ID: 1184766816

View in Genome Browser
Species Human (GRCh38)
Location 22:46576660-46576682
Sequence CCTTTCCTCGACCGCCTCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766816_1184766819 -10 Left 1184766816 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
1184766816_1184766820 -9 Left 1184766816 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1184766820 22:46576674-46576696 GAGGAAAGGCATTTCCACCCGGG 0: 1
1: 0
2: 3
3: 15
4: 199
1184766816_1184766825 8 Left 1184766816 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1184766816_1184766821 -3 Left 1184766816 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77
1184766816_1184766822 -2 Left 1184766816 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766816 Original CRISPR CCTTTCCTCGACCGCCTCGC GGG (reversed) Intronic
900143598 1:1148736-1148758 CCATTCCCCGACGCCCTCGCAGG - Intergenic
904917749 1:33982670-33982692 CCTTTCCTCCACCAACTGGCAGG - Intronic
907182037 1:52579139-52579161 CCTTTTCTCCACAGCCTTGCCGG + Intergenic
919245124 1:194972952-194972974 CCTTTTCTCCACAGCCTCACTGG - Intergenic
919920536 1:202164231-202164253 ACTTTCCTGGACCTCCTGGCAGG - Intergenic
922190281 1:223312804-223312826 CCTTTCCTCATCTGCCTCACTGG - Intronic
924351525 1:243119154-243119176 CCTTTCCTTGGCCTCCTCTCTGG - Intergenic
924715256 1:246566809-246566831 CCTTACCTCCTCCGCCTCTCAGG + Intronic
1062845092 10:697440-697462 CCGTTCCTGGAACGCCTCTCTGG + Intergenic
1064371578 10:14756520-14756542 CCTTTTCTCCACAACCTCGCTGG - Intronic
1065839086 10:29685553-29685575 CCTTTTCTCCACAACCTCGCCGG + Intronic
1075693544 10:124418024-124418046 CGTTTCCTCGATCGCCTTCCCGG - Intronic
1078431666 11:11292940-11292962 CCTCTCCTCCACCACCTCCCTGG + Intronic
1083465046 11:62839791-62839813 CCTTTCCTGGACTGCGTGGCCGG + Exonic
1089180598 11:116580569-116580591 GCTTTCCCCGGGCGCCTCGCGGG - Intergenic
1089445112 11:118545756-118545778 CCTTTCCTCGTCCCCATCTCTGG - Intronic
1093979201 12:25456340-25456362 CCTTTTCTCCACAGCCTCACCGG - Intronic
1098956925 12:76697294-76697316 CCTTTCCTGGATCTCCTGGCTGG + Intergenic
1101180321 12:102209844-102209866 CCTTTTCTCTACAGCCTTGCCGG - Intergenic
1101719783 12:107341383-107341405 CATTTCCTGGACAGCCTCACGGG - Intronic
1105203544 13:18200089-18200111 CCTCTCCTCCTCTGCCTCGCTGG + Intergenic
1107086346 13:36431624-36431646 CATCTCCTCTGCCGCCTCGCAGG + Intergenic
1114686871 14:24541285-24541307 CCTTTACTCCACAACCTCGCTGG - Intergenic
1118992334 14:70808699-70808721 CCCTTCCCCGACCGCCCCCCAGG + Intronic
1127845204 15:62864634-62864656 CCTTTTCTCTACAACCTCGCTGG - Intergenic
1130224051 15:82044801-82044823 CTGTTCCTCGAGCGCCTCGCGGG - Intronic
1139551366 16:67674875-67674897 CCTTTCCTGGTCCGACTCACTGG + Exonic
1150168525 17:62966759-62966781 CCTTTCCTCGCCCTGCTCCCCGG - Intergenic
1150280886 17:63929122-63929144 CCTTTCCTGGACCCCCCAGCTGG - Exonic
1150885014 17:69074882-69074904 CCTTTTCTCCACAGCCTTGCTGG + Intergenic
1152843286 17:82584077-82584099 CCTTCCCTCGACAGGCTCTCAGG - Exonic
1155208450 18:23580661-23580683 CCTCTCCTCCATCGCCTCACTGG - Intronic
1157886835 18:51376786-51376808 CCTTTTCTCCACATCCTCGCTGG - Intergenic
1161143608 19:2664087-2664109 CCTATCCTCCACCGCCCCCCAGG + Intronic
1163123341 19:15231396-15231418 CCCTCCCTCGCCCGCCTGGCAGG - Exonic
1167101562 19:47407137-47407159 CGTTTCCATGACCGCCTCCCAGG - Exonic
1167643548 19:50694614-50694636 CTTTTCCTCCACCCCCTCACAGG - Intronic
925388518 2:3479986-3480008 CCTCTCCTCCACCGCCAGGCTGG - Intronic
945023845 2:205601136-205601158 CTTTTTCTCCACAGCCTCGCTGG + Intronic
1176714427 21:10337988-10338010 CCTCTCCTCCTCTGCCTCGCTGG - Intergenic
1181693943 22:24583593-24583615 CCTGCCCTCGACAGCCTTGCTGG + Intronic
1184766816 22:46576660-46576682 CCTTTCCTCGACCGCCTCGCGGG - Intronic
950796313 3:15513244-15513266 CCTTGCCTCCATCGCCTCTCTGG - Intronic
956559744 3:70561820-70561842 CCTTTCCTCCACATCCTCACTGG + Intergenic
956640692 3:71412755-71412777 CCTCTCCTCTACCTCCTCCCTGG + Intronic
957871988 3:86101121-86101143 CCTTCCCTCGGCCCCCTGGCAGG + Intergenic
957916820 3:86696287-86696309 CCTTTCCTGGATCTCCTGGCTGG + Intergenic
960639357 3:119811548-119811570 CCTCTCCTCCACGGCCTCGTCGG - Exonic
966936260 3:184711719-184711741 CCGGGCCCCGACCGCCTCGCAGG - Exonic
968300642 3:197611151-197611173 CCTTTTCTCCACATCCTCGCCGG - Intergenic
971434987 4:26611082-26611104 CCTTTTCTCTACAGCCTCCCTGG + Intronic
979250417 4:118561379-118561401 CCTTTCCTTGGCCTCCTCTCTGG + Intergenic
980103579 4:128565858-128565880 CCTTTCCAAGACGGCCTCTCAGG - Intergenic
980464205 4:133152141-133152163 CCTTTCCTCCACCGCCACCCTGG + Exonic
985411482 4:189690119-189690141 CCTTTCCATGAACGCCACGCTGG - Intergenic
991407515 5:66315809-66315831 CCTTTTCTCCACAGCCTTGCTGG + Intergenic
993155735 5:84219462-84219484 CCTTTCCTCCACGTCCTCACTGG - Intronic
994722164 5:103392866-103392888 GCTTTCCCCGACCACCTCTCTGG + Intergenic
1002045317 5:176538088-176538110 CTCTTCCTCCACCGCCACGCTGG - Intergenic
1006164874 6:32058244-32058266 CCTTTCCTGGACCGTCCCCCAGG - Intronic
1006676260 6:35765845-35765867 CCTTTCCCACACCGCCTCCCCGG + Intergenic
1015668776 6:135663650-135663672 CCTTTCCTCCACATCCTGGCTGG - Intergenic
1016128887 6:140441418-140441440 CTTTTCCTCCCCCGCCTCCCAGG + Intergenic
1017487925 6:154920084-154920106 CCTGTCCTCGACAGGCACGCTGG - Intronic
1020693288 7:11385866-11385888 CCTTACCTCCACCCCCTCACAGG + Intronic
1022968154 7:35493353-35493375 TCTTTCCTGGAAAGCCTCGCTGG - Intergenic
1024041067 7:45555084-45555106 CCTTTTCTCCACATCCTCGCCGG - Intergenic
1044252052 8:90014618-90014640 CATTTCCTCAACCTCCTCACTGG - Intronic
1045320968 8:101080947-101080969 CCTCTCCCCGACCCCCTCCCGGG + Intergenic
1047363203 8:124188312-124188334 CCTTTTCTCCACAGCCTCACTGG + Intergenic
1048553704 8:135456492-135456514 CCTTCCCTGGACAGCCTCTCAGG - Intergenic
1048898646 8:139017181-139017203 GCTTTCCTCGGCTGCCTGGCTGG + Intergenic
1049396708 8:142404203-142404225 CCCTTCCCCCACCGCCCCGCTGG + Intergenic
1050885250 9:10756512-10756534 CCTTTTCTCCACAGCCTCACTGG - Intergenic
1054821563 9:69526576-69526598 CCTTTTCTCCACAGCCTCACTGG - Intronic
1055358396 9:75461983-75462005 CCTTTCCTGGACTGCATCCCTGG + Intergenic
1061272266 9:129550203-129550225 CCTCTCCCCGCCCGGCTCGCCGG + Intergenic
1061937746 9:133867546-133867568 CCTTTCCAGGACCCCCTGGCAGG + Intronic
1062490780 9:136803889-136803911 TCTTTCCTCCACCTCCTCCCAGG - Intronic
1186425894 X:9464648-9464670 CCTTTCCACGACTGCCTCGAGGG - Intronic
1188605176 X:32020000-32020022 CCTTTCCTTGCCCACCTTGCAGG - Intronic
1188759130 X:34003816-34003838 CCTTTTCTCCATAGCCTCGCCGG - Intergenic
1189008604 X:37021252-37021274 CCTTTTCTCTATCGCCTAGCAGG - Intergenic
1189040119 X:37533772-37533794 CCTTTTCTCTATCGCCTAGCAGG + Intronic
1189377145 X:40474912-40474934 CCTTTCCTTGACCTCCGCCCTGG - Intergenic
1190482816 X:50894355-50894377 CCTTTTCTCCACATCCTCGCTGG - Intergenic
1190912311 X:54784699-54784721 CCTTTTCTCCACATCCTCGCCGG - Intronic
1192434755 X:71136388-71136410 CCTCTCCTCGAGCCACTCGCCGG - Exonic
1198024968 X:132696009-132696031 CCTTTCCTCCACCGACTCAGAGG - Intronic
1198787917 X:140311614-140311636 CCTTTGCTCTACAGCCTCACCGG - Intergenic