ID: 1184766819

View in Genome Browser
Species Human (GRCh38)
Location 22:46576673-46576695
Sequence CGAGGAAAGGCATTTCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766809_1184766819 14 Left 1184766809 22:46576636-46576658 CCGGCGTGGGGCCGCGTCCGGCG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
1184766815_1184766819 -9 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
1184766806_1184766819 16 Left 1184766806 22:46576634-46576656 CCCCGGCGTGGGGCCGCGTCCGG 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
1184766811_1184766819 3 Left 1184766811 22:46576647-46576669 CCGCGTCCGGCGCCCCGCGAGGC 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
1184766816_1184766819 -10 Left 1184766816 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
1184766805_1184766819 20 Left 1184766805 22:46576630-46576652 CCAGCCCCGGCGTGGGGCCGCGT 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
1184766813_1184766819 -3 Left 1184766813 22:46576653-46576675 CCGGCGCCCCGCGAGGCGGTCGA 0: 1
1: 0
2: 1
3: 7
4: 60
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 118
1184766808_1184766819 15 Left 1184766808 22:46576635-46576657 CCCGGCGTGGGGCCGCGTCCGGC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766819 Original CRISPR CGAGGAAAGGCATTTCCACC CGG Intronic
900983999 1:6062716-6062738 ACAGGAAAGGCACTTCCACAGGG + Intronic
904111136 1:28127320-28127342 CTGGGAAAGGAATTACCACCCGG - Intergenic
907172665 1:52484013-52484035 AGAGGCAAGGCCTTTGCACCTGG - Intronic
917563157 1:176181189-176181211 CTAGGAAAGACATTTTCACTTGG + Intronic
919612428 1:199761625-199761647 GGATCAGAGGCATTTCCACCAGG + Intergenic
922500115 1:226091094-226091116 CAAGGAAGGGCATGTCCTCCAGG + Intergenic
923505105 1:234598945-234598967 CTAGGAATTGCATTTCAACCCGG + Intergenic
924732458 1:246724431-246724453 CGAGCAGAGGCCTTTCCACCTGG + Exonic
1066381600 10:34906609-34906631 CGGGGAAAGGTTTATCCACCAGG - Intergenic
1066622653 10:37374632-37374654 AGAGGAACAGCATTCCCACCAGG - Intronic
1069560582 10:69426621-69426643 CCAGGAAAGGCACTCCCTCCAGG + Intergenic
1069898596 10:71694438-71694460 GGAAGAAAGGCATCACCACCAGG + Intronic
1071445296 10:85740691-85740713 TTATGAAAGGCATTTCCACAGGG - Intronic
1081761022 11:45576510-45576532 CCATGAAAGGGATTTCCACGGGG + Intergenic
1086228812 11:84544138-84544160 GGAGAAATGGCATTTCTACCAGG - Intronic
1095315564 12:40756613-40756635 TTAGGAAAGGCATTTGCACTAGG + Intronic
1096226815 12:49871336-49871358 GGAGGAAAGGCATTAACCCCGGG - Intronic
1097371727 12:58790434-58790456 CCAGTAAAGGCATCTGCACCTGG - Intronic
1098866458 12:75769159-75769181 CATGGAAAGGCATTTCCAATTGG + Intergenic
1100212785 12:92414978-92415000 CCAGGAAAGACATTTCTAGCAGG + Intergenic
1101578055 12:106015971-106015993 CGAGGAAATGCATTTCCTGAGGG + Intergenic
1102374005 12:112406677-112406699 CGTGCAAACGCATTGCCACCAGG + Intronic
1102563829 12:113781620-113781642 AGAGTAAAGTCATTCCCACCAGG + Intergenic
1104932775 12:132348553-132348575 AGAGAAAAGGCCTTTCCTCCTGG + Intergenic
1106548177 13:30748631-30748653 ATAGGAAAGACATTTCCACTGGG + Intronic
1112274590 13:98004661-98004683 GGAGGAAAGACATTTCCTCTGGG + Intronic
1122325433 14:100878679-100878701 CTAGGAAAGCCATTTCCACCTGG - Intergenic
1124499239 15:30212220-30212242 GGAGGAAAAGCACTTCCAGCAGG - Intergenic
1124744340 15:32326450-32326472 GGAGGAAAAGCACTTCCAGCAGG + Intergenic
1126941850 15:53776148-53776170 AGAGGAAAGGAATTTCTTCCTGG - Intergenic
1129277212 15:74454043-74454065 AGAGGAAAACCATTTCCACTGGG - Intronic
1129503043 15:76059001-76059023 CTAGGACAGGCTTCTCCACCGGG + Intronic
1131541739 15:93280423-93280445 GGAGGGAAAGCCTTTCCACCTGG + Intergenic
1133589197 16:7226362-7226384 AGAGGGAAGGAATTTCCAGCAGG + Intronic
1138237785 16:55399797-55399819 CGAGGATACGCATTGCCACGGGG - Intronic
1139970137 16:70769223-70769245 GGCAGAAAGGCATTCCCACCTGG - Intronic
1140336423 16:74109182-74109204 CTGGGAAAGGCATATCAACCTGG + Intergenic
1141579017 16:84984597-84984619 CAAGGAAAGGCATTTCGAAGGGG + Intronic
1141843626 16:86591763-86591785 CAAGGACTGGCTTTTCCACCTGG - Intergenic
1142518873 17:491436-491458 CGAGGACAGGCCTCTCCTCCGGG - Intergenic
1142800649 17:2343278-2343300 CAAGGCAGGGCACTTCCACCTGG + Intronic
1143037049 17:4005347-4005369 CCAGGCCAGGCCTTTCCACCAGG + Exonic
1144785356 17:17828241-17828263 CCAGGAATGCCCTTTCCACCTGG + Intronic
1147253828 17:39169823-39169845 GCAGGAAAGGCATTTCTAGCTGG - Intergenic
1147419695 17:40316423-40316445 CGTGGAAATGCATTTGTACCAGG + Intronic
1148070036 17:44903425-44903447 TGATGAAAGACTTTTCCACCAGG + Exonic
1148665266 17:49370061-49370083 TAAGGAAAGGCATGTTCACCTGG + Intergenic
1149537413 17:57443405-57443427 CGAGGAGAGGCAGTTCCTGCCGG - Intronic
1150218552 17:63483374-63483396 GTAGAAAAGGCATTTCCACCCGG - Intergenic
1157097163 18:44696440-44696462 CGAGAACTTGCATTTCCACCAGG + Intronic
1159734924 18:72083731-72083753 CCAGGAAAGGTATTTCCATACGG - Intergenic
1160071779 18:75635338-75635360 AGAGGAAAGGAGTTTCCACCAGG - Intergenic
1160179379 18:76620542-76620564 CGGGTACATGCATTTCCACCTGG - Intergenic
1160970135 19:1764333-1764355 CCGGGAAACGCATTTCCACTTGG - Intronic
1165045414 19:33101012-33101034 GGATGAAAGGCAATGCCACCAGG - Intronic
1165787912 19:38473454-38473476 GCAGGAAAAGCATCTCCACCAGG - Exonic
1165928240 19:39340889-39340911 TGAGGAAAGGCTGTTTCACCAGG - Intronic
925699572 2:6621838-6621860 CCAGTAAAGCCATTTACACCTGG + Intergenic
927385837 2:22532958-22532980 CCATGAAAGCCAGTTCCACCAGG - Intergenic
931978629 2:67670342-67670364 CAAGGAAGGGCATCTCCACCAGG + Intergenic
936053947 2:109246673-109246695 CGAGCCAGGGCAATTCCACCAGG - Intronic
936093596 2:109515946-109515968 CTAGGGATTGCATTTCCACCTGG + Intergenic
937655460 2:124369819-124369841 CCAGGAAAGGCAGTTCCCTCAGG + Intronic
941649102 2:168074028-168074050 CTAGGAAAGGCCTATCCACATGG + Intronic
942556522 2:177177776-177177798 CGAGGAAGGGCGCATCCACCAGG + Intergenic
1169021466 20:2334171-2334193 CCAGGGGAGGCATTTCCATCTGG + Intronic
1169322952 20:4649802-4649824 TGAGAACAGGCATTACCACCGGG - Intergenic
1171460005 20:25292892-25292914 CCAGGAAAGGCCTTTTCCCCTGG + Intronic
1171492857 20:25533334-25533356 AGAGGAAAGCCATTTCAGCCAGG + Intronic
1176310557 21:5146757-5146779 GGAGCAAAGACATGTCCACCTGG - Exonic
1176987409 21:15454041-15454063 TGAGGAAATTCATTACCACCAGG - Intergenic
1177842438 21:26249462-26249484 CAAGGAAAATAATTTCCACCTGG - Intergenic
1179101671 21:38359964-38359986 TGAGAAGAGGCATTTCCAACAGG + Intergenic
1179846498 21:44115278-44115300 GGAGCAAAGACATGTCCACCTGG + Exonic
1179980030 21:44891027-44891049 TGAGGAAGGGCACTGCCACCAGG + Intronic
1180737811 22:18031729-18031751 AGAGGAAACCCATTACCACCTGG - Intergenic
1181601999 22:23958338-23958360 CGAGGAAGGGCCTGTCCCCCAGG + Exonic
1181606510 22:23982969-23982991 CGAGGAAGGGCCTGTCCCCCAGG - Exonic
1182791900 22:32960145-32960167 CTAGGAAGGGCATTCCCTCCAGG - Intronic
1183602979 22:38850749-38850771 CTAGGAAAGGCATTTTCAGGTGG + Intergenic
1184766819 22:46576673-46576695 CGAGGAAAGGCATTTCCACCCGG + Intronic
951799234 3:26576525-26576547 GTTGGAAAGGCATTTCCTCCTGG + Intergenic
956761110 3:72446495-72446517 TGAGGAAAGGCACCTCCACCAGG - Exonic
961524120 3:127485798-127485820 CGAGGAAAGGCCGTCTCACCTGG - Intergenic
962475352 3:135750648-135750670 TGAGGACAGGCATGTCGACCTGG - Intergenic
963815050 3:149820395-149820417 AGAGGGAATGAATTTCCACCGGG + Intronic
963973792 3:151458618-151458640 CGAGGACAGGCCTTGCCCCCAGG + Exonic
966259669 3:177960852-177960874 AGAGGCCAGGCATTTCCACAGGG - Intergenic
968587169 4:1424781-1424803 CGATAAAAGCCATTTCCACTGGG + Intergenic
973939831 4:55895850-55895872 GGAGGATAGGCATTTCCATATGG - Intronic
975404259 4:73970879-73970901 TGAGGAAATTCATTACCACCAGG + Intergenic
976577680 4:86693653-86693675 CGAGGAAAAGGATTACCAACAGG + Exonic
981471444 4:145139673-145139695 CCAGCAAGGGCATTTCCACTAGG + Intronic
982366704 4:154586617-154586639 CGAGTAATCTCATTTCCACCAGG + Exonic
983774713 4:171593229-171593251 TGAGGGAATTCATTTCCACCAGG - Intergenic
985058048 4:186052267-186052289 CGAGCACACGCATATCCACCAGG + Intergenic
986307010 5:6523378-6523400 CCAGAGAAAGCATTTCCACCAGG + Intergenic
986645905 5:9915712-9915734 TGAGGACAGGCATTCTCACCAGG - Intergenic
992052224 5:72951720-72951742 AGAAGAAAGGCACATCCACCTGG + Intergenic
993346600 5:86791401-86791423 TGAAGAAAGGAATTTCCACCAGG - Intergenic
998137196 5:139680362-139680384 AGAGTGAAGACATTTCCACCTGG + Exonic
999095914 5:148978253-148978275 CAAGGAAAGGCACCTCCACCAGG + Intronic
999735573 5:154510608-154510630 CTAGGCAAGGCATTTCCCCAGGG - Intergenic
1000151339 5:158504196-158504218 TGAGGAAAAGCAATTCCACTTGG + Intergenic
1001700942 5:173706046-173706068 AGAGAAAAGAGATTTCCACCTGG - Intergenic
1003168351 6:3700826-3700848 TGAAGAAAGGCATTAGCACCTGG - Intergenic
1010037969 6:71347742-71347764 AATGGAGAGGCATTTCCACCTGG + Intergenic
1012510468 6:99995314-99995336 CTAGAAAAGGCTTTTCCACAAGG - Intergenic
1013703512 6:112803274-112803296 TGAGGAAAGACATATCCACAAGG + Intergenic
1015881048 6:137870065-137870087 CAAGGAAAGAAGTTTCCACCAGG - Intronic
1021871363 7:25009452-25009474 CAAGGAAAGGCAGTTACACAAGG + Intergenic
1021985593 7:26095345-26095367 AGATGAAAGGCATTTGAACCAGG + Intergenic
1023990084 7:45123659-45123681 CCAGGAAAGGCCTCTCCACTAGG - Intergenic
1028349297 7:89824932-89824954 CGTGGAAAGACATTTCCCCGGGG + Intergenic
1033791763 7:144798728-144798750 TGAGGAAATCCATCTCCACCAGG + Intronic
1035596442 8:861798-861820 CCAGCAAACACATTTCCACCGGG - Intergenic
1038163658 8:25064135-25064157 AGCTGAAAGGCATTTCCCCCTGG + Intergenic
1038980954 8:32759128-32759150 CCAGGACAGGATTTTCCACCTGG + Intronic
1046010938 8:108546306-108546328 CAAGGAAAGGGATTTACACAAGG + Intergenic
1048575745 8:135688688-135688710 GGAGGAATGGCCTTTCCACCAGG - Intergenic
1049762531 8:144337701-144337723 CGAGGAAAGGGTTATCCGCCTGG - Intergenic
1061129639 9:128701748-128701770 GGAGAAAAGCCATTTACACCTGG - Intergenic
1061146013 9:128799008-128799030 CGATCAAAGTCATTTCCAGCTGG - Intronic
1061774077 9:132948950-132948972 CGAGGAAGAGCCTTCCCACCTGG + Intronic
1062156901 9:135054859-135054881 AGAGTAAAGGCATTTCCAGTTGG + Intergenic
1189334808 X:40164649-40164671 AGGGGCAAAGCATTTCCACCAGG + Intronic
1190918374 X:54826710-54826732 AGAGGAAAGGCAGTTCCAGAAGG + Intergenic
1192951077 X:76016786-76016808 CGATGAAAGGCCTATCCAACAGG + Intergenic