ID: 1184766805

View in Genome Browser
Species Human (GRCh38)
Location 22:46576630-46576652
Sequence ACGCGGCCCCACGCCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766805_1184766820 21 Left 1184766805 22:46576630-46576652 CCAGCCCCGGCGTGGGGCCGCGT No data
Right 1184766820 22:46576674-46576696 GAGGAAAGGCATTTCCACCCGGG No data
1184766805_1184766821 27 Left 1184766805 22:46576630-46576652 CCAGCCCCGGCGTGGGGCCGCGT No data
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG No data
1184766805_1184766814 2 Left 1184766805 22:46576630-46576652 CCAGCCCCGGCGTGGGGCCGCGT No data
Right 1184766814 22:46576655-46576677 GGCGCCCCGCGAGGCGGTCGAGG No data
1184766805_1184766817 7 Left 1184766805 22:46576630-46576652 CCAGCCCCGGCGTGGGGCCGCGT No data
Right 1184766817 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG No data
1184766805_1184766822 28 Left 1184766805 22:46576630-46576652 CCAGCCCCGGCGTGGGGCCGCGT No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766805_1184766812 -4 Left 1184766805 22:46576630-46576652 CCAGCCCCGGCGTGGGGCCGCGT No data
Right 1184766812 22:46576649-46576671 GCGTCCGGCGCCCCGCGAGGCGG No data
1184766805_1184766810 -7 Left 1184766805 22:46576630-46576652 CCAGCCCCGGCGTGGGGCCGCGT No data
Right 1184766810 22:46576646-46576668 GCCGCGTCCGGCGCCCCGCGAGG No data
1184766805_1184766819 20 Left 1184766805 22:46576630-46576652 CCAGCCCCGGCGTGGGGCCGCGT No data
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766805 Original CRISPR ACGCGGCCCCACGCCGGGGC TGG (reversed) Intronic