ID: 1184766825

View in Genome Browser
Species Human (GRCh38)
Location 22:46576691-46576713
Sequence CCCGGGACGCGGGTTTCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766813_1184766825 15 Left 1184766813 22:46576653-46576675 CCGGCGCCCCGCGAGGCGGTCGA 0: 1
1: 0
2: 1
3: 7
4: 60
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1184766811_1184766825 21 Left 1184766811 22:46576647-46576669 CCGCGTCCGGCGCCCCGCGAGGC 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1184766815_1184766825 9 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1184766816_1184766825 8 Left 1184766816 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1184766818_1184766825 7 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC 0: 1
1: 0
2: 1
3: 2
4: 39
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766825 Original CRISPR CCCGGGACGCGGGTTTCCAC CGG Intronic
911161303 1:94685317-94685339 CCTGGGACACTGCTTTCCACTGG - Intergenic
920560546 1:206935544-206935566 GCCGGGACGCCGGCTTCTACTGG - Exonic
922739623 1:228007789-228007811 CCGGGCACGGGGGTTTCCAGGGG + Intronic
1073057124 10:100710049-100710071 CGCGGGGCGCGGGTTTCTCCCGG - Intergenic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1080034983 11:27700784-27700806 CGCGGGACGCGGGGTTCCCCGGG - Intronic
1083407951 11:62471776-62471798 GCCGGGATGCGGGTACCCACAGG + Intronic
1083618075 11:64036126-64036148 CCGGGGAGGCGGGTCTCCTCGGG - Intronic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1084741607 11:71143434-71143456 CCCGATGCGCGGGTTCCCACGGG + Intronic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1088583193 11:111334895-111334917 CCCGGGGACTGGGTTTCCACTGG - Intergenic
1093164376 12:15788921-15788943 CCCTGGGCGCGGGTCTGCACGGG + Intronic
1107995084 13:45851383-45851405 CCCGAGACCCGGGTTTGCAAAGG + Intronic
1112344432 13:98577483-98577505 CCCGGGACGCGTTTTCCCAGAGG - Intronic
1128724739 15:69980049-69980071 TCCAGGACGCAGGTTTCCCCTGG + Intergenic
1145235077 17:21202492-21202514 TCCAGGACCGGGGTTTCCACTGG - Intronic
1147161846 17:38573027-38573049 CCCGGGACTCGGGTTGCAGCAGG + Intronic
1150289761 17:63974330-63974352 CCAGGGAGTCGTGTTTCCACGGG + Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152831704 17:82501320-82501342 CCTGGGACCCAGGTCTCCACTGG - Intergenic
1154337913 18:13480877-13480899 GCCAGGACGTGGGTTTTCACTGG - Intronic
1160571011 18:79817870-79817892 CCCGAGACCTGGGCTTCCACGGG - Intergenic
1161772161 19:6236735-6236757 CCCAGGAGGCTGGTTTCCAGGGG - Intronic
930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG + Intronic
933751108 2:85602540-85602562 CCCGGGACGCGAGAGTCCCCAGG + Intronic
938489287 2:131753606-131753628 CCAGGGACGCCAGGTTCCACTGG - Intronic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
1168760720 20:347856-347878 CCCGGGACGAGGGTTGCCATGGG - Intronic
1172184087 20:33020606-33020628 CCCAGGACGGGGGTTTCTAGAGG - Intronic
1175924938 20:62466976-62466998 CCTGGGAGGCGGGTGTCCAGGGG - Intronic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
978385549 4:108172751-108172773 TCCGGGGCGCGGCTGTCCACAGG + Intergenic
985348686 4:189035161-189035183 CGGAAGACGCGGGTTTCCACAGG + Intergenic
990447229 5:55904230-55904252 CCAGGGAGGGGGGTTCCCACTGG + Intronic
1005955419 6:30660049-30660071 CCCCGGACGCAGGTTTCCTGTGG - Exonic
1029524659 7:101087581-101087603 CCCGGCACGCAGGTCTCCACAGG - Exonic
1036556416 8:9863843-9863865 CCCAGGACGCAGATTTCTACAGG - Intergenic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1038417463 8:27407629-27407651 CCCGGGAGGTGGGTCTCCCCAGG + Intronic
1057197022 9:93120984-93121006 CCCGGGAGCCAGGTTTCCACTGG + Intergenic
1060524936 9:124315199-124315221 CCCAGGAAGCGGGTTTCCCTGGG - Intronic
1061149101 9:128818847-128818869 CCCGGGCCGCGGGGTCCCCCGGG - Exonic
1061942839 9:133892245-133892267 CCCGGGACACCTGTTCCCACTGG - Intronic
1062426683 9:136509224-136509246 GCCGGGCCCCGGGTTCCCACTGG - Intronic
1203738770 Un_GL000216v2:161214-161236 CCCCGGCCCCGGGCTTCCACTGG - Intergenic
1199699333 X:150364436-150364458 CCCGAGGCGCGTGTTTGCACAGG - Intronic