ID: 1184767182

View in Genome Browser
Species Human (GRCh38)
Location 22:46577850-46577872
Sequence TGGCACCTTGGCTGTAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184767171_1184767182 22 Left 1184767171 22:46577805-46577827 CCTTTGTTCGGGATGTTGAGCTC 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1184767182 22:46577850-46577872 TGGCACCTTGGCTGTAGCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 242
1184767170_1184767182 23 Left 1184767170 22:46577804-46577826 CCCTTTGTTCGGGATGTTGAGCT 0: 1
1: 0
2: 1
3: 2
4: 62
Right 1184767182 22:46577850-46577872 TGGCACCTTGGCTGTAGCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184767182 Original CRISPR TGGCACCTTGGCTGTAGCCC AGG Intronic
900110468 1:1003333-1003355 TGGATCCTGGGCTGCAGCCCAGG + Intergenic
900159391 1:1216353-1216375 TGGCACCTGGGCTGGTTCCCAGG - Intergenic
900985102 1:6068712-6068734 TTGCACCCTGGCTGTGGCCCTGG - Intronic
901678184 1:10898769-10898791 TGCACCCTTGGCAGTAGCCCCGG - Intergenic
903428205 1:23270585-23270607 TGACACCTTGATTTTAGCCCAGG + Intergenic
904629556 1:31830670-31830692 AGCCACCTTGGCTGCAGCCCAGG - Intergenic
907074813 1:51568590-51568612 TGTCACCCAGGCTGTCGCCCAGG + Intergenic
909674430 1:78223513-78223535 TGGCTTCTTGGCTATAGCCCTGG - Intergenic
910221666 1:84894228-84894250 TGAAAACTTAGCTGTAGCCCCGG - Intergenic
912274589 1:108242891-108242913 AGGCAACTTGGATGGAGCCCAGG + Intronic
912286678 1:108376967-108376989 AGGCAACTTGGATGGAGCCCAGG - Intronic
912293629 1:108451450-108451472 AGGCAACTTGGATGGAGCCCAGG - Intronic
912457000 1:109804708-109804730 TGACACCTTCACTGCAGCCCTGG - Intergenic
912690926 1:111804167-111804189 TGTCACCTTGGCGGAAGCCAGGG - Intronic
914364682 1:146967674-146967696 AAGCACCTTGGATGGAGCCCAGG - Intronic
914486997 1:148119478-148119500 AAGCACCTTGGATGGAGCCCAGG + Intronic
915348154 1:155208552-155208574 TGGCTCCTCGCCTGTACCCCTGG - Intronic
917656477 1:177131121-177131143 AGGCACATTCACTGTAGCCCAGG - Intronic
921154231 1:212426215-212426237 TGGCACCCGGGCAATAGCCCTGG + Intergenic
922127390 1:222741551-222741573 TGGCATCTTCTCTGTCGCCCAGG + Intronic
1063055015 10:2495419-2495441 TGACACCTTGACTGCAGCCAGGG - Intergenic
1063640350 10:7823608-7823630 TGGCATCTTGCTTGTTGCCCAGG - Intronic
1063764778 10:9126489-9126511 TGGGACCTTGCTTGTTGCCCAGG - Intergenic
1063978825 10:11437708-11437730 TGGCAGCTGGGCTGGACCCCAGG + Intergenic
1064005581 10:11696485-11696507 TGTCACCCAGGCTGTGGCCCAGG + Intergenic
1064104543 10:12490035-12490057 TGGCTCCTTGGCTGGAGCAGGGG + Intronic
1066246984 10:33593091-33593113 TGGAATCTTGGCAGTAGCCTTGG - Intergenic
1067526915 10:47044736-47044758 TGGCACTGGGGCTGGAGCCCAGG - Intergenic
1068899915 10:62256248-62256270 TGGGAGGATGGCTGTAGCCCAGG - Intronic
1069950136 10:72012986-72013008 TGGCGCCATGTCTGTAGCCTTGG - Exonic
1070306110 10:75240091-75240113 TGGCCACTTGGCTTTAGCCTTGG + Intergenic
1071581015 10:86770196-86770218 TGGCAGATTGGCTTGAGCCCAGG + Intronic
1072086313 10:92082849-92082871 TTGCACATTGGCTGTGGCCCAGG - Intronic
1072378407 10:94840426-94840448 AGGCACCTAGGCTATAACCCAGG - Intronic
1074469186 10:113711654-113711676 TGGCTCCTTGGCTCTTGGCCAGG - Intronic
1075122996 10:119678070-119678092 TGGCACCTTGGCTGTTGGCTGGG - Intergenic
1075210274 10:120485094-120485116 TAGCACTTTGCCTTTAGCCCAGG + Intronic
1076652045 10:131996673-131996695 TGGCAGCTTGGGTGCAGGCCCGG - Intergenic
1077252918 11:1568525-1568547 TGGCACCTCTGCTGTTGCCATGG - Intronic
1077336065 11:2005163-2005185 GGGCACCTTGGCTGGGGCTCTGG - Intergenic
1077375800 11:2204616-2204638 GGGCACCTAGGCTGTAGCAGGGG - Intergenic
1078120739 11:8506463-8506485 TGACACCTTGATTTTAGCCCAGG - Intronic
1079470903 11:20776408-20776430 TGTCACCCAGGCTGTTGCCCAGG - Intronic
1083774495 11:64887895-64887917 TGGCACCTGGGCTGTGCCCTAGG + Intronic
1084010630 11:66346571-66346593 TGGTACCTTGGCAGGACCCCTGG - Exonic
1084399678 11:68936448-68936470 TGGCAGCGTGGCTGGAACCCTGG - Exonic
1084551945 11:69849323-69849345 GCACACCTTGGCTTTAGCCCAGG + Intergenic
1084894548 11:72256270-72256292 TGACACCTTGATTGTAGCCTTGG - Intergenic
1084978432 11:72815731-72815753 TGTCACCTTGACTGAGGCCCTGG - Intronic
1085019767 11:73198554-73198576 TGGCACCTTGGATGGAATCCTGG - Intergenic
1085047493 11:73362214-73362236 TGGCAGCGAGGCTGCAGCCCGGG - Exonic
1085141066 11:74142207-74142229 TGGAACATTTGCTGTATCCCTGG + Intronic
1085520806 11:77138054-77138076 TGGCACCGCGGCGGTAGGCCCGG - Intronic
1086156471 11:83672227-83672249 TGGCACCATTGCAGTAGCCTGGG - Intronic
1089379395 11:118016580-118016602 TGGCCTCTTGGCAGTATCCCTGG - Intergenic
1089535922 11:119160768-119160790 GGGCACCCTGGCTGCACCCCAGG + Intronic
1089932080 11:122323010-122323032 TGGAACGTTGGCTTTAACCCTGG - Intergenic
1090851270 11:130572531-130572553 TGGAGACCTGGCTGTAGCCCAGG + Intergenic
1202819049 11_KI270721v1_random:60345-60367 GGGCACCTTGGCTGGGGCTCTGG - Intergenic
1092317297 12:7431389-7431411 TGTCACCCAGGCTGTTGCCCAGG - Intronic
1096123929 12:49106117-49106139 TGCCACCTTGGCTGGAGAACAGG - Intronic
1096981232 12:55729054-55729076 GGGGACCGTGGCTGGAGCCCGGG - Intronic
1099034194 12:77564933-77564955 TGGCTCATTGACTGTAGGCCAGG + Intergenic
1100673737 12:96844467-96844489 TGACACCTTGACTTTAGCCCAGG + Intronic
1101964859 12:109275521-109275543 TGACACCTTGATTTTAGCCCAGG - Intergenic
1102627565 12:114247599-114247621 TGGAACCTTGGCTGTTTCACTGG + Intergenic
1102813297 12:115842463-115842485 TCACACCTTGACTTTAGCCCAGG + Intergenic
1103624029 12:122205170-122205192 TGGCACCTTGCGTGAAGACCTGG - Intronic
1103730472 12:123024024-123024046 TGGCAGGATGGCTGGAGCCCAGG + Intronic
1103832205 12:123788831-123788853 TGGCACGTTGGCTTGAGCCTGGG + Intronic
1104070061 12:125336799-125336821 AGACACCTGGGCTGGAGCCCCGG - Intronic
1104091711 12:125523252-125523274 TGACAACTTTGCTTTAGCCCAGG - Intronic
1106639904 13:31573102-31573124 TGGCACCTTGGCGGGGACCCTGG - Intergenic
1107284356 13:38773481-38773503 TGGGAGCTTTGCTTTAGCCCAGG - Intronic
1107555869 13:41516286-41516308 TGGCAACCTGCCTGGAGCCCAGG - Intergenic
1108258396 13:48632408-48632430 TGGCACTTTGCCTGCATCCCAGG - Intergenic
1108876358 13:55054994-55055016 AGGCATCTAGGCTGTAACCCAGG + Intergenic
1109494891 13:63157061-63157083 TGACACCTTGGCTGGAGTACTGG + Intergenic
1109931457 13:69222984-69223006 AGGCACCTAGGCTATAACCCAGG + Intergenic
1111021607 13:82458647-82458669 AGGCACCTAGGCTATAACCCGGG + Intergenic
1113477633 13:110596066-110596088 TGGCAACGTGCCTGTAGTCCTGG - Intergenic
1113914812 13:113863897-113863919 TGGCCCCTTCGCTCTCGCCCGGG - Exonic
1115870744 14:37799846-37799868 TGACACCTTGACTGAAGCCTGGG + Intronic
1116076693 14:40119825-40119847 TGGCACCTTGGACTTAGCCCAGG + Intergenic
1116777765 14:49201452-49201474 TGGCACACTGGCTGTAGCCCTGG - Intergenic
1117158653 14:52965903-52965925 TGGCAGCATGGCTTGAGCCCAGG - Intergenic
1118200479 14:63667302-63667324 TGGAATCTTGCCTGTGGCCCAGG + Intergenic
1118432544 14:65734782-65734804 TGCCACCTTCTCTGTAGGCCTGG + Intronic
1118752367 14:68816509-68816531 CGGAACCTTGGCTGTTTCCCGGG - Intergenic
1119907581 14:78319678-78319700 TGGCACTGAGGCTGCAGCCCTGG + Intronic
1121251762 14:92505046-92505068 TGACACCTTGATTTTAGCCCAGG + Intergenic
1121280383 14:92693227-92693249 TTGCAGCTGGGCTGGAGCCCAGG - Intergenic
1121660148 14:95628952-95628974 TGACACCTTGATTTTAGCCCAGG - Intergenic
1121874415 14:97438398-97438420 AAACACCTTGGCTGTAGCCTTGG - Intergenic
1122797588 14:104213801-104213823 AGGCACCTTGGCTGTGGCCCAGG - Intergenic
1123458679 15:20448070-20448092 TGTCACCAAGGCTGGAGCCCAGG + Intergenic
1123659383 15:22552345-22552367 TGTCACCCAGGCTGGAGCCCAGG - Intergenic
1123971525 15:25512140-25512162 GGACACCTTGGTTTTAGCCCAGG + Intergenic
1124313247 15:28646836-28646858 TGTCACCCAGGCTGGAGCCCAGG - Intergenic
1125732481 15:41900971-41900993 TGGCACCCTCCCCGTAGCCCTGG + Exonic
1125749359 15:42018457-42018479 TGCCAGCTGGGCTGCAGCCCTGG + Intronic
1127892827 15:63270193-63270215 TGACACCTTGATTTTAGCCCAGG + Intergenic
1128166919 15:65473628-65473650 TGTCACCCTGGCTGTAGTGCAGG - Intronic
1130135638 15:81179575-81179597 TGTCACCTTGATTTTAGCCCAGG - Intronic
1131463085 15:92633684-92633706 AGTCACCTTGCCAGTAGCCCTGG + Intronic
1132995532 16:2820573-2820595 GGGCAGCCTGGCTGCAGCCCTGG - Intronic
1134005584 16:10817125-10817147 TGCCACCTTGGTTTCAGCCCAGG + Intronic
1135143033 16:19937823-19937845 TGGCACCTTGATTGTAGCTTGGG + Intergenic
1136274397 16:29169889-29169911 TGTCACCTTGGCTGGGGCACAGG + Intergenic
1138244167 16:55454208-55454230 TAGCTCTCTGGCTGTAGCCCAGG - Intronic
1139440480 16:66964160-66964182 TGGAACCTGGGCTTCAGCCCAGG - Intronic
1142078679 16:88135535-88135557 TGTCACCTTGGCTGGGGCACAGG + Intergenic
1142123498 16:88398775-88398797 TGGCTCCTTTGCAGCAGCCCAGG + Intergenic
1142155515 16:88531201-88531223 TGGCCCCTTGGCTGAAGACAGGG - Intronic
1142585392 17:969320-969342 TGGAAACTTGGCTGTTTCCCGGG - Intronic
1143417575 17:6760822-6760844 TGGTAGCTAGGCTCTAGCCCCGG - Intronic
1144739805 17:17575557-17575579 AGGCACTTCGGCTGCAGCCCTGG + Intronic
1145093032 17:20001547-20001569 TGTCACCCAGGCTGTTGCCCAGG + Intergenic
1145997188 17:29111518-29111540 TGGTGCCATGGCTGTGGCCCAGG + Exonic
1146219950 17:31009125-31009147 TCCCACCTGGGCGGTAGCCCAGG - Intergenic
1148578705 17:48728554-48728576 TGCCACCTTGGATGGAGCCAAGG - Exonic
1150373391 17:64661486-64661508 TCTCACCTGGGCGGTAGCCCAGG + Intronic
1150778827 17:68102281-68102303 TCTCACCTGGGCGGTAGCCCAGG - Intergenic
1151597814 17:75088622-75088644 AGGCTCCTGGGCTGGAGCCCTGG - Intronic
1151737147 17:75950378-75950400 TGGCACATTGCCTGTAATCCCGG - Intronic
1151937842 17:77274215-77274237 TGGCACCAGGGCTGTCGACCAGG - Intergenic
1152031465 17:77845958-77845980 TGACACCTTCCCTGCAGCCCCGG - Intergenic
1152083734 17:78204967-78204989 GGGCAGCTTGGCTGTATCCTAGG - Intronic
1158938469 18:62385500-62385522 TGGCAACCTGGCTCTGGCCCAGG + Exonic
1159180646 18:64898456-64898478 TGTCACCTTGGTTGAAGCCACGG + Intergenic
1159958523 18:74537572-74537594 TGGATCCCTGGCTGTGGCCCAGG + Intronic
1161016734 19:1987082-1987104 TGGAACCCTGGCTGAACCCCCGG - Intronic
1162562644 19:11426440-11426462 TGGCACCTTGGCAATGTCCCGGG + Exonic
1162889789 19:13724283-13724305 TGGAACCATGGCTGTACCGCAGG - Intergenic
1163133835 19:15294775-15294797 AGGCACCTTGGATGTTGGCCAGG - Intronic
1164064736 19:21706269-21706291 GGACACCCTGGCTGTAACCCTGG + Intergenic
1164172554 19:22738125-22738147 TGTCACCTTGGCACTGGCCCAGG + Intergenic
1164869342 19:31630185-31630207 TGGCACCTTGTTTGTAGCCTGGG + Intergenic
1165080849 19:33305182-33305204 TGGCAGCTTGGCTTTGGCCTTGG + Intergenic
1166197934 19:41219121-41219143 TGGCCCCTGGGCTCTGGCCCTGG + Intergenic
1166389835 19:42402711-42402733 TGGCACCCTGGCTGGAGCGTCGG + Exonic
1166525835 19:43509131-43509153 TGTGACCTTGGCTGTCACCCAGG + Intronic
1167087051 19:47317468-47317490 TGTCACCCAGGCTGTAGCTCAGG - Intronic
1167419583 19:49395104-49395126 AGGCACTGTGGCTGTGGCCCAGG + Exonic
1168142571 19:54398935-54398957 TGGCCCCTTGATTGCAGCCCGGG - Intergenic
924974740 2:162263-162285 TGTCACCTTGGCTGAAGTGCTGG - Intergenic
925925950 2:8670767-8670789 TGGCAGGTGGGCTGTGGCCCAGG - Intergenic
927044503 2:19263305-19263327 TGGGACCATGGCTGTATCCCCGG + Intergenic
927113108 2:19878312-19878334 TGGCACCTGAGCCGTAGGCCAGG + Intergenic
927960067 2:27235577-27235599 TGGCATAGAGGCTGTAGCCCAGG - Exonic
927975445 2:27335050-27335072 GGGCACCCAGGCTGGAGCCCTGG - Intronic
932800215 2:74735148-74735170 AGGCACCAGGCCTGTAGCCCAGG + Intergenic
932917339 2:75873025-75873047 AGGCACCTAGGCTATAACCCAGG + Intergenic
933782235 2:85810824-85810846 GGGCACCTTATCTGCAGCCCAGG + Intergenic
934220365 2:90076603-90076625 TGCCAGCCTGACTGTAGCCCTGG + Intergenic
934792420 2:97072744-97072766 AGGCACTTTGGCAGTATCCCTGG - Intergenic
934814199 2:97310965-97310987 AGGCACTTTGGCAGTATCCCTGG + Intergenic
934823495 2:97397518-97397540 AGGCACTTTGGCAGTATCCCTGG - Intergenic
941857831 2:170248511-170248533 TGACACCTTGATTTTAGCCCAGG - Intronic
943723637 2:191230726-191230748 TGGCACCTGGGCCATAGCACGGG - Intergenic
947613143 2:231536207-231536229 TGGCACCTGGGCTGTCTGCCAGG - Intergenic
948408481 2:237740826-237740848 TGGCACCTGGGCCGTGGCCTCGG - Intronic
1169287833 20:4324450-4324472 TGGGACCTAGACTGAAGCCCTGG + Intergenic
1169340955 20:4795824-4795846 TGGCACTCTGGCTGTAACCTGGG - Exonic
1171277334 20:23869068-23869090 TGGCAACATGGCTGAATCCCTGG - Intergenic
1172191536 20:33064712-33064734 GGGCACCTTGGCTGGGGCACGGG - Exonic
1172278202 20:33692379-33692401 TCCCACCTTCGCTGTGGCCCTGG - Intergenic
1172837895 20:37884837-37884859 TGCCGACTTGGCTGTGGCCCTGG - Intergenic
1173185889 20:40839889-40839911 AGGCACCTTGGTTGTTGGCCAGG + Intergenic
1173998398 20:47357211-47357233 TGGCCCCTTGGCTGTTTCCCCGG - Intergenic
1174164291 20:48573896-48573918 TGTCACCTAGGCTGGAGTCCAGG + Intergenic
1175021855 20:55859493-55859515 TGACACCTTGATTTTAGCCCAGG + Intergenic
1175645514 20:60667403-60667425 CAGCACCTTGACTGTAGCCTTGG + Intergenic
1176132837 20:63503499-63503521 TGGGACCTTGGGTGGGGCCCAGG - Intergenic
1177501961 21:21968317-21968339 TGGCACCTTGGTTGCTACCCCGG + Intergenic
1177894317 21:26843112-26843134 CGGCCCCTTGGCAGCAGCCCAGG - Intronic
1178610868 21:34078370-34078392 TTGTACCTTAGCTGTAGCTCAGG - Intronic
1179259445 21:39745315-39745337 AGGCACCTAGGCTATAGCCCAGG - Intergenic
1181668482 22:24414310-24414332 AGGCACCTTGCCTGTGGCTCTGG + Intronic
1181773436 22:25143128-25143150 TGGCACCTTGGCCGGTGCCCAGG - Intronic
1182288835 22:29263917-29263939 TGCCACCGTGGCTGTCGCCGTGG - Exonic
1182844409 22:33418675-33418697 TGGCCCCCTGGCTGTTGCCCAGG - Intronic
1183977832 22:41523480-41523502 GGGCAACTTGGCTGAAGCCTGGG + Intronic
1184767182 22:46577850-46577872 TGGCACCTTGGCTGTAGCCCAGG + Intronic
1184938010 22:47739320-47739342 CGGCACCTTGGCAGATGCCCAGG - Intergenic
950115711 3:10449301-10449323 GGCCACCTAGGCTGCAGCCCTGG + Intronic
951201020 3:19875537-19875559 AGGCACCTAGGCTATAACCCAGG - Intergenic
951669100 3:25160739-25160761 CGGCACCTTGACTTTAGCTCAGG - Intergenic
953888405 3:46733143-46733165 TGGCACCTTGCCGGTGGCCATGG - Intronic
954082344 3:48219977-48219999 TGGCTCCGTGTCTGCAGCCCTGG - Intergenic
954093305 3:48301966-48301988 AGGATCCTTGGCTGGAGCCCAGG + Intergenic
956021843 3:64941484-64941506 TGGCACCTTCCCTGTAGCCTGGG - Intergenic
958003054 3:87775775-87775797 TATCACCTTTGCTGTATCCCGGG + Intergenic
958466878 3:94470548-94470570 TGGTACTTTGGCTGTACTCCTGG + Intergenic
962414274 3:135168198-135168220 TGGCAGCTGGGCTGCTGCCCAGG + Intronic
962636598 3:137338344-137338366 GGGCACCCTGGATGTAGACCAGG - Intergenic
967488318 3:190059470-190059492 TGACACTATGGCTGGAGCCCAGG - Intronic
967623271 3:191659878-191659900 AGGCACATAGGCTGTAACCCAGG + Intergenic
970055312 4:11964937-11964959 TGGCACTGTGGCTGTATGCCTGG + Intergenic
972056975 4:34815418-34815440 TGACCCATGGGCTGTAGCCCTGG - Intergenic
972118604 4:35671235-35671257 TGGCATCTTGATTTTAGCCCAGG - Intergenic
972235845 4:37133377-37133399 TGACAACTTGGCTGTGGCCAGGG - Intergenic
973689999 4:53418018-53418040 TGGCACATTGCCTGTAATCCTGG + Intronic
976113592 4:81702628-81702650 TGGCCCCTTGTTTGTAGCCCTGG - Intronic
978365147 4:107973609-107973631 AGGCACCTGGGCTGGAGCCCTGG + Intergenic
980887358 4:138777814-138777836 TGGCTACATGGCTGTTGCCCTGG - Intergenic
982226891 4:153174545-153174567 TGGCAGGTTGGCCGCAGCCCTGG - Intronic
983896982 4:173091534-173091556 TGGCACCTTGCCTGCAGCTGTGG + Intergenic
989688160 5:44112436-44112458 AGGCACCTAGGCTATAACCCAGG + Intergenic
990287649 5:54315819-54315841 TGACACCTTGCATGTAGCCCTGG + Intergenic
991371080 5:65920614-65920636 TGGCACAATCGCTGGAGCCCAGG + Intergenic
993306723 5:86283614-86283636 AGGCAACTTGGATGGAGCCCAGG - Intergenic
994147133 5:96408230-96408252 TGGCATCTTCGCTCTGGCCCTGG - Exonic
994960466 5:106595182-106595204 TGGGAGGTTGGCTTTAGCCCAGG + Intergenic
996662883 5:126025719-126025741 TGGCTCCTTGGCTGATGCCCTGG - Intergenic
997212024 5:132082467-132082489 AGGCACCTTGGCTCTTGCCCAGG - Intergenic
1002623633 5:180508665-180508687 TGGCACCTGTGCTCTAGCCTGGG - Intronic
1004276004 6:14235793-14235815 TGTTTCCTTAGCTGTAGCCCAGG - Intergenic
1004458902 6:15817418-15817440 TGGGACCTCTGCTGTAGGCCAGG - Intergenic
1004626572 6:17382934-17382956 TGGCACAGTGTCTGTCGCCCCGG - Intergenic
1004900194 6:20186424-20186446 TGTCACCTTTCCTGGAGCCCAGG + Intronic
1005323973 6:24681704-24681726 AGGCACCTGGGCTGTAACCCAGG - Intronic
1006435256 6:34022738-34022760 TGGGCCCTTGGGTGTGGCCCTGG + Exonic
1007696553 6:43737491-43737513 GGGCTCCATGGCTGTTGCCCAGG + Intergenic
1007989295 6:46238589-46238611 TGTCACCTAGGCTGGAGTCCAGG + Intronic
1009544480 6:65006055-65006077 AGGCACCTAGGCTATAACCCAGG + Intronic
1009779593 6:68253099-68253121 TAGCACTTTTGCTGTATCCCAGG + Intergenic
1010150174 6:72722170-72722192 TGGTACCTTGACTTTAGCCCAGG + Intronic
1010893186 6:81338320-81338342 AGGCACCTAGGCTATAACCCAGG + Intergenic
1015334022 6:132014719-132014741 TGGCACCTTTGCTGTAAACCAGG + Intergenic
1017739834 6:157397366-157397388 TGACACCCTGATTGTAGCCCAGG - Intronic
1018443236 6:163832754-163832776 TGACACCTTGATTTTAGCCCAGG - Intergenic
1019192784 6:170263016-170263038 TGGCAGGATGGCTGGAGCCCAGG - Intergenic
1019440439 7:1043571-1043593 TGGCACAGTGGATGCAGCCCGGG - Intronic
1021168713 7:17372220-17372242 CAGCACCTTGACAGTAGCCCAGG - Intergenic
1021652760 7:22847696-22847718 TGTCACCCAGGCTGGAGCCCAGG + Intergenic
1021680773 7:23129091-23129113 TGGGACCTTGGCTGTGGATCAGG + Intronic
1028588925 7:92476830-92476852 AGGCACCTAGGCTATAACCCAGG - Intronic
1028775189 7:94668039-94668061 TGGGCCGTTGTCTGTAGCCCTGG + Exonic
1029155371 7:98513670-98513692 TGTCACCTAGGCTGGAGCACAGG - Intergenic
1030148134 7:106377052-106377074 TGTCACCTTGACTGGGGCCCGGG - Intergenic
1030503068 7:110384554-110384576 TGGGACCTTCCCTATAGCCCTGG + Intergenic
1030843832 7:114385190-114385212 AGGCACCTAGGCTATAACCCAGG - Intronic
1031264492 7:119566681-119566703 AGGCACCTAGGCTATAACCCAGG + Intergenic
1032011444 7:128350653-128350675 TGCCACCTTCTCTGGAGCCCTGG - Exonic
1032130675 7:129225099-129225121 AGGCACCTTGGCGGCAGCCGCGG - Exonic
1034830763 7:154305493-154305515 TGGCTCCTTGGCTGTGGTCATGG - Exonic
1034863298 7:154618630-154618652 TGGAAGCTGGGCTGTGGCCCCGG - Intronic
1035390508 7:158501284-158501306 TGTTTGCTTGGCTGTAGCCCCGG - Intronic
1035948560 8:3993019-3993041 TGGGTCCCTGGCTGGAGCCCTGG + Intronic
1038344343 8:26718446-26718468 TGTCACCTTGGTTGGACCCCAGG - Intergenic
1040979680 8:53233765-53233787 TGACACCCAGGCTGTACCCCAGG + Intronic
1041099552 8:54382208-54382230 TGGCTCCTTGGCTGCGGGCCAGG - Intergenic
1047125104 8:121951340-121951362 TGACACCTTGACTTTGGCCCTGG - Intergenic
1047213982 8:122862316-122862338 TGCCACCATGGCTGTGGACCTGG - Intronic
1047295881 8:123570182-123570204 TGACACCTTGATTTTAGCCCAGG + Intergenic
1049083945 8:140463511-140463533 TGGGACGTTGGCTTGAGCCCAGG - Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1057939845 9:99272430-99272452 TGTCACCGAGGCTGTTGCCCAGG + Intergenic
1058671037 9:107360513-107360535 TGGCACCTTGATTTTAGCCCAGG - Intergenic
1059537140 9:115091427-115091449 TTGTATCTTGGCTGTAGCTCTGG + Intronic
1059701290 9:116777442-116777464 CGGCACCTAGGTTGTAACCCAGG + Intronic
1062249325 9:135586368-135586390 GGACACCTTGGCTGTAGCCAGGG + Intergenic
1062576994 9:137213563-137213585 TGGCACCCTGGCAGCTGCCCTGG + Intronic
1191800856 X:65077628-65077650 GGGTACCTTGGCTGTAGAACAGG + Intergenic
1193079976 X:77397268-77397290 TGACACCTTGATTTTAGCCCAGG - Intergenic
1199750260 X:150809152-150809174 TAGCACCTTGATTTTAGCCCAGG + Intronic
1199923114 X:152430478-152430500 TGGCAACTGGGGTGTTGCCCAGG + Intronic
1201499033 Y:14621716-14621738 TGGGAGGTTGGCTTTAGCCCAGG + Intronic