ID: 1184766806

View in Genome Browser
Species Human (GRCh38)
Location 22:46576634-46576656
Sequence CCGGACGCGGCCCCACGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766806_1184766822 24 Left 1184766806 22:46576634-46576656 CCCCGGCGTGGGGCCGCGTCCGG No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766806_1184766812 -8 Left 1184766806 22:46576634-46576656 CCCCGGCGTGGGGCCGCGTCCGG No data
Right 1184766812 22:46576649-46576671 GCGTCCGGCGCCCCGCGAGGCGG No data
1184766806_1184766821 23 Left 1184766806 22:46576634-46576656 CCCCGGCGTGGGGCCGCGTCCGG No data
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG No data
1184766806_1184766820 17 Left 1184766806 22:46576634-46576656 CCCCGGCGTGGGGCCGCGTCCGG No data
Right 1184766820 22:46576674-46576696 GAGGAAAGGCATTTCCACCCGGG No data
1184766806_1184766819 16 Left 1184766806 22:46576634-46576656 CCCCGGCGTGGGGCCGCGTCCGG No data
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG No data
1184766806_1184766814 -2 Left 1184766806 22:46576634-46576656 CCCCGGCGTGGGGCCGCGTCCGG No data
Right 1184766814 22:46576655-46576677 GGCGCCCCGCGAGGCGGTCGAGG No data
1184766806_1184766817 3 Left 1184766806 22:46576634-46576656 CCCCGGCGTGGGGCCGCGTCCGG No data
Right 1184766817 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766806 Original CRISPR CCGGACGCGGCCCCACGCCG GGG (reversed) Intronic