ID: 1184766811

View in Genome Browser
Species Human (GRCh38)
Location 22:46576647-46576669
Sequence GCCTCGCGGGGCGCCGGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766811_1184766819 3 Left 1184766811 22:46576647-46576669 CCGCGTCCGGCGCCCCGCGAGGC 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
1184766811_1184766821 10 Left 1184766811 22:46576647-46576669 CCGCGTCCGGCGCCCCGCGAGGC 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77
1184766811_1184766822 11 Left 1184766811 22:46576647-46576669 CCGCGTCCGGCGCCCCGCGAGGC 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766811_1184766817 -10 Left 1184766811 22:46576647-46576669 CCGCGTCCGGCGCCCCGCGAGGC 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1184766817 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG 0: 1
1: 0
2: 0
3: 1
4: 33
1184766811_1184766820 4 Left 1184766811 22:46576647-46576669 CCGCGTCCGGCGCCCCGCGAGGC 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1184766820 22:46576674-46576696 GAGGAAAGGCATTTCCACCCGGG 0: 1
1: 0
2: 3
3: 15
4: 199
1184766811_1184766825 21 Left 1184766811 22:46576647-46576669 CCGCGTCCGGCGCCCCGCGAGGC 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766811 Original CRISPR GCCTCGCGGGGCGCCGGACG CGG (reversed) Intronic
901049628 1:6419790-6419812 GCCTCGCCGGGCAGGGGACGCGG - Exonic
901361322 1:8703277-8703299 GCCGCGCGGGGCCCCGCCCGCGG + Intronic
903263227 1:22142517-22142539 CCCGGGAGGGGCGCCGGACGCGG - Intronic
904799212 1:33081175-33081197 GGCTGGCGGGGCGCAGGCCGCGG + Exonic
905124625 1:35708094-35708116 GCCTCGAGTGGCGCGGGCCGGGG - Intergenic
906650296 1:47508210-47508232 GCCCCGCGGGGCGCCCGCCGCGG + Intergenic
910450102 1:87335394-87335416 GCCTCGGGCGGCGCCGGCCCGGG - Intronic
912401523 1:109397646-109397668 GCGTCGCAGCGCGCCGGGCGAGG - Exonic
912716874 1:111989528-111989550 CGCGCGCGGGGCGCCGGGCGCGG - Intergenic
918040756 1:180912773-180912795 GCCCCGCGGGGCTCCGGGCGGGG + Intergenic
920655213 1:207869197-207869219 GCCGCGCGGGACGCCGAGCGTGG - Intergenic
922739373 1:228006884-228006906 GCCGCGGGGGGCGCCCGCCGGGG - Intergenic
924289592 1:242524322-242524344 GGCGCGCGGGGAGCCGGGCGCGG + Exonic
1069790379 10:71015750-71015772 GCCTCCCGAGGCCCCTGACGTGG - Intergenic
1069998042 10:72354966-72354988 GCGTCGCGGGCAGCCGGGCGCGG + Exonic
1071309502 10:84328971-84328993 CCCTCGCGAGCCGCCGGACGCGG + Intronic
1074591835 10:114821626-114821648 GCCTCGCGCGGGGCTGGAGGCGG - Intergenic
1076792855 10:132786051-132786073 GCAGCGCGGGGCGCGGGGCGCGG + Exonic
1077040497 11:518993-519015 GGCGCGCGAGGCGCCGCACGGGG + Intergenic
1080571186 11:33558492-33558514 GCCTCCAGGGGCACCGGACAGGG + Intronic
1084068470 11:66718915-66718937 GCCCTGCGGGGCGGCGGAGGAGG + Intronic
1084070170 11:66728471-66728493 GCCCCGCGGGGCTCTGGGCGGGG + Intronic
1084809421 11:71603369-71603391 GCCACGAGGGGCACCGGGCGTGG - Intergenic
1094155502 12:27333307-27333329 TCCTCCCGGGGAGCGGGACGCGG + Intronic
1096106276 12:48998427-48998449 GCGTTGCGGGGCTCCGGGCGGGG + Exonic
1102997459 12:117361248-117361270 GCCGCGCGGGGCGGCGGACTCGG - Intronic
1103954219 12:124567493-124567515 GCATCGCGGAGCGCAGGGCGCGG + Intronic
1106340148 13:28819906-28819928 GCGACGCGGGGCGCGGGGCGCGG + Intergenic
1110572962 13:77026662-77026684 GCCGGGCGGGGCGCGGGGCGCGG - Intronic
1113494507 13:110715917-110715939 GCCCCGCGGGTCGCGGGAGGCGG - Exonic
1113660738 13:112105038-112105060 GCAGCGCGGGGCTCCAGACGGGG - Intergenic
1119602488 14:75985939-75985961 GCCTCGCGCCGCGCCGGGTGAGG + Intronic
1121025855 14:90615839-90615861 GCTTTGCGGGGAGCCGGAGGGGG + Intronic
1122151969 14:99730445-99730467 GCCTCGCCGGGAGCCGGGCCTGG + Intergenic
1122296529 14:100709209-100709231 GCCTCACGGGGGCCTGGACGGGG + Intergenic
1122768097 14:104085406-104085428 GCCTGGCGGGGTGCGGGGCGGGG - Intergenic
1122768108 14:104085428-104085450 GCCTGGCGGGGTGCGGGGCGGGG - Intergenic
1122768119 14:104085450-104085472 GCCTGGCGGGGTGCGGGGCGGGG - Intergenic
1122768130 14:104085472-104085494 GCCTGGCGGGGTGCGGGGCGGGG - Intergenic
1122905545 14:104800140-104800162 ACCTCGCAGGGCGCCGGCCTTGG - Intergenic
1132544552 16:527370-527392 GGCTCGCGGGGAGCCGGGCTGGG - Intergenic
1132674328 16:1115410-1115432 GCCTCCCGGGGGGCAGGACTGGG - Intergenic
1133782949 16:8953661-8953683 GCCTCCGGTGGCGCCGCACGGGG - Intronic
1133782959 16:8953700-8953722 GCCTCCGGTGGCGCCGCACGGGG - Intronic
1136546483 16:30957851-30957873 GCCTCCCAGGGCGCCGGCCGAGG + Exonic
1141584922 16:85027666-85027688 CCCTCGCGGGGGGCGGGAGGCGG - Intergenic
1143030435 17:3964379-3964401 GCCTCGCGCGGCGCCCGCCCGGG - Intronic
1144757962 17:17691667-17691689 GCCTCGGGGGGCCCAGGAAGTGG + Intronic
1148899569 17:50866031-50866053 GTATCTCGGGGCGCCGGGCGGGG - Intronic
1152085359 17:78214528-78214550 GCCTCGCTGGGGACAGGACGGGG - Intronic
1152319614 17:79601100-79601122 GCCTCGAGGGGCCCCGGCTGGGG + Intergenic
1152349702 17:79777937-79777959 CCCGCGCGGGGCCCCGGGCGGGG - Intergenic
1152375980 17:79919264-79919286 GCCTGGCAGGGCGCCGGGCGAGG - Intergenic
1152378530 17:79930564-79930586 GCCTCGCGAGGAGCCGGCCGGGG + Intergenic
1152628130 17:81397586-81397608 GGCTCGGGAGGCGCCGGCCGGGG + Intronic
1152689635 17:81712188-81712210 GCCGCGAGGGGCGCCGAGCGCGG - Intergenic
1152759147 17:82099079-82099101 GCTTCCCGGGGACCCGGACGAGG + Intergenic
1152865377 17:82719462-82719484 GCCTCGCTGCACGCCGGCCGCGG + Intronic
1160893307 19:1390821-1390843 GCCACGCGGGGCTCCGGGGGTGG + Intronic
1163026993 19:14518295-14518317 GGCCCGCGGCGCGTCGGACGAGG - Exonic
1163743892 19:19033489-19033511 GCCTCGCGCGGCGGCGGCGGCGG - Intronic
1164639029 19:29811708-29811730 GGGGCGCGGGGCGCGGGACGCGG - Intergenic
1165349357 19:35267989-35268011 GCCGCGCGGGGCGGGGGACCGGG + Intergenic
1166641921 19:44500666-44500688 GCCCCCCCGGGCCCCGGACGAGG - Intergenic
1168107026 19:54171988-54172010 GCCTTGGGGGGCGCTGGAGGAGG - Exonic
1168689646 19:58368915-58368937 GCATCGCGGGGCGCCCGCTGGGG - Exonic
927713929 2:25341173-25341195 GCCCCGCGGGGCGGGGGACCCGG - Intronic
931763605 2:65436208-65436230 GCCTCGCGGGGCGGGGAGCGGGG - Intergenic
935265161 2:101387424-101387446 GCCGCGCCGGCCGCCGGCCGCGG + Exonic
938895223 2:135742416-135742438 CCCGCTCGGGGCGACGGACGCGG + Intronic
946386583 2:219387694-219387716 GCCCCGGAGGGCGCCGGACCCGG + Intronic
948991824 2:241559382-241559404 GGCGCGCGGGGCGCCGGGCTGGG - Intronic
1171035423 20:21709357-21709379 GCCCCGGGGGGCGCCAGAGGAGG - Exonic
1172284743 20:33732410-33732432 GGCGCGCGGGGCCCGGGACGGGG + Intronic
1172618982 20:36307223-36307245 TCTCCGCGGGGCGCCGCACGTGG - Intronic
1175399715 20:58693272-58693294 GCCTCGCGGGGCGCAGGGCTGGG - Intronic
1175847494 20:62066164-62066186 GCCGGGCGGGGCGCGGGATGCGG + Intergenic
1176548966 21:8213421-8213443 GCCTCGCGGCGCGTCGGCCGGGG + Intergenic
1176556859 21:8257633-8257655 GCCTCGCGGCGCGTCGGCCGGGG + Intergenic
1176567895 21:8396451-8396473 GCCTCGCGGCGCGTCGGCCGGGG + Intergenic
1176575799 21:8440670-8440692 GCCTCGCGGCGCGTCGGCCGGGG + Intergenic
1179213657 21:39348843-39348865 GCCCGGCGGGGCGCCGGCGGCGG + Intronic
1180182872 21:46125642-46125664 GCATTGCGGGGGGCCGGGCGGGG + Intronic
1181299279 22:21867754-21867776 GCCGCGCGGGCCGGCGGAAGCGG + Intergenic
1182903860 22:33920478-33920500 GCCGGGCCGGGCGCCGAACGCGG + Intronic
1184720071 22:46307045-46307067 GCCTTGCGGGGAGCTGGAGGAGG + Intronic
1184766811 22:46576647-46576669 GCCTCGCGGGGCGCCGGACGCGG - Intronic
1185038019 22:48489766-48489788 GGCCCGCGGGGCGCCTGCCGGGG - Intronic
1185259510 22:49853809-49853831 GCCCCGCGCGGCGCGGGGCGGGG - Intergenic
1203253850 22_KI270733v1_random:129728-129750 GCCTCGCGGCGCGTCGGCCGGGG + Intergenic
1203261906 22_KI270733v1_random:174807-174829 GCCTCGCGGCGCGTCGGCCGGGG + Intergenic
953326066 3:42013551-42013573 GCGGCGCGGGGCGGCGGGCGGGG + Intergenic
953614398 3:44477488-44477510 GCCTGCCCGGGCGGCGGACGGGG - Intronic
954375811 3:50193676-50193698 GCAGCGCGGGGCGCGGGGCGCGG + Intronic
954403454 3:50331735-50331757 GCCCGGCGGGGCCCAGGACGGGG - Exonic
956761360 3:72447411-72447433 GCCTCACGGGGCGCCGTGCGGGG - Intergenic
960691373 3:120349442-120349464 GCCTCACGAGGCGCGGGGCGCGG + Intergenic
961858161 3:129893380-129893402 GCCTGGCGGCGCAGCGGACGCGG - Intronic
967054957 3:185823778-185823800 GGTTCGGGGGGCGCCGGCCGGGG + Intronic
967904071 3:194486699-194486721 GCAGCGCGCGGCGCCGGCCGAGG - Intronic
968831353 4:2934326-2934348 GAATCGCGGGGCGCGGGCCGGGG - Exonic
968845875 4:3041328-3041350 GCCTCTCGGGGGCCCTGACGTGG - Intergenic
977809698 4:101346056-101346078 GCCGCGGGGGGCGCGGGAGGCGG - Intronic
979536225 4:121823588-121823610 GCCTCGCGGGTCGCAGGCCCCGG + Exonic
984639371 4:182144857-182144879 GCCCCGGGAGGCGGCGGACGCGG + Intronic
985866974 5:2521607-2521629 GCCTGGCTGGGCGCTGGACTCGG + Intergenic
986184503 5:5423007-5423029 ACCTCCCGGGGCCCCGGGCGCGG + Intronic
992104094 5:73436365-73436387 GCCTCGCTGGGGGCCGGGCGGGG - Intergenic
992365460 5:76084777-76084799 GCCCCGCGGCGCGCCTGGCGCGG + Intronic
993168277 5:84384226-84384248 GCCGCGCAGGGGGCCGGAGGCGG - Intronic
998200373 5:140113887-140113909 GCCTGGCGGGCGGGCGGACGGGG + Intronic
999223463 5:150000693-150000715 CCCTCGCGGCGCACCGGAAGCGG - Exonic
1002537999 5:179888776-179888798 GCCTGGCAGGGAGACGGACGAGG + Intronic
1006725410 6:36196547-36196569 GCCTGGCGCGGCGGCGGCCGGGG - Intergenic
1011128733 6:84033696-84033718 GCGGCGCGGGGCGCCGGAGCAGG - Intergenic
1013803177 6:113970426-113970448 GCCTCGCGGGGGACGGGTCGAGG + Intronic
1018020915 6:159761878-159761900 GGCGCGCGGGGCGCGGGGCGCGG - Exonic
1019338027 7:494361-494383 GCTTCCCGGGGCGCCCGGCGAGG - Intergenic
1019346510 7:533408-533430 GTCCCGCGGGGTGCCAGACGTGG + Intergenic
1019379256 7:712594-712616 GCCCCGCGGGGAGGCGGTCGGGG - Intronic
1019732306 7:2634858-2634880 GCTCCTCGGGGGGCCGGACGAGG - Intronic
1022395978 7:29988990-29989012 TCTCCGCGGGGCGCCGGGCGGGG - Intronic
1026164323 7:67896590-67896612 GCCTCACGGGGCGACGGGTGGGG + Intergenic
1026894124 7:74000275-74000297 GCCTCACGGGGCGGCGGGTGGGG + Intergenic
1032095800 7:128938084-128938106 CCCTCGGGGCGCGCCGGGCGCGG - Intronic
1035319003 7:158016312-158016334 GCCCGGCGGGGCACAGGACGGGG - Intronic
1036930560 8:12951803-12951825 CCCGCGCGGGGCGCCGGAGTAGG + Intronic
1037769182 8:21789028-21789050 GCGGCGCGGGGCGCGGGGCGCGG + Intronic
1038035410 8:23682631-23682653 GCCCCGCGCCGCGCCGGAGGAGG - Exonic
1039948988 8:42153196-42153218 GCCTCTCAGGGCTGCGGACGCGG + Intronic
1045488673 8:102654335-102654357 GGCTCGCGGGGAGCTGGAAGGGG - Intronic
1060979810 9:127785669-127785691 GCTGCGCGGGGCGGCGGGCGGGG - Intronic
1061006409 9:127930721-127930743 ACCTCGCGGGGCCCCGGGCTCGG + Exonic
1061863465 9:133479342-133479364 CCCCCGCGGAGCGCCGGAAGCGG + Intergenic
1062550935 9:137086287-137086309 GCCTCGCTCGGCGCCGGTCCAGG + Intergenic
1062718681 9:138023627-138023649 GCCTCCCGGGGCCCCGCTCGGGG - Exonic
1203470250 Un_GL000220v1:112872-112894 GCCTCGCGGCGCGTCGGCCGGGG + Intergenic
1203478071 Un_GL000220v1:156844-156866 GCCTCGCGGCGCGTCGGCCGGGG + Intergenic
1193755853 X:85408184-85408206 GCCTAGGGTGGCGGCGGACGTGG - Intergenic
1200163304 X:154019921-154019943 GCCCCGCCGGGCGTCGCACGAGG - Exonic
1201790275 Y:17832280-17832302 GCCAGGCGGGGCGTCGCACGTGG + Intergenic
1201811279 Y:18073709-18073731 GCCAGGCGGGGCGTCGCACGTGG - Intergenic