ID: 1184766822

View in Genome Browser
Species Human (GRCh38)
Location 22:46576681-46576703
Sequence GGCATTTCCACCCGGGACGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766813_1184766822 5 Left 1184766813 22:46576653-46576675 CCGGCGCCCCGCGAGGCGGTCGA No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766805_1184766822 28 Left 1184766805 22:46576630-46576652 CCAGCCCCGGCGTGGGGCCGCGT No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766815_1184766822 -1 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766806_1184766822 24 Left 1184766806 22:46576634-46576656 CCCCGGCGTGGGGCCGCGTCCGG No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766809_1184766822 22 Left 1184766809 22:46576636-46576658 CCGGCGTGGGGCCGCGTCCGGCG No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766808_1184766822 23 Left 1184766808 22:46576635-46576657 CCCGGCGTGGGGCCGCGTCCGGC No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766811_1184766822 11 Left 1184766811 22:46576647-46576669 CCGCGTCCGGCGCCCCGCGAGGC No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766818_1184766822 -3 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data
1184766816_1184766822 -2 Left 1184766816 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG No data
Right 1184766822 22:46576681-46576703 GGCATTTCCACCCGGGACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766822 Original CRISPR GGCATTTCCACCCGGGACGC GGG Intronic