ID: 1184766821

View in Genome Browser
Species Human (GRCh38)
Location 22:46576680-46576702
Sequence AGGCATTTCCACCCGGGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 77}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766816_1184766821 -3 Left 1184766816 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77
1184766806_1184766821 23 Left 1184766806 22:46576634-46576656 CCCCGGCGTGGGGCCGCGTCCGG 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77
1184766811_1184766821 10 Left 1184766811 22:46576647-46576669 CCGCGTCCGGCGCCCCGCGAGGC 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77
1184766813_1184766821 4 Left 1184766813 22:46576653-46576675 CCGGCGCCCCGCGAGGCGGTCGA 0: 1
1: 0
2: 1
3: 7
4: 60
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77
1184766805_1184766821 27 Left 1184766805 22:46576630-46576652 CCAGCCCCGGCGTGGGGCCGCGT 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77
1184766809_1184766821 21 Left 1184766809 22:46576636-46576658 CCGGCGTGGGGCCGCGTCCGGCG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77
1184766815_1184766821 -2 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77
1184766818_1184766821 -4 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC 0: 1
1: 0
2: 1
3: 2
4: 39
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77
1184766808_1184766821 22 Left 1184766808 22:46576635-46576657 CCCGGCGTGGGGCCGCGTCCGGC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG 0: 1
1: 0
2: 2
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766821 Original CRISPR AGGCATTTCCACCCGGGACG CGG Intronic
903549559 1:24148540-24148562 ATGCATTTCCAGCCAGGATGGGG + Intergenic
914349915 1:146831862-146831884 AGGCATTTGAACCCAGGAGGTGG + Intergenic
918098075 1:181350666-181350688 AGGCATTTCCACCCAGACTGGGG + Intergenic
919612429 1:199761632-199761654 AGGCATTTCCACCAGGCACGTGG + Intergenic
1067692072 10:48508434-48508456 AGCCTTTCCCACCCGGGAGGGGG + Intronic
1067984201 10:51123597-51123619 AATCACTTCCACCCGGGAGGTGG + Intronic
1072680164 10:97499973-97499995 TGGCATTTCGCCCCGGGAAGAGG + Intronic
1077245280 11:1533951-1533973 AGTCACTTGAACCCGGGACGTGG - Intergenic
1078226505 11:9396307-9396329 AGTCATTTCAACCTGGGAGGCGG + Intronic
1081849708 11:46266526-46266548 AATCACTTCCACCCGGGAGGTGG - Intergenic
1084571811 11:69964391-69964413 TGGCATTTGCACCCTGGATGGGG + Intergenic
1084749153 11:71192625-71192647 AGGCTTTTCCACCCAGGGTGGGG - Intronic
1089274628 11:117326313-117326335 AGGCACTTAAACCCGGGAGGTGG - Intronic
1092246445 12:6866947-6866969 AGGCCTTGCCAGCCGGGGCGAGG + Intergenic
1094845461 12:34359503-34359525 AGGCATTTTCACCCGTGGCAGGG + Intergenic
1100444863 12:94650696-94650718 AGACATTGCCTCCCGGGTCGGGG - Intergenic
1102573442 12:113841508-113841530 AAGCACTTGAACCCGGGACGCGG - Intronic
1102580178 12:113881430-113881452 AGGCATTCCCACCTGGGTCCTGG - Intronic
1102700781 12:114837602-114837624 AATCATTTCAACCCGGGAGGTGG - Intergenic
1103872020 12:124099026-124099048 AGGCATGTCCACCCTGGAGGCGG - Intronic
1106576212 13:30978160-30978182 AAGCAATTGCACCCGGGAAGCGG + Intergenic
1107399676 13:40057198-40057220 ATGCATTTCCAGCAGGGATGGGG - Intergenic
1109498070 13:63200986-63201008 AATCATTTGAACCCGGGACGTGG - Intergenic
1117727536 14:58689390-58689412 AAACATTTGCACCCGGGAGGAGG + Intergenic
1118719071 14:68580863-68580885 GGCCATTTCCACACGGGGCGGGG + Intronic
1121407131 14:93725945-93725967 AGGCATTTCCACCCTGGTCCAGG + Intronic
1122644778 14:103187077-103187099 AGTCATTTCGATCAGGGACGGGG - Intergenic
1132467986 16:86439-86461 AGGCATCTCCACGCTGGAGGGGG - Exonic
1134483625 16:14639392-14639414 AATCATTTGCACCCAGGACGTGG - Intronic
1134587661 16:15426022-15426044 TGGCAGTTCCTCCCGGGAGGTGG - Intronic
1136553887 16:30996869-30996891 AGGCATTTCCTCTCTGGAGGGGG - Intronic
1139984122 16:70883669-70883691 AGGCATTTGAACCCAGGAGGTGG - Intronic
1145819944 17:27824492-27824514 CGGCATTTCCACCCAGGGTGTGG - Intronic
1145820482 17:27830038-27830060 TGGCATTTCCACCTGGAATGTGG - Intronic
1147666174 17:42149963-42149985 AGGCAGTTCAACCTGGGAGGTGG - Intronic
1152601083 17:81262464-81262486 AGAGAAATCCACCCGGGACGAGG - Intronic
1152902162 17:82948491-82948513 TGGCGTTTGCACACGGGACGTGG + Intronic
1155155362 18:23152886-23152908 AGTCATTTGAACCCGGGAGGTGG - Intronic
1166802345 19:45466008-45466030 AAGCACTTCAACCCGGGAGGCGG + Intronic
926271442 2:11369675-11369697 AGGCATTTCCATCAGGGAAATGG + Intergenic
928033913 2:27803953-27803975 AGGCACTTGAACCCGGGAGGTGG + Intronic
932496624 2:72148757-72148779 AGGCAGTCCGTCCCGGGACGCGG + Intergenic
935833782 2:107027483-107027505 AGGCCTTTCCACCCTGAAAGAGG + Intergenic
937293692 2:120797395-120797417 AGGCCTTTTTACCCGGGTCGGGG - Exonic
1169893685 20:10479634-10479656 ATGCAATTCGAGCCGGGACGTGG - Intronic
1172583236 20:36064754-36064776 AGGCAGGCCCAGCCGGGACGAGG + Intergenic
1173537823 20:43829462-43829484 AGGCATCTTCACCCTGGAGGTGG + Intergenic
1179962400 21:44776093-44776115 CGGCATTTCCACCAGTGAAGTGG + Intronic
1181089973 22:20465900-20465922 AATCATTTCAACCCGGGAGGGGG - Intronic
1184766821 22:46576680-46576702 AGGCATTTCCACCCGGGACGCGG + Intronic
959060927 3:101615571-101615593 AAGCACTTGCACCCGGGAGGCGG + Intergenic
971392523 4:26199346-26199368 AGGCACTTGAACCCGGGAGGTGG + Intronic
973206887 4:47570714-47570736 AGTCACTTGCACCCGGGAAGCGG + Intronic
978351566 4:107825195-107825217 AGGCACTTGCTCCCGGGAAGGGG - Intronic
984032121 4:174617198-174617220 AAGCATTTGAACCCGGGAGGTGG + Intergenic
988469726 5:31526883-31526905 ATGTCGTTCCACCCGGGACGAGG - Exonic
993346598 5:86791394-86791416 AGGAATTTCCACCAGGGAAATGG - Intergenic
997460315 5:134047375-134047397 AGGCATCTCCACACAGGAGGTGG + Intergenic
999775924 5:154813193-154813215 AAGCATTTCCACCCTTGAGGAGG + Intronic
1001033888 5:168282977-168282999 AATCATTTCAACCCGGGAGGTGG - Intergenic
1001487007 5:172127079-172127101 AGTCATTTGAACCCGGGAGGCGG + Intronic
1002306273 5:178285861-178285883 AGGAATTTCCACTCAGGACTGGG + Intronic
1003868454 6:10383519-10383541 GGGAATATCCACCCGCGACGTGG - Intergenic
1013102825 6:107001157-107001179 AACCATTTCAACCCGGGAGGTGG + Intergenic
1014664759 6:124223124-124223146 AATCATTTCGACCCGGGAGGTGG + Intronic
1016500668 6:144717720-144717742 AGTCATTTGGACCCGGGAGGCGG - Intronic
1019487991 7:1298252-1298274 AGGCAGTGCCAGCCGGGCCGAGG - Intergenic
1024045401 7:45582431-45582453 AGGCATGTCCACATGGGACTTGG + Intronic
1027175458 7:75900169-75900191 AAGCATTTCCACCCTGCAGGCGG - Intronic
1033168918 7:139066288-139066310 AGGCATTTCCACTAGGGAAGAGG - Intronic
1033912481 7:146281706-146281728 AGTCACTTGCACCCGGGAGGTGG + Intronic
1034102120 7:148458923-148458945 AATCATTTGCACCCGGGAGGTGG - Intergenic
1037192385 8:16142242-16142264 AATCATTTCAACCCGGGAGGTGG + Intronic
1042509352 8:69594961-69594983 AGGCATGTCCACCAGGCACTGGG - Intronic
1043670705 8:82881092-82881114 AGGCAGCTCCACCTGCGACGGGG + Intergenic
1045503729 8:102763143-102763165 AGGCATTTCCACCCAGGAGGGGG - Intergenic
1057442303 9:95091276-95091298 AGGCAGTCCCACCCGGCAAGGGG + Intergenic
1057560484 9:96124493-96124515 AGGCATTCCCACCTGGGCTGGGG - Intergenic
1059100869 9:111470395-111470417 AGTCACTTGAACCCGGGACGGGG - Intronic
1185836116 X:3346825-3346847 AGGCATGCCCACCCGGGCCCAGG - Intergenic
1188017183 X:25118223-25118245 AGGCAGTGCCATCCGGGACACGG - Intergenic
1191075605 X:56450067-56450089 AGGCATTACCACTCAGGACATGG - Intergenic
1200224869 X:154411827-154411849 AGGCATCCCCACCCGGCCCGCGG - Exonic