ID: 1184766825

View in Genome Browser
Species Human (GRCh38)
Location 22:46576691-46576713
Sequence CCCGGGACGCGGGTTTCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766815_1184766825 9 Left 1184766815 22:46576659-46576681 CCCCGCGAGGCGGTCGAGGAAAG No data
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG No data
1184766811_1184766825 21 Left 1184766811 22:46576647-46576669 CCGCGTCCGGCGCCCCGCGAGGC No data
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG No data
1184766813_1184766825 15 Left 1184766813 22:46576653-46576675 CCGGCGCCCCGCGAGGCGGTCGA No data
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG No data
1184766816_1184766825 8 Left 1184766816 22:46576660-46576682 CCCGCGAGGCGGTCGAGGAAAGG No data
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG No data
1184766818_1184766825 7 Left 1184766818 22:46576661-46576683 CCGCGAGGCGGTCGAGGAAAGGC No data
Right 1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766825 Original CRISPR CCCGGGACGCGGGTTTCCAC CGG Intronic