ID: 1184766986

View in Genome Browser
Species Human (GRCh38)
Location 22:46577211-46577233
Sequence GCAGGCGTAGCGCGGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 138}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184766973_1184766986 6 Left 1184766973 22:46577182-46577204 CCCGGCGCCGCTGGGCTCCCGGG 0: 1
1: 0
2: 0
3: 30
4: 372
Right 1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 138
1184766968_1184766986 14 Left 1184766968 22:46577174-46577196 CCCGGCTCCCCGGCGCCGCTGGG 0: 1
1: 0
2: 4
3: 32
4: 344
Right 1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 138
1184766964_1184766986 23 Left 1184766964 22:46577165-46577187 CCGCCTCCTCCCGGCTCCCCGGC 0: 1
1: 1
2: 18
3: 150
4: 1307
Right 1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 138
1184766978_1184766986 -1 Left 1184766978 22:46577189-46577211 CCGCTGGGCTCCCGGGCGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 249
Right 1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 138
1184766966_1184766986 17 Left 1184766966 22:46577171-46577193 CCTCCCGGCTCCCCGGCGCCGCT 0: 1
1: 1
2: 2
3: 50
4: 399
Right 1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 138
1184766975_1184766986 5 Left 1184766975 22:46577183-46577205 CCGGCGCCGCTGGGCTCCCGGGC 0: 1
1: 0
2: 3
3: 46
4: 319
Right 1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 138
1184766971_1184766986 7 Left 1184766971 22:46577181-46577203 CCCCGGCGCCGCTGGGCTCCCGG 0: 1
1: 0
2: 4
3: 35
4: 301
Right 1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 138
1184766965_1184766986 20 Left 1184766965 22:46577168-46577190 CCTCCTCCCGGCTCCCCGGCGCC 0: 1
1: 0
2: 19
3: 102
4: 942
Right 1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 138
1184766970_1184766986 13 Left 1184766970 22:46577175-46577197 CCGGCTCCCCGGCGCCGCTGGGC 0: 1
1: 1
2: 3
3: 35
4: 359
Right 1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184766986 Original CRISPR GCAGGCGTAGCGCGGCCGGG CGG Intronic
900113738 1:1020072-1020094 GGCGGCGGAGCGCGGGCGGGCGG - Intergenic
902053726 1:13583734-13583756 GCGGGCCTAGCGCGCCCGGACGG + Exonic
904460161 1:30672210-30672232 GCAGGCTTAGCGGGGCCAGGTGG - Intergenic
912435107 1:109656263-109656285 GCGGGCGCAGCGGGGCCGAGGGG + Exonic
918407568 1:184225954-184225976 GCAGGAGGAGCGGGGCCTGGAGG - Intergenic
920260559 1:204685355-204685377 GCGAGCGGAGCGCGGCCGCGCGG - Intronic
920290840 1:204922017-204922039 GCAGGGGTGGCGCGGGCAGGGGG + Intronic
922695374 1:227728575-227728597 GGAGGCGGGGCGGGGCCGGGAGG - Intronic
922748240 1:228059170-228059192 GTAGGTGTAGCGCGGCCGCAGGG - Exonic
923429131 1:233904575-233904597 CCAGGCGGAGCGCGGGCGCGAGG + Intergenic
1069885042 10:71618355-71618377 GCGGGCGTAGGGGGGCAGGGCGG + Intronic
1070152282 10:73812016-73812038 GCAGGCGACGCGGGGCGGGGAGG - Intergenic
1072670611 10:97426415-97426437 GGAGGCGAAGCGCGGCGGGCAGG + Exonic
1073403457 10:103277126-103277148 GCAGGCAGGGCGCGGCGGGGCGG - Intergenic
1075054476 10:119207422-119207444 CCCGGCGCCGCGCGGCCGGGAGG + Intergenic
1075144616 10:119872629-119872651 GCGGGCCGAGCGCGGCCGGGCGG + Exonic
1077339788 11:2021186-2021208 ACAGACCTGGCGCGGCCGGGCGG + Intergenic
1077419913 11:2445215-2445237 GCTGGCGGAGGGCGGCCCGGCGG + Exonic
1077575319 11:3378814-3378836 GCGGGCGAAGAGCTGCCGGGGGG + Intronic
1079090517 11:17476978-17477000 GCAAGCGTAGCAGGGCCGGTCGG - Intergenic
1083176068 11:60951227-60951249 GCAGGCTGAGCGCGACCGCGCGG + Exonic
1083747695 11:64744804-64744826 GCAGCCGCAGCGAGGCCGGCGGG - Intronic
1083879487 11:65540957-65540979 GCAGGGGCAGGGCGGCCGTGGGG + Intronic
1083999627 11:66289083-66289105 GGACGTGTCGCGCGGCCGGGTGG - Exonic
1085515027 11:77106831-77106853 GCAGGCGCAGGGCGGAGGGGTGG + Intronic
1090238633 11:125166557-125166579 GCGGGCGCAGCGCGGCGGGGCGG + Intronic
1091268273 11:134287732-134287754 GCAGGCGTGGCGCTGCCCTGTGG + Intronic
1202822773 11_KI270721v1_random:76375-76397 ACAGACCTGGCGCGGCCGGGCGG + Intergenic
1096710473 12:53452152-53452174 GCGGGCGGAGGGCGGGCGGGCGG - Exonic
1100337080 12:93641457-93641479 GGAGGCGAAGCGCGGCGGGCAGG - Intergenic
1101361383 12:104030886-104030908 GGAGGCGAAGCGCGGCGGGCAGG + Intronic
1102003583 12:109573881-109573903 GCCGGGGTCGGGCGGCCGGGCGG + Intronic
1118854753 14:69612031-69612053 GCTGGCGTGGCGCGGCCAGCCGG + Intronic
1119290578 14:73491846-73491868 GCGGGCAGCGCGCGGCCGGGTGG - Exonic
1119562882 14:75605031-75605053 GCAGGGGTAGGGGGACCGGGCGG + Intronic
1121994632 14:98592813-98592835 GCATGCGCAGCTCGGCCTGGGGG + Intergenic
1122131272 14:99605367-99605389 GCAGGCGGGGCGGGGCGGGGCGG + Intergenic
1122366201 14:101196174-101196196 GCAGGCGCAGCCCTGCCAGGGGG - Intergenic
1122750321 14:103928296-103928318 GCAGGCCTAGCGCGGCGGGGCGG + Intergenic
1125674220 15:41493949-41493971 ACGGGCATGGCGCGGCCGGGGGG + Exonic
1126557381 15:50004239-50004261 GAAGGCCCAGCGGGGCCGGGAGG + Intronic
1128423996 15:67521269-67521291 GCAGGCGGAGCGCGACCTCGTGG - Exonic
1128582224 15:68818335-68818357 CCAGGGGCAGCGCGGCGGGGAGG + Intronic
1129173424 15:73821987-73822009 GCAGTGGTAGGGCTGCCGGGAGG - Intergenic
1132498216 16:273729-273751 GCAGGCGGGGCGGGGCAGGGCGG + Intronic
1132574025 16:656548-656570 GCAGGGGCAGCACGGCAGGGAGG + Intronic
1132747324 16:1442480-1442502 GCAGGAGGAGCAGGGCCGGGAGG - Exonic
1132831241 16:1929528-1929550 GCGGGGGTGGCGCGGCCGGTGGG - Intergenic
1132931353 16:2460586-2460608 GCAGCCGTCGCACGGCCAGGAGG - Intronic
1132978315 16:2721285-2721307 GCGGGCGGGGCGGGGCCGGGCGG + Intergenic
1135588616 16:23689981-23690003 GCGGGCGTAGCGGAGCCGGCTGG - Exonic
1138802427 16:60049514-60049536 GCAGGGGTTGCGGGGGCGGGGGG - Intergenic
1139684295 16:68590717-68590739 GCAGGCTTCCTGCGGCCGGGCGG - Intergenic
1141957641 16:87383374-87383396 GCGGGGGTGGCGGGGCCGGGAGG - Intronic
1142203074 16:88770322-88770344 GCAGGCGGGGCCCGGCTGGGGGG - Intronic
1142210810 16:88807667-88807689 GCAGGTGTGGAGGGGCCGGGCGG - Intronic
1142859041 17:2749756-2749778 GCCGGCGGCGCGCGGTCGGGGGG + Intergenic
1143140637 17:4740056-4740078 GGAGGAGTGGGGCGGCCGGGAGG + Intronic
1144586802 17:16492115-16492137 GCGGGCGTCGCGGGGGCGGGCGG + Intronic
1146100419 17:29975347-29975369 GCAGGAGAATCGCTGCCGGGAGG - Intronic
1147996790 17:44363923-44363945 GCGGGCGGAGCGGGGCCGGGAGG - Intergenic
1152729181 17:81961415-81961437 GGGGGGGCAGCGCGGCCGGGCGG + Intronic
1152782096 17:82231141-82231163 GCTGGCGGGGCGGGGCCGGGCGG + Intronic
1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG + Intronic
1155053583 18:22167638-22167660 GCGGGGGTTGAGCGGCCGGGCGG + Intergenic
1155465777 18:26133811-26133833 GCAGCCGAAGCGCGGGCGCGGGG + Intergenic
1155954101 18:31942851-31942873 GCCGGCCTGGCCCGGCCGGGCGG + Exonic
1157464449 18:47931273-47931295 CGAGGCGGGGCGCGGCCGGGCGG + Intergenic
1160873153 19:1286057-1286079 GCGGGCGGAGGGCGGGCGGGAGG - Intergenic
1161504867 19:4638576-4638598 GCTGGCGCTGCGCAGCCGGGAGG + Intergenic
1163113880 19:15177983-15178005 GCAGGCGCAGCGCGGCCCGCGGG + Exonic
1166347762 19:42177003-42177025 GCAAGCGCGGCGCGGGCGGGCGG + Intronic
1167162763 19:47778709-47778731 GCAGACCTAGCGCGTCCAGGTGG + Exonic
1167509912 19:49890603-49890625 GCAGGCGGGGCGGGGCGGGGTGG + Intronic
924987772 2:287763-287785 GGCGGCGGGGCGCGGCCGGGGGG - Exonic
925181138 2:1817638-1817660 GCAGGCCCAGCGCGGCCCTGGGG + Intronic
929777711 2:44939047-44939069 GCAGGCGGGGTGCGGCAGGGCGG + Intergenic
936074883 2:109395412-109395434 GCAGGCGAACCGCTGCCGAGGGG - Intronic
938034873 2:128027635-128027657 GCCGGGGGAGCGCGGGCGGGCGG - Intronic
938297213 2:130185739-130185761 GCAGGCATAGAGGGGCCAGGAGG + Intronic
938459566 2:131488936-131488958 GCAGGCATAGAGGGGCCAGGAGG - Intronic
942241063 2:173964556-173964578 GCAGGCACAGCGCGGGGGGGTGG + Intronic
944264029 2:197705244-197705266 GCGGGCGGGGCGGGGCCGGGCGG + Intronic
945033705 2:205686561-205686583 GCAGGCGTCCAGCGGCTGGGTGG + Intronic
946921251 2:224584639-224584661 GGAGGCGTGGGGCGGCCGAGGGG + Intronic
948492068 2:238320320-238320342 GCAGGCGGGGCGCGGCGGGGCGG - Intergenic
948793395 2:240390548-240390570 GCAGGCATAGAGAGGCCGGTAGG + Intergenic
948805740 2:240452927-240452949 GGCGGCGGAGCGGGGCCGGGCGG - Intronic
1169164031 20:3407437-3407459 GCAGCCGAGGGGCGGCCGGGCGG - Intronic
1172428603 20:34872827-34872849 GCAGGCGCTGCGCTGCTGGGGGG - Exonic
1175340930 20:58228586-58228608 GCGGGCGGAGCGCGGGCGGCGGG - Exonic
1175847288 20:62065515-62065537 GCAGGTAGAGCGCGGCCGGGGGG - Exonic
1175997153 20:62817011-62817033 GCGGGCGGCGCGCGGGCGGGCGG - Intronic
1176002673 20:62840033-62840055 GCGGGCATGGTGCGGCCGGGAGG - Intronic
1180959678 22:19756923-19756945 GGCGGCGGAGCGCGGCGGGGCGG + Intronic
1182578638 22:31290854-31290876 GGAGGCGGAGCGGGGCCGGCCGG + Intronic
1184101544 22:42343869-42343891 GCGGGCGGAGGGCGGGCGGGCGG + Intergenic
1184442522 22:44526563-44526585 GCAGACGTAGCACTGCCAGGTGG - Intergenic
1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG + Intronic
1185338341 22:50280716-50280738 CCAGGCGTCGGGCGGGCGGGAGG - Intronic
950303072 3:11898746-11898768 GCAGGCCACGCGTGGCCGGGCGG + Intergenic
954437322 3:50503141-50503163 GAAGGAGTAGCGCGGACCGGGGG + Intronic
958732323 3:97972480-97972502 GCCGGCGTGGCGGGGCGGGGCGG - Intergenic
960281305 3:115784237-115784259 GCAGGCGCCGCCCGGTCGGGAGG - Intergenic
968657762 4:1785960-1785982 GCAGGCGTGGCGGGGAAGGGAGG + Intergenic
968880258 4:3294939-3294961 GCAGGGGTGGCGCGGCCTGAGGG + Intronic
969413289 4:7043266-7043288 GCAGGCGCAGAGCGGCGGGCCGG + Intronic
969566788 4:7983499-7983521 GCAGGTGTGGCGCGGCACGGAGG + Intronic
970004768 4:11399924-11399946 GCTGGCCTAGCTCGGCGGGGCGG + Exonic
973634878 4:52852587-52852609 GCAGGCCCAGCGCTGCCTGGAGG - Intergenic
974055170 4:56977003-56977025 GCAGGCGTAGAGCGCGCCGGTGG + Exonic
974069454 4:57110492-57110514 GCAGGCCCCGCGGGGCCGGGAGG - Intergenic
982134255 4:152258710-152258732 GCAGGCGGGGGGCGGGCGGGGGG - Intergenic
982564557 4:156971529-156971551 GCAGGCGGAGAGAGGCCGCGGGG + Intergenic
982584773 4:157222446-157222468 GCAGGCTCAGGCCGGCCGGGTGG + Intronic
991298187 5:65103092-65103114 GGAGGCGGGGCGCGGCGGGGCGG - Intergenic
997621899 5:135304564-135304586 GCAGGAGAAGCGCGGGCAGGCGG + Intronic
997659514 5:135578748-135578770 GCAGGAGCAGCGCGGCCGCCAGG + Exonic
998463127 5:142324038-142324060 GCAGCCCTAGCGCGGCCTGGGGG + Intronic
1002662782 5:180802854-180802876 GCAGGCGGGGCGGGGCGGGGCGG + Intronic
1003624054 6:7726931-7726953 GCGGGGGCAGCCCGGCCGGGCGG + Exonic
1004395799 6:15245632-15245654 GCTGGCGTGGGGCGGCCGTGGGG + Intergenic
1006404756 6:33838484-33838506 GCAGGCGTGGGGAGGCGGGGAGG - Intergenic
1013422307 6:109978151-109978173 GCAGGGGGAGTGCGGCGGGGAGG + Intergenic
1018806943 6:167269105-167269127 GCAGCCGTAGCGAGGCTGAGAGG + Intergenic
1024639382 7:51316932-51316954 GCAGGCGGGGCGGGGCGGGGCGG - Intergenic
1025089667 7:56051782-56051804 GCCGGCGCGGCGTGGCCGGGAGG - Exonic
1034475081 7:151277008-151277030 GCCGGCGCAGCGCGGCCGGGAGG + Intronic
1040470260 8:47730755-47730777 GCAGGGGTAGTGGGGCAGGGAGG - Intronic
1041689887 8:60678658-60678680 GCGGGCGCGGCGCGGCCCGGAGG + Intergenic
1045516479 8:102864407-102864429 GCAGGCGAAGGGCGGCCGCGCGG + Exonic
1047423764 8:124727815-124727837 GGAGGCGAAGCGCGGCGGCGAGG + Intronic
1048553896 8:135457351-135457373 GCAGGCGCGGCGCGGCAGGGCGG + Intergenic
1049509131 8:143018892-143018914 GCAGCCCTGGGGCGGCCGGGAGG - Exonic
1049604978 8:143525189-143525211 GCAGGCCGAGCGCTGCTGGGAGG - Intronic
1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG + Intronic
1051659033 9:19408908-19408930 GCAGGCGAGGCGAGGCGGGGCGG + Intergenic
1053381282 9:37651171-37651193 GCAGGCGGAGGGCGGCGCGGAGG - Intronic
1056643178 9:88388299-88388321 GCAGGCGCAGTGGGGCGGGGCGG - Intergenic
1058937119 9:109779960-109779982 GCTGGCGTGGCGCGCCCGCGTGG - Intronic
1059414751 9:114155857-114155879 GCCGGCCTGGCGCGGCGGGGCGG + Exonic
1060629450 9:125143130-125143152 GCTGGCGGCGCGGGGCCGGGAGG - Intronic
1060970046 9:127732633-127732655 GGAGGCGTGGCGCAGCCGGCGGG - Exonic
1061128220 9:128689763-128689785 GGGGGCGCGGCGCGGCCGGGCGG + Intronic
1062162390 9:135087609-135087631 GGAGGCGGGGCTCGGCCGGGCGG - Intronic
1192533743 X:71911174-71911196 GCAGGCTGAGCGCTGCCAGGTGG - Intergenic
1193135798 X:77969509-77969531 GGAGGCGAAGCGCGGCGGGCAGG - Exonic
1195072139 X:101291380-101291402 GGAGGCGTGGCGAGGCGGGGAGG - Intronic
1197754496 X:129984295-129984317 GCAGGCGGCGCGCGGTGGGGAGG + Intronic
1199119618 X:144036120-144036142 ACAGGCGTAGGGTGGCAGGGAGG + Intergenic
1200098171 X:153673829-153673851 GCCGGCGGGGCGCGGGCGGGGGG - Intronic