ID: 1184759724

View in Genome Browser
Species Human (GRCh38)
Location 22:46537538-46537560
Sequence CGGGGGCTGAGTTCCCGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184759709_1184759724 16 Left 1184759709 22:46537499-46537521 CCGGACGGGCGTGGGAAGCGGGG No data
Right 1184759724 22:46537538-46537560 CGGGGGCTGAGTTCCCGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184759724 Original CRISPR CGGGGGCTGAGTTCCCGGAG CGG Intergenic
No off target data available for this crispr