ID: 1184759862

View in Genome Browser
Species Human (GRCh38)
Location 22:46537904-46537926
Sequence GAGCCGCGGCCCCGAGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184759862_1184759874 29 Left 1184759862 22:46537904-46537926 CCTCGGGCTCGGGGCCGCGGCTC No data
Right 1184759874 22:46537956-46537978 GATCCACGGAGACCGCCGCCAGG No data
1184759862_1184759865 -1 Left 1184759862 22:46537904-46537926 CCTCGGGCTCGGGGCCGCGGCTC No data
Right 1184759865 22:46537926-46537948 CAGAGCCTGGCTCCCCACCCCGG No data
1184759862_1184759870 15 Left 1184759862 22:46537904-46537926 CCTCGGGCTCGGGGCCGCGGCTC No data
Right 1184759870 22:46537942-46537964 ACCCCGGCAGAACAGATCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184759862 Original CRISPR GAGCCGCGGCCCCGAGCCCG AGG (reversed) Intergenic
No off target data available for this crispr