ID: 1184766818

View in Genome Browser
Species Human (GRCh38)
Location 22:46576661-46576683
Sequence GCCTTTCCTCGACCGCCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766818_1184766821 -4 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC No data
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG No data
1184766818_1184766822 -3 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766818_1184766820 -10 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC No data
Right 1184766820 22:46576674-46576696 GAGGAAAGGCATTTCCACCCGGG No data
1184766818_1184766825 7 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC No data
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766818 Original CRISPR GCCTTTCCTCGACCGCCTCG CGG (reversed) Intronic