ID: 1184766818

View in Genome Browser
Species Human (GRCh38)
Location 22:46576661-46576683
Sequence GCCTTTCCTCGACCGCCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766818_1184766820 -10 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC 0: 1
1: 0
2: 1
3: 2
4: 39
Right 1184766820 22:46576674-46576696 GAGGAAAGGCATTTCCACCCGGG 0: 1
1: 0
2: 3
3: 15
4: 199
1184766818_1184766825 7 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC 0: 1
1: 0
2: 1
3: 2
4: 39
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1184766818_1184766822 -3 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC 0: 1
1: 0
2: 1
3: 2
4: 39
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766818_1184766821 -4 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC 0: 1
1: 0
2: 1
3: 2
4: 39
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766818 Original CRISPR GCCTTTCCTCGACCGCCTCG CGG (reversed) Intronic
900263643 1:1746226-1746248 GCCTCTCCGCGGCCGCCTGGTGG + Intergenic
903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG + Intergenic
906821970 1:48939516-48939538 GCCTTTCCTCCCCCTCCTGGAGG - Intronic
921287615 1:213622999-213623021 GGCTTTCCTGGACTGCCTCTAGG - Intergenic
1065614387 10:27504785-27504807 GCCTTGCCTCGAACCTCTCGGGG + Intronic
1065807727 10:29410047-29410069 GCCTCGCCTCGAGCCCCTCGGGG + Intergenic
1077610964 11:3642796-3642818 GCCTTTCCCCCACCTCCTCTGGG + Intergenic
1078780622 11:14435673-14435695 TCCTTTCCCCAACCGCCTCCTGG - Intergenic
1088443194 11:109894758-109894780 GCCTTTCCTCAAATGCCTGGTGG - Intergenic
1097697190 12:62786322-62786344 TCCTTTCCTCTCCCGCCTCAGGG - Intronic
1105745987 13:23377333-23377355 GCTTTTCCTGGACCACCTCTGGG + Intronic
1105750602 13:23419419-23419441 GCCTCTCCTAGACGGCCTCTAGG - Intronic
1130224052 15:82044802-82044824 GCTGTTCCTCGAGCGCCTCGCGG - Intronic
1133342525 16:5045897-5045919 GCCTTTCCTGGAACACCTCCAGG - Intronic
1151564555 17:74890532-74890554 GCCTTTCCTCCCCAGCTTCGAGG + Intronic
1152124515 17:78438276-78438298 GCTTGTCCTCGAGCGCCTCTGGG - Intronic
1160148205 18:76380931-76380953 GCCTTTGCTCACCCGCCTCTGGG - Intronic
925141547 2:1553292-1553314 GCCTTACCTCGTCCTCCTAGAGG + Intergenic
938258653 2:129879907-129879929 CCCCTTCCTTGACCACCTCGGGG - Intergenic
944165761 2:196718598-196718620 CCCTGTCCTCCACAGCCTCGAGG - Exonic
948479328 2:238240224-238240246 GCCTTCCCTAGACCCCCGCGGGG + Intronic
1170107552 20:12767900-12767922 GACTTTCCCCCACCGCCTCAAGG + Intergenic
1175503978 20:59469152-59469174 GCCTCTCCCCGACTGCCTCCAGG - Intergenic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
1185138405 22:49086844-49086866 GCCTCTCCCCGACGGCCTCCTGG - Intergenic
950722912 3:14897637-14897659 GCCTTTCCTCCAGCTCCTCCAGG - Exonic
968480334 4:830365-830387 CCCTTTCCTCCACAGCCTCTGGG - Intergenic
977497096 4:97790640-97790662 ACCTTTCCTTGATGGCCTCGAGG - Intronic
985604344 5:850429-850451 GCCTTTCCTCGGCCACCTTCGGG - Exonic
997421044 5:133766981-133767003 GCCTTTCCTTGACCATCTCCTGG - Intergenic
998283367 5:140834698-140834720 GCCTTTCCACGATCACCTCCAGG - Exonic
1002211919 5:177604425-177604447 GCCCTTCCGCGAACGCTTCGAGG + Exonic
1014943951 6:127475346-127475368 GACCTTCATCGACCGCCTCGAGG - Exonic
1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG + Intronic
1028583947 7:92434776-92434798 GCTTTTCCTCTACAGCCTCCAGG + Intergenic
1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG + Intronic
1033690050 7:143727676-143727698 GCCTTTTCTCTCCCGCCTTGTGG - Intronic
1033698921 7:143817982-143818004 GCCTTTTCTCTCCCGCCTTGTGG - Intergenic
1041489093 8:58411567-58411589 GCCTTTCCCCGACCCCGTCTGGG + Intronic
1050671048 9:7997262-7997284 GTCCTCCCTCGACTGCCTCGAGG - Intergenic
1186274786 X:7927392-7927414 GACTTTCCTGGGCCGGCTCGCGG - Exonic
1186425896 X:9464649-9464671 GCCTTTCCACGACTGCCTCGAGG - Intronic
1187175049 X:16888693-16888715 GCCTTGCCTCCCCTGCCTCGGGG - Intergenic