ID: 1184766815

View in Genome Browser
Species Human (GRCh38)
Location 22:46576659-46576681
Sequence CTTTCCTCGACCGCCTCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 25}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766815_1184766821 -2 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77
1184766815_1184766820 -8 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1184766820 22:46576674-46576696 GAGGAAAGGCATTTCCACCCGGG 0: 1
1: 0
2: 3
3: 15
4: 199
1184766815_1184766825 9 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1184766815_1184766819 -9 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
1184766815_1184766822 -1 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766815 Original CRISPR CTTTCCTCGACCGCCTCGCG GGG (reversed) Intronic
900163081 1:1233518-1233540 CTGTCCCCGACCGGCTCACGGGG + Exonic
904378047 1:30094123-30094145 CTGGCCTCAACCGCCTCGCATGG - Intergenic
905397173 1:37674218-37674240 CTTTCCCAGACCGCCTGGCTTGG - Intergenic
1083823271 11:65184243-65184265 CTGTCCTTGCCCGCCTTGCGCGG + Intronic
1090661855 11:128888136-128888158 ATTTTCTCGACAGCCTCGGGAGG - Intergenic
1097281113 12:57846011-57846033 CTTTCCTTCACCGCCGCGCGCGG - Intronic
1101719782 12:107341382-107341404 ATTTCCTGGACAGCCTCACGGGG - Intronic
1110711799 13:78658690-78658712 CTTCCCTCTGCAGCCTCGCGTGG - Intronic
1118949719 14:70423785-70423807 CTTTCCTCCACATCCTCGCCAGG - Intergenic
1142152077 16:88517067-88517089 CTTTCCTCCAACCCCTGGCGTGG - Intronic
1150806624 17:68324485-68324507 CTTTCCACTACAGCCACGCGAGG - Intronic
930411096 2:51027606-51027628 CCCTCCTCGCCCGCCTCGCACGG + Exonic
934649845 2:96084627-96084649 CTCTCCACGACCGCCTGGAGGGG - Intergenic
942181255 2:173383290-173383312 CTTACCTCCACCACCTCCCGAGG - Intergenic
948928387 2:241115079-241115101 CTTTCATCGACCGCCACCCCAGG - Exonic
1184766815 22:46576659-46576681 CTTTCCTCGACCGCCTCGCGGGG - Intronic
978351481 4:107824887-107824909 CTCTCCCCGCCCGCCGCGCGCGG - Intronic
981563193 4:146069076-146069098 CTTTCTTCGACCACCACTCGAGG + Intergenic
985323298 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG + Intergenic
994722165 5:103392867-103392889 CTTTCCCCGACCACCTCTCTGGG + Intergenic
1017313539 6:153002530-153002552 CCTTCCTCGAGCGCCAGGCGGGG - Exonic
1022968153 7:35493352-35493374 CTTTCCTGGAAAGCCTCGCTGGG - Intergenic
1049693263 8:143971980-143972002 CTTTCCTCTACCTCCTGGGGTGG - Intronic
1062490779 9:136803888-136803910 CTTTCCTCCACCTCCTCCCAGGG - Intronic
1186425893 X:9464647-9464669 CTTTCCACGACTGCCTCGAGGGG - Intronic
1194199037 X:90932770-90932792 CTTTTCTCGGCAGCCTCGCCAGG + Intergenic
1197718925 X:129731492-129731514 CTTTCCTTGACCTCCTGGCGAGG - Intergenic
1198806920 X:140502633-140502655 CTTTCCAGCCCCGCCTCGCGTGG + Intergenic
1200545034 Y:4509202-4509224 CTTTTCTCGGCAGCCTCGCCAGG + Intergenic