ID: 1184766892

View in Genome Browser
Species Human (GRCh38)
Location 22:46576964-46576986
Sequence GCCCCCGCGGACCCCCGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766884_1184766892 13 Left 1184766884 22:46576928-46576950 CCGAGCTGGCGCACGCGGACCCG No data
Right 1184766892 22:46576964-46576986 GCCCCCGCGGACCCCCGAGCCGG No data
1184766882_1184766892 21 Left 1184766882 22:46576920-46576942 CCGCGTGACCGAGCTGGCGCACG No data
Right 1184766892 22:46576964-46576986 GCCCCCGCGGACCCCCGAGCCGG No data
1184766889_1184766892 -7 Left 1184766889 22:46576948-46576970 CCGCCAGGGCAGGCGCGCCCCCG No data
Right 1184766892 22:46576964-46576986 GCCCCCGCGGACCCCCGAGCCGG No data
1184766888_1184766892 -6 Left 1184766888 22:46576947-46576969 CCCGCCAGGGCAGGCGCGCCCCC No data
Right 1184766892 22:46576964-46576986 GCCCCCGCGGACCCCCGAGCCGG No data
1184766890_1184766892 -10 Left 1184766890 22:46576951-46576973 CCAGGGCAGGCGCGCCCCCGCGG No data
Right 1184766892 22:46576964-46576986 GCCCCCGCGGACCCCCGAGCCGG No data
1184766881_1184766892 26 Left 1184766881 22:46576915-46576937 CCGCGCCGCGTGACCGAGCTGGC No data
Right 1184766892 22:46576964-46576986 GCCCCCGCGGACCCCCGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766892 Original CRISPR GCCCCCGCGGACCCCCGAGC CGG Intronic