ID: 1184766815

View in Genome Browser
Species Human (GRCh38)
Location 22:46576659-46576681
Sequence CTTTCCTCGACCGCCTCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766815_1184766820 -8 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG No data
Right 1184766820 22:46576674-46576696 GAGGAAAGGCATTTCCACCCGGG No data
1184766815_1184766821 -2 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG No data
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG No data
1184766815_1184766819 -9 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG No data
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG No data
1184766815_1184766825 9 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG No data
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG No data
1184766815_1184766822 -1 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766815 Original CRISPR CTTTCCTCGACCGCCTCGCG GGG (reversed) Intronic