ID: 1184766818 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:46576661-46576683 |
| Sequence | GCCTTTCCTCGACCGCCTCG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1184766818_1184766825 | 7 | Left | 1184766818 | 22:46576661-46576683 | CCGCGAGGCGGTCGAGGAAAGGC | No data | ||
| Right | 1184766825 | 22:46576691-46576713 | CCCGGGACGCGGGTTTCCACCGG | No data | ||||
| 1184766818_1184766821 | -4 | Left | 1184766818 | 22:46576661-46576683 | CCGCGAGGCGGTCGAGGAAAGGC | No data | ||
| Right | 1184766821 | 22:46576680-46576702 | AGGCATTTCCACCCGGGACGCGG | No data | ||||
| 1184766818_1184766822 | -3 | Left | 1184766818 | 22:46576661-46576683 | CCGCGAGGCGGTCGAGGAAAGGC | No data | ||
| Right | 1184766822 | 22:46576681-46576703 | GGCATTTCCACCCGGGACGCGGG | No data | ||||
| 1184766818_1184766820 | -10 | Left | 1184766818 | 22:46576661-46576683 | CCGCGAGGCGGTCGAGGAAAGGC | No data | ||
| Right | 1184766820 | 22:46576674-46576696 | GAGGAAAGGCATTTCCACCCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1184766818 | Original CRISPR | GCCTTTCCTCGACCGCCTCG CGG (reversed) | Intronic | ||