGG - Intronic
1062445982 9:136595054-136595076 AAGGAGGAGGAGGAGGAGAAAGG + Intergenic
1062469704 9:136697007-136697029 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1062469712 9:136697026-136697048 AGGGGGGAGGAGGAGGGGGAAGG - Intergenic
1062469722 9:136697045-136697067 AGGGGGGAGGAGGAGGGGGAGGG - Intergenic
1062469750 9:136697095-136697117 AAGGAGGAGGGGGAGGGGGAAGG - Intergenic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062690768 9:137841242-137841264 ATGGAGGATACGGAGGGGGACGG - Intronic
1062690785 9:137841294-137841316 ATGGAGGATACGGAGGGGGACGG - Intronic
1062690810 9:137841371-137841393 ATGGAGGATACGGAGGGGGACGG - Intronic
1062690843 9:137841473-137841495 ATGGAGGATACGGAGGGGGACGG - Intronic
1062690911 9:137841675-137841697 ATGGAGGATACGGAGGGGGACGG - Intronic
1062690962 9:137841827-137841849 ATGGAGGATACGGAGGGGGACGG - Intronic
1062690971 9:137841854-137841876 ATGGAGGATACGGAGGGGGACGG - Intronic
1062721100 9:138044616-138044638 CTTGAGGAGGAGGAGGCAGAGGG + Intronic
1062759517 9:138331710-138331732 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1203443324 Un_GL000219v1:31623-31645 AGGGATGAGCAGGAGACAGATGG + Intergenic
1203369580 Un_KI270442v1:290170-290192 AGGGACGAGCAGGAGACAGATGG - Intergenic
1203514132 Un_KI270741v1:150532-150554 AGGGATGAGCAGGAGACAGATGG + Intergenic
1203599964 Un_KI270748v1:2482-2504 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1185459858 X:328923-328945 AGAGAGGAGGAGGAGGGGGAGGG - Intergenic
1185504971 X:625221-625243 AAGGAGGAGGAGGAGGGAGAAGG - Intronic
1185523701 X:760960-760982 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1185540500 X:899418-899440 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1185550763 X:981100-981122 ATGGAGGAGGACGAGGAGGAGGG + Intergenic
1185575522 X:1169134-1169156 AGGGAGGAGGAGGAGGGGAAGGG + Intergenic
1185591635 X:1281152-1281174 AAGGAGGAGTAGGAGGAGAAGGG - Intronic
1185603633 X:1355080-1355102 AAGGAGGGGCAGGAGGAAGAAGG + Intronic
1185603702 X:1355266-1355288 ATGGAGGAAGAGGAGCAGGAGGG + Intronic
1185661948 X:1735264-1735286 GGGGAGGAGGAGGAGGGGGAGGG - Intergenic
1185662053 X:1735650-1735672 AAAGAGGAGGAGGAGGGGGAGGG - Intergenic
1185852315 X:3500683-3500705 ATGGCAGAGCAGAAGGCGAATGG + Intergenic
1185887116 X:3792718-3792740 AAGAAGGAGCTGGAGGAGGAGGG + Intergenic
1185913792 X:4011645-4011667 AAGGAGGAGCAGGAAGGAGAAGG - Intergenic
1186027814 X:5333110-5333132 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186072054 X:5832858-5832880 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1186124716 X:6400918-6400940 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186249800 X:7653328-7653350 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186638163 X:11427843-11427865 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1186855826 X:13625216-13625238 ATGGAGGTGCAGGAGGAGCAGGG - Intronic
1187613601 X:20969408-20969430 ATGGAGGGGCATAAGGCAGAAGG - Intergenic
1187665968 X:21609563-21609585 GAGGAGGAGGAGGAGGAGGAAGG + Exonic
1188344391 X:29045976-29045998 AAGGAGGAGGAGGAGGAAGAAGG - Intronic
1188724276 X:33562286-33562308 GAAGAGGAGCAGGAGGGGGAGGG - Intergenic
1189137354 X:38562573-38562595 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
1189725701 X:43966339-43966361 AAAGAGGAGGAGGAGGAGGAAGG + Intronic
1190220349 X:48508909-48508931 ATGGGAGAGCAGGAGGGGGGCGG - Intergenic
1190405353 X:50081352-50081374 AAGGAGGAGCTGGAGAGGGAGGG - Intronic
1190718389 X:53124577-53124599 ATGGAGAAGCAGGAGTTAGAGGG - Intergenic
1191104202 X:56762334-56762356 AGAGAGGAGGAGGAGGAGGAGGG - Intergenic
1191736657 X:64395045-64395067 AGGGAGGAGCTGGAGTCAGAGGG + Intronic
1191850572 X:65582930-65582952 AAGGGAGAGCAGGAGGGGGAGGG + Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192026009 X:67452513-67452535 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1192106013 X:68317664-68317686 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1192318623 X:70070575-70070597 ATGGGGGAGGTGGAGGCGGAAGG - Intergenic
1192459571 X:71305279-71305301 ATTGAGCAGCAGGAGGCTGAAGG + Exonic
1192639083 X:72846133-72846155 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192642628 X:72874672-72874694 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1192705003 X:73519911-73519933 ATGCAGGAGCATTAGGCAGAAGG - Intergenic
1192770594 X:74185594-74185616 ATGGATGATCAGGAGGCTGAGGG + Intergenic
1193841109 X:86409543-86409565 ATGTAGGAGCAGGAGAGAGAAGG - Intronic
1194312594 X:92331349-92331371 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1195000862 X:100641995-100642017 AAGGAAGAGCATGAGGCAGAGGG + Intergenic
1195275406 X:103276186-103276208 ATGGAGGAGGAGGAGGACCAGGG - Intronic
1195696231 X:107669609-107669631 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1195875378 X:109535226-109535248 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1196473595 X:116057413-116057435 ATGGTGGAGCAGGAGAAAGATGG - Intergenic
1196828407 X:119758500-119758522 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1197605834 X:128584126-128584148 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1197808031 X:130416032-130416054 GTGGAGGAGCAGGAGGCTAAGGG - Intergenic
1198685866 X:139227409-139227431 GAGGAGGAGGAGGAGGCTGAAGG + Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199012804 X:142777387-142777409 ATGGAAGAGCAGAAGGCTGAGGG + Intergenic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199398185 X:147365478-147365500 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1199715752 X:150506336-150506358 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1199751573 X:150824242-150824264 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1199792948 X:151171931-151171953 TGGGAGGAGCAGGAGGGGCAGGG + Intergenic
1199818891 X:151424732-151424754 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200002511 X:153069324-153069346 AAGTAGGAGGAGGAGGAGGAAGG + Intergenic
1200005213 X:153080686-153080708 AAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200133253 X:153862721-153862743 AAGAAGGAGAAGGAGGCGGCAGG - Exonic
1200214542 X:154361840-154361862 ATGGAGGTCCAGGAGGGGGTTGG - Intronic
1200620857 Y:5445495-5445517 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1201068716 Y:10124855-10124877 AGGGACGAGCAGGAGACAGATGG + Intergenic
1201233969 Y:11892446-11892468 ATGGTGGTGCAGGATGTGGAAGG + Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201300227 Y:12498706-12498728 AAAGAGGAGAAGGAGGGGGAAGG - Intergenic
1201461744 Y:14233036-14233058 AATGAGGAGGAGGAGGGGGAGGG - Intergenic