ID: 1184758837

View in Genome Browser
Species Human (GRCh38)
Location 22:46533542-46533564
Sequence ATGCCAGGCGGAGCCCTTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184758822_1184758837 18 Left 1184758822 22:46533501-46533523 CCTTGCAGAGTTGCCCGGGCCCG 0: 1
1: 0
2: 1
3: 7
4: 92
Right 1184758837 22:46533542-46533564 ATGCCAGGCGGAGCCCTTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 127
1184758828_1184758837 -2 Left 1184758828 22:46533521-46533543 CCGGCCCAATTGCGCCCCGGCAT 0: 1
1: 0
2: 1
3: 0
4: 32
Right 1184758837 22:46533542-46533564 ATGCCAGGCGGAGCCCTTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 127
1184758824_1184758837 5 Left 1184758824 22:46533514-46533536 CCCGGGCCCGGCCCAATTGCGCC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1184758837 22:46533542-46533564 ATGCCAGGCGGAGCCCTTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 127
1184758830_1184758837 -7 Left 1184758830 22:46533526-46533548 CCAATTGCGCCCCGGCATGCCAG 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1184758837 22:46533542-46533564 ATGCCAGGCGGAGCCCTTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 127
1184758829_1184758837 -6 Left 1184758829 22:46533525-46533547 CCCAATTGCGCCCCGGCATGCCA 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1184758837 22:46533542-46533564 ATGCCAGGCGGAGCCCTTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 127
1184758827_1184758837 -1 Left 1184758827 22:46533520-46533542 CCCGGCCCAATTGCGCCCCGGCA 0: 1
1: 1
2: 0
3: 2
4: 50
Right 1184758837 22:46533542-46533564 ATGCCAGGCGGAGCCCTTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 127
1184758825_1184758837 4 Left 1184758825 22:46533515-46533537 CCGGGCCCGGCCCAATTGCGCCC 0: 1
1: 0
2: 1
3: 9
4: 171
Right 1184758837 22:46533542-46533564 ATGCCAGGCGGAGCCCTTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184758837 Original CRISPR ATGCCAGGCGGAGCCCTTGG CGG Intronic
900798573 1:4724194-4724216 ATGCCAGGCGGAACCATGGGCGG + Intronic
900813055 1:4822597-4822619 CTGCTCGGGGGAGCCCTTGGAGG - Intergenic
900828102 1:4942609-4942631 ATGACAAGCGGAGCACTTGCAGG + Intergenic
902756083 1:18550135-18550157 AGGCCTGGCGGAGCTCTGGGAGG - Intergenic
903917460 1:26774777-26774799 ATGATAGGCGGGGCCCTGGGGGG - Exonic
905325954 1:37152106-37152128 ATGCCAGGCTGGGCCCTGGAAGG - Intergenic
905458234 1:38103342-38103364 ATTACAGGCGTAGCACTTGGTGG - Intergenic
915517309 1:156420997-156421019 AAGCGAAGCGGAGCCCTTGTGGG + Intronic
920190508 1:204190697-204190719 CTGCCAGGCTGAGCCGTCGGGGG - Exonic
920511846 1:206557472-206557494 ACGCCAAGCGGAGCCCGGGGAGG + Intronic
923111205 1:230891734-230891756 AGGCCAGGCTGTGCCCTTGCAGG + Intergenic
1063298175 10:4826705-4826727 ATGCCGAGGGGAGGCCTTGGCGG + Intronic
1063605897 10:7522628-7522650 GTGCCAGGCGGTGCCCTGGGCGG - Intergenic
1067741365 10:48898122-48898144 ATGCCTGGCTAAGCCCTTGAAGG - Intronic
1068496767 10:57792548-57792570 CTGCAGGGTGGAGCCCTTGGAGG - Intergenic
1069893144 10:71664419-71664441 AAGCCAGGCCCAGCCCTGGGTGG - Intronic
1070703415 10:78619546-78619568 ATCCCTGCCGCAGCCCTTGGTGG + Intergenic
1083504188 11:63139815-63139837 CTTCCAGGTAGAGCCCTTGGAGG - Intronic
1084706469 11:70818942-70818964 TTGCCAGGTGGAGCCCCTGGGGG + Intronic
1086865971 11:91980762-91980784 AGGCCAGGGAGAACCCTTGGTGG + Intergenic
1089385688 11:118066087-118066109 GTGCCAGGGAGAGCCCTGGGTGG - Intergenic
1091178754 11:133584181-133584203 ATGCCAGGTGCACCCCTTGAAGG - Intergenic
1091227590 11:133966781-133966803 AGGACAGGCAGTGCCCTTGGGGG + Intergenic
1091781755 12:3218419-3218441 CTGCCAGGAGGAGACCTTTGGGG + Intronic
1098363343 12:69676982-69677004 ATGCCCTGCGTAGCCTTTGGTGG + Exonic
1103008411 12:117439517-117439539 ATGCCAGGGTGAGGCCTTGCCGG - Intronic
1103994785 12:124822002-124822024 ATGCCAAGGTGAGCCCTTGTTGG + Intronic
1104990188 12:132620208-132620230 ATGCCAGGCGGGGGCTTTGCGGG + Intronic
1106580544 13:31014453-31014475 GAGCCAGGAGGAGGCCTTGGGGG - Intergenic
1111518275 13:89363426-89363448 ACGCCAGGCGGGGCCGGTGGCGG - Intergenic
1113878667 13:113609927-113609949 ATCCCAAGAGGAGGCCTTGGAGG - Intronic
1119861537 14:77939597-77939619 ATGCCAGGGGGAATCCTTGATGG - Intergenic
1124173693 15:27402484-27402506 TTGCCAGGCTGACCCCTTGGTGG - Intronic
1125753479 15:42046272-42046294 AAGACAGGGGGAGCCCATGGAGG - Intronic
1127632753 15:60841895-60841917 GTGCCAAGCAGTGCCCTTGGGGG + Intronic
1128359743 15:66953677-66953699 GTGCCAGGCAGAGCCCTGTGCGG - Intergenic
1132501873 16:288078-288100 GTGCCAGGCGAGGCCCTTGGCGG - Exonic
1132825636 16:1903967-1903989 ATGCCAGGCAGGGCCCACGGTGG - Intergenic
1132860121 16:2066477-2066499 AGGCCCGGCGGAGCCCTCGTAGG - Intronic
1133287294 16:4696622-4696644 ATACCAGGCAGGGCCCTGGGGGG - Exonic
1137553556 16:49456268-49456290 ATGCATGGGGGAGGCCTTGGGGG - Intergenic
1137851703 16:51752206-51752228 CTCCTAGGCGGAGTCCTTGGTGG + Intergenic
1138124733 16:54429423-54429445 ATGCCAGGTGGAGAGGTTGGGGG + Intergenic
1139953379 16:70682335-70682357 ATGCCTGGAGTACCCCTTGGGGG + Intronic
1142302475 16:89266639-89266661 CTGCCAGGCTGAGCCAGTGGCGG - Intergenic
1142394359 16:89823179-89823201 ATATCAGACGGAGCCCTTTGAGG - Intronic
1142610955 17:1109067-1109089 ATGGCAGCCGGAGCCCGCGGAGG + Intronic
1147611426 17:41803817-41803839 GTTCCAGGCTGAGCCCTTGCTGG + Intronic
1150764647 17:67993611-67993633 GTGGCCGGCGGAGCCCTCGGTGG + Intronic
1151305553 17:73260848-73260870 AGGCCAGGCAGAGCCCCTGCTGG + Intronic
1156348401 18:36280885-36280907 ATGCCTGGCAGAGCCTTTAGTGG + Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1158016305 18:52788715-52788737 CTTCAGGGCGGAGCCCTTGGAGG + Intronic
1160828089 19:1089984-1090006 ATGCCAGACAGGGCCGTTGGGGG + Intronic
1162158628 19:8696419-8696441 ATGCCAGGGGCATCCCATGGTGG + Intergenic
1165257677 19:34589535-34589557 ATGACAGCCAGAGCCCCTGGAGG - Intergenic
1168352515 19:55684832-55684854 ATGCCAGGCGATGCCCATGGCGG + Intronic
925350411 2:3197471-3197493 ATGCCAGGCGAAGGCCGTGTGGG - Intronic
926559052 2:14395063-14395085 CTGCCAGGCTGGGCCTTTGGTGG + Intergenic
928084275 2:28336043-28336065 ATGCCAGGCTGAGAGTTTGGAGG + Intronic
929182610 2:39059709-39059731 ATGCCATGTGATGCCCTTGGTGG + Intronic
935180175 2:100682126-100682148 ATGGCAGGCAGAGCCCATGCTGG - Intergenic
935405783 2:102707691-102707713 ATGCCAGGCTGAGCCCTCCTGGG + Intronic
937499295 2:122461110-122461132 ATGCCAGTCAGGGCCCTTGGGGG + Intergenic
940203329 2:151175417-151175439 CTGCCAGGCTGAGTCCTTTGTGG - Intergenic
948639129 2:239362586-239362608 ATGGCAGGCTGAGGCCATGGTGG - Intronic
949018753 2:241728630-241728652 ATGCCAAGCGGAGGCCTGCGTGG + Exonic
1170613610 20:17932833-17932855 ATGCCTGGCCCAGCTCTTGGTGG - Intergenic
1172493407 20:35360022-35360044 AGGCCAGGTGTAGCTCTTGGAGG - Intronic
1172571524 20:35974539-35974561 TTGTCAGGCGGAGCACTGGGCGG + Intronic
1175911788 20:62408504-62408526 AGGCCTGGCAGAGGCCTTGGAGG - Intergenic
1176087683 20:63305483-63305505 CTGCAAGGTGTAGCCCTTGGAGG - Exonic
1176379351 21:6104082-6104104 ATGCCTGGCAGATCCCATGGAGG - Intergenic
1178383971 21:32134657-32134679 AAGCGAGGAGGAGCCCTGGGAGG - Intergenic
1179679138 21:43005677-43005699 ATGCCAGGCAGAGATGTTGGGGG - Intronic
1179744122 21:43434155-43434177 ATGCCTGGCAGATCCCATGGAGG + Intergenic
1179829742 21:43989131-43989153 AAGCCATGCGGAGCCCTCCGTGG - Intergenic
1180174612 21:46081611-46081633 CTGCCAGGGGGAGCGCTGGGAGG - Intergenic
1180204157 21:46247012-46247034 ATGCCCAGCTGTGCCCTTGGAGG - Intronic
1182299610 22:29330305-29330327 ATGCCAGGGGGTGGCCCTGGTGG - Intronic
1183212695 22:36460711-36460733 ATCCCAGGAGGAGGCTTTGGTGG - Intergenic
1183990992 22:41597017-41597039 ATGCCAGGCCCTGCCCTGGGAGG + Intergenic
1184758837 22:46533542-46533564 ATGCCAGGCGGAGCCCTTGGCGG + Intronic
1185041452 22:48506523-48506545 GTGACAGGCGGGGCCTTTGGAGG + Intronic
1185130400 22:49035570-49035592 AAGCCAGGAGGAGGCCTTCGAGG - Intergenic
949243134 3:1894565-1894587 ATACCAGGAGGAGCACTGGGTGG + Intergenic
950010340 3:9718435-9718457 CTGCCAGGCTGAGCCCATGCAGG - Intronic
952723472 3:36557368-36557390 ATCCCTGGGGAAGCCCTTGGAGG - Intergenic
954682753 3:52354806-52354828 AAGCCAGGCTGAGTCCTGGGAGG - Intronic
956890803 3:73612376-73612398 ATGCCAGGCTCAGTCTTTGGAGG - Intronic
965585751 3:170316822-170316844 CTTCAGGGCGGAGCCCTTGGAGG + Intergenic
967170398 3:186818546-186818568 AGGCAATGCGGAGCCCCTGGAGG + Intergenic
969326678 4:6448326-6448348 AAGGCAGGTGGATCCCTTGGAGG + Intronic
969876773 4:10141316-10141338 CTTCCAGGCTGAGCCCCTGGAGG + Intergenic
971148693 4:24007806-24007828 ATGCTAGGCGGGTTCCTTGGAGG + Intergenic
971279339 4:25229523-25229545 CTTCAAGGTGGAGCCCTTGGAGG - Intronic
974922733 4:68261869-68261891 CTTCAAGGTGGAGCCCTTGGAGG - Intergenic
978954562 4:114598596-114598618 ATGCTAGGCTGAGCGCGTGGCGG + Exonic
979643762 4:123041966-123041988 ATGCAAGGCAGTGTCCTTGGTGG + Intronic
982169205 4:152644897-152644919 ATTCCAAGGGGAGCCCTTGATGG - Intronic
985946375 5:3187876-3187898 ATGTCAGGAGGTGCCATTGGAGG - Intergenic
989782074 5:45279286-45279308 ATGAAAGGCAGACCCCTTGGTGG - Intronic
996400816 5:123060222-123060244 ATGCCAGGCAGGGCTTTTGGGGG + Intergenic
997657935 5:135569044-135569066 CTGCCAGGCCCAGCCATTGGAGG + Intergenic
1002159902 5:177308920-177308942 CTCCCAGGCGGAGCCCTCAGTGG + Intronic
1002717027 5:181234229-181234251 CTGCCAGGCGGACCCCCCGGCGG - Exonic
1004912225 6:20297571-20297593 AGGCCAGGTGGTGACCTTGGTGG - Intergenic
1005583172 6:27251869-27251891 AAACCAGGCGGAGCTGTTGGGGG + Exonic
1007779708 6:44245986-44246008 AGGGCAGCCGGAGCTCTTGGAGG - Intergenic
1009995844 6:70894240-70894262 AGGCCAGACGGAGACCTTGCGGG + Exonic
1017991491 6:159493044-159493066 ATGCCATGAGGTGCCCTTGAAGG + Intergenic
1019292121 7:255978-256000 AGACCTGGCGGAACCCTTGGCGG + Exonic
1019952315 7:4383587-4383609 ATGGCAGCCGGAGCCTTAGGCGG + Intergenic
1033159424 7:138982486-138982508 CTGCCAGGCCCAGCCCTTGAAGG + Intergenic
1033919142 7:146366649-146366671 AAGACAGGTGGAGCCCTTGATGG - Intronic
1034165716 7:149023505-149023527 CTGCCAGCCGGGGCCCCTGGTGG - Intronic
1034268746 7:149793310-149793332 GTGCCAGACGGAGCCCTGTGAGG + Intergenic
1046743094 8:117848905-117848927 GTGCCAGGAGGAGCCACTGGAGG - Intronic
1049360792 8:142211739-142211761 ATGCCACACTGAGCCCTTGATGG - Intergenic
1053415561 9:37944951-37944973 TGGCCAGGCTGAGCCCCTGGAGG + Intronic
1053485980 9:38456598-38456620 AGGCCAGGCAGAGCCCTTTGGGG + Intergenic
1056942153 9:90964952-90964974 CTGCCAGGAGGACCCCTTGGGGG - Intergenic
1057073657 9:92122521-92122543 ATGCCAGCCGGGGCCCCAGGTGG + Intergenic
1057794569 9:98146146-98146168 AGGGCAGGCAGAGCCCCTGGGGG - Intronic
1057842816 9:98500258-98500280 ATGGCAGGGGGTGCCCCTGGGGG + Intronic
1059259194 9:112959556-112959578 ATGCCAGGCAGAAGTCTTGGGGG + Intergenic
1061175943 9:128997154-128997176 CTTCCAGGTGGAGCCCGTGGAGG + Intronic
1061570903 9:131476902-131476924 CTGCCAGGCGGCGTCCTAGGGGG + Intronic
1061952828 9:133945755-133945777 ATGCCAGCCAGAGACCTGGGAGG - Intronic
1062381664 9:136289909-136289931 ATGCCGGGCGGGGCCTTGGGGGG - Intronic
1062595681 9:137298120-137298142 TTGCCAGGCACAGCCCTAGGGGG - Intergenic
1187449122 X:19381439-19381461 CTGCCAGGCTCAGGCCTTGGTGG + Intronic
1190711135 X:53071346-53071368 ATGACAGGCACAGGCCTTGGAGG + Intronic
1190815714 X:53927296-53927318 CTTCAGGGCGGAGCCCTTGGAGG - Intergenic
1192430142 X:71106257-71106279 TTGCCAGGAGGAGGGCTTGGGGG + Intronic
1194262550 X:91715483-91715505 TTGCCAGGCGGAGGCCGAGGCGG - Intergenic
1199826945 X:151509788-151509810 ATGCCAGTGGGAGCCTTTTGGGG + Intergenic